Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2026 Sep 22;105(12):107834. doi: 10.1016/j.psj.2026.107834

Isolation, identification, and pathogenicity of Novel Duck Reovirus strain from ducklings in China

Zhixian Wang a,c,1, Jia Tan a,b,1, Haoran Xi a,b, Yao Hu a,b, Xu Lei d, Meifang Tan a,b, Jiazhen Wei c,e, Cui Lin a,b, Fanfan Zhang a,b, Yanbing Zeng a,b, Chengcheng Wu a,b, Na Li a,b, Jiangnan Huang a,b, Haiqin Li a,b,⁎
PMCID: PMC13634508  PMID: 42785070

Abstract

Novel duck reovirus (NDRV) is a prevalent pathogen that seriously threatens China’s waterfowl industry. It primarily induces hemorrhage and necrosis in the liver and spleen of ducklings, leading to immunosuppression and even causes high mortality in severe cases. In this study, a total of 150 tissue samples were collected from diseased ducks in Jiangxi Province, China. Among these samples, 40 were confirmed to be NDRV-positive. To further characterize the prevalent NDRV strains, virus isolation and identification were carried out using these positive samples, and four strains (NDRV-JX01, NDRV-JX02, NDRV-JX11, NDRV-JX12) were successfully isolated. Phylogenetic analysis based on the σC gene showed that the four strains clustered with the same evolutionary branch as prevalent NDRV strains in China, with the amino acid identity ranging from 94.1% to 99.1%. Pathogenicity revealed that the NDRV-JX01 strain was pathogenic to one‑day‑old mule ducklings, triggering depression, anorexia, and even death, with a mortality rate of 33.3%. Histopathological analysis revealed that lesions were mainly concentrated in the spleen, liver, and bursa of Fabricius, with lesion severity positively correlated with the clinical symptoms and gross lesions. Tissue tropism analysis further indicated that the NDRV-JX01 strain exhibited a broad tissue infection spectrum in ducklings, with the highest viral loads detected in the spleen, liver, and bursa of Fabricius. Moreover, NDRV-JX01 infection was found to trigger hepatic dysfunction and significantly alter the expression profiles of immune-related genes in ducklings. In summary, these findings expand our knowledge of the genetic diversity and pathogenic characteristics of NDRV, and provide reliable theoretical support for the prevention and control of this pathogen in waterfowl.

Keywords: Novel duck reovirus, Virus isolation and identification, σC gene, Phylogenetic analysis, Pathogenicity study

Introduction

Novel duck reovirus (NDRV) belongs to the genus Orthoreovirus within the family Reoviridae (Huang, et al., 2026). It was first reported in Fujian Province, China, in 2005. Since then, this virus has triggered widespread outbreaks in multiple regions of China, posing a serious threat to the development of China’s waterfowl farming industry (Liu, et al., 2010; Chen, et al., 2019; Yun, et al., 2022). NDRV has a wide host range and can infect multiple duck breeds including Muscovy duck (Chen, et al., 2019; Liu, et al., 2025), Mule duck (Zeng, et al., 2025), Cherry Valley duck (Li, et al., 2016; Li, et al., 2024) and Pekin duck (Zheng, et al., 2016; Cao, et al., 2019). NDRV primarily infects ducklings within 25 days of age; the younger the affected ducklings, the higher their mortality rate (Zeng, et al., 2025). Previous studies have demonstrated that the mortality caused by NDRV varies with virus strain, host age, inoculation route and host species. NDRV-FJ19 causes overall mortality of 46.7% in one-day-old ducklings and 33.3% in one-day-old chicks (Yang, et al., 2023). Strain SD416 causes mortality of 40% in one‑day‑old ducklings, whereas seven and fourteen-day-old ducklings exhibit clinical signs without mortality (Wang, et al., 2026). For strain LY20, mortality varies across inoculation routes, reaching 30% for footpad inoculation, 20% for intramuscular inoculation, and 17% for oral administration (Li, et al., 2023). NY01 causes 36% mortality in one-day-old mule ducklings, while one-day-old shelduck ducklings show no mortality (Zeng, et al., 2025). Clinically, affected ducklings appear lethargic with reduced feed intake. The virus induces hemorrhage and necrosis in the liver and spleen of ducklings, which further compromises the host’s immune defense and increases susceptibility to other pathogens, ultimately leading to secondary and co-infections (Zheng, et al., 2016; Xu, et al., 2025; Huang, et al., 2026). Thus, it seriously constrains the healthy development of China’s waterfowl industry.

NDRV virions are icosahedral, non-enveloped, and approximately 60-85 nm in diameter, appearing as either dispersed or crystalline lattice arrays in infected cells (Li, et al., 2023a). Multiple methods are available for NDRV isolation, among which inoculation into specific pathogen‑free (SPF) chicken embryos, duck embryos, or susceptible cell lines is the most widely used approach (Liu, et al., 2010; Yang, et al., 2020). NDRV consists of 10 double-stranded RNA genome segments, which are divided into three categories based on molecular weight: large (L1-L3), medium (M1-M4), and small (S1-S4) segments (Yun, et al., 2018; Franzo, et al., 2024). These genomic segments are susceptible to genetic reassortment and homologous recombination, leading to remarkable genetic diversity among different NDRV strains (Fang, et al., 2026). The S1 gene segment of NDRV is similar to Avian reovirus (ARV), but markedly different from classical Muscovy duck reovirus (MDRV) (Wang, et al., 2012; Du, et al., 2020). It contains three consecutive overlapping open reading frames (ORFs), encoding P10, P18 and σC proteins respectively (Kong, et al., 2023; Farkas, et al., 2025). The σC protein binds to surface receptors on host cells to mediate viral infection, while exhibiting high variability. Thus, the σC gene is a key target for NDRV genotyping, sequence variation analysis, immunogenicity study and cross-protection evaluation among different strains (Bi, et al., 2016; Zhang, et al., 2020).

The liver is not only a metabolic hub but also a critical immune-functional organ with a unique microenvironment, serving an important role in defending against pathogen infections (Ronca, et al., 2024). During viral infection, the liver serves as both a hub for immune responses and a primary target of immune-mediated injury (Wohlleber and Knolle, 2025). Notably, NDRV infection causes hemorrhagic and necrotic hepatitis, accompanied by severe hepatocyte degeneration and necrosis (Wang, et al., 2020; Sun, et al., 2025). Studies have shown that NDRV infection significantly upregulates the expression of multiple innate immunity-related genes in the liver (Huang, et al., 2026). Therefore, the liver is a core target organ in the pathogenesis of NDRV.

In this study, four NDRV strains were isolated from tissue samples of diseased ducks in Jiangxi Province, China. Phylogenetic analysis of the σC gene revealed the epidemiological profiles of these isolates. A duckling infection model was successfully constructed. Using this model, we further confirmed that NDRV exhibits specific tropism for immune organs as well as broad tropism for other host tissues. These findings lay a robust theoretical foundation for the clinical diagnosis as well as targeted prevention and control of NDRV.

Materials and methods

Sample collection

A total of 150 tissue samples from diseased ducks with hemorrhagic necrosis of the liver and spleen were collected in Jiangxi Province, China. All tissue samples obtained from diseased ducks were stored at -80°C.

Virus isolation and identification

Viral nucleic acids were extracted using the TaKaRa MiNiBEST Viral RNA/DNA Extraction Kit (TaKaRa, Dalian, China). All samples were detected using reverse transcription polymerase chain reaction (RT-PCR) with primers listed in Table 1. The results showed that only NDRV was positive, while all other viruses including MDRV, ARV, Duck Tembusu virus (DTMUV), Fowl Adenovirus (FAdV), Duck Parvovirus (DPV), Duck circovirus (DuCV) were negative. Samples with single NDRV infection were homogenized in phosphate-buffered saline (PBS, pH 7.2), then centrifuged at 4°C at 12,000 × g for 5 min, and the supernatant was collected. The supernatant was filtered through a 0.22 µm filter and then inoculated into nine-day-old duck embryos via the allantoic cavity at 200 µL per embryo, while the control group received an equivalent dose of physiological saline. All embryos were incubated at 37 °C, and those that died between 24 and 120 hours post‑infection (hpi) were collected. After several serial passages, the harvested virus suspension was then inoculated onto leghorn male hepatoma (LMH) and chicken embryo fibroblasts (DF-1) cells, and cytopathic effects (CPE) were monitored.

Table 1.

Primer sequences for detection used in this study.

Name Sequences (5’ to 3’) Amplicon size
(bp)
NDRV-F ATGTCGCTGTCACGGGTAA 196
NDRV-R TGGTAGGAACCACGCTCAA
NDRV-σC-F ATGGATCGCAACGAGGTGATACGC 966
NDRV-σC-R CTAGCCCGTGGCGACGGTGAAGCGT
MDRV-F TCGTGCCTGTTTGTGGTG 349
MDRV-R CCCGGACAGTCTTAATGTGA
ARV-F ATGCTGCGTATGCCTCCCG 297
ARV-R TCAAACGTCGTATGGCGGAG
DTMUV-F ACATCTCGGCCAAAGAAGGA 330
DTMUV-R GGTCGCATTACCTTCACCAC
FAdV-F AAGTTCAGGCAGACGGT 884
FAdV-R TAGTGATGCCGGGACATC
DuCV-F GATCCTCTGATCTGGCCGAA 351
DuCV-R TTCCAATCACGTTGCGTCTC
DPV-F TGCCGGGACCTAAATTCCT 301
DPV-R TTCCACCCTACTCCATTCGT
Open in a new tab

Phylogenetic analysis

Nucleic acids were extracted from the virus suspension using the above method. Viral RNA was then reverse transcribed into complementary DNA (cDNA) with the HiScript II Reverse Transcriptase Kit (Vazyme, Nanjing, China). PCR amplification was performed using specific primers for the viral σC gene. The amplified products were recovered and purified, then ligated into the pMD18-T vector and transformed into E. coli DH5α competent cells. The plasmid DNA was extracted and sent to Sangon Biotech (Shanghai, China) for sequencing. The sequences were submitted to GenBank and assigned the following accession numbers: NDRV-JX01 (GenBank: PX580558.1), NDRV-JX02 (GenBank: PX580559.1), NDRV-JX11 (GenBank: PX580567.1), and NDRV-JX12 (GenBank: PX580568.1). A phylogenetic tree was constructed in MEGA 11 using the neighbor‑joining method with 1,000 bootstrap replicates, based on the σC gene sequences of strains NDRV-JX01, NDRV-JX02, NDRV-JX11, and NDRV-JX12 alongside reference sequences retrieved from GenBank. Concurrently, the amino acid identity was calculated using the Clustal W algorithm in MegAlign.

Embryo lethal dose 50 (ELD50) test

The virus suspension of NDRV-JX01 strain was serially diluted 10-fold in PBS (10-1 to 10-6). The diluted allantoic fluid was inoculated into nine-day-old duck embryos at 200 μL per embryo (n = 6). Simultaneously, six additional duck embryos were injected with an equivalent dose of PBS as a negative control. All embryos were placed in a 37°C incubator and monitored daily. The number of dead embryos at each dilution was recorded between 24 and 120 hpi, with the ELD50 calculated using the Reed-Muench method.

Tissue culture infectious dose 50 (TCID50) test

LMH cells were seeded into 96‑well plates and cultured until reaching 80% confluence. The virus suspension of NDRV-JX01 strain was serially diluted 10‑fold (10⁻¹ to 10⁻⁷), and 100 μL of each dilution was inoculated onto the cells with eight replicates per dilution. Mock-infected cells received only Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 1% Fetal Bovine Serum (FBS). After adsorption at 37°C in a 5% CO₂ incubator for 2 h, the medium was replaced with DMEM containing 1% FBS and incubation was maintained for 72 h. At the end of the culture period, cells were fixed with 4% paraformaldehyde (PFA) at room temperature for 20 min, then blocked with PBS containing 5% non‑fat dry milk for 1 h at room temperature. Subsequently, the cells were incubated overnight at 4°C with a mouse monoclonal antibody against the NDRV σC protein. After washing, Alexa Fluor 488‑conjugated goat anti‑mouse secondary antibody was added and incubated for 1 h at 37°C in the dark. Between each step, cells were washed three times with PBS. Specific fluorescent signals were observed under an inverted fluorescence microscope, and the viral titer was calculated using the Reed‑Muench method.

Pathogenicity experiment in ducklings

One-day-old healthy mule ducklings free from specific maternal antibodies were randomly divided into a control group and an infected group (n = 60). Healthy ducklings in the infected group were subcutaneously injected with 0.2 mL virus suspension of the NDRV-JX01 strain (ELD₅₀ = 10-4.57/0.2 mL) via the neck, while those in the control group were subcutaneously injected with an equivalent dose of PBS. After inoculation, the two groups were housed in separate rooms under identical temperature and humidity, with sterilized water and antibiotic-free feed provided. Clinical symptoms, gross lesions and mortality of each group were monitored daily. At 1, 3, 6, 9, 12 and 15 days post-infection (dpi), six ducklings randomly chosen from each group were weighed, euthanised and the gross lesions of each duckling were recorded in detail. At each time point, blood and tissue samples (liver, spleen, kidney, bursa of Fabricius and duodenum) were collected immediately. Tissues viral loads were determined using RT-qPCR. Tissue samples collected from both groups at 3 dpi were fixed in 10% neutral buffered formalin and processed for routine histopathological examination with hematoxylin-eosin (H&E) staining. For ultrastructural analysis, liver and spleen tissues were fixed, dehydrated, embedded in resin, ultrathin-sectioned, stained with uranyl acetate and lead citrate, and examined under a transmission electron microscope (TEM).

The relative mRNA expression in livers from infected ducklings

Total RNA was extracted using the Trizol reagent (Servicebio, Wuhan, China) following the manufacturer’s guidelines and reverse-transcribed into cDNA. The mRNA expression levels of IFN-α, IFN-β, IFN-λ, IFITM1, IFITM2, TLR3, RIG-I, and the reference gene GAPDH were measured by RT-qPCR using SYBR Green Premix (Servicebio, Wuhan, China). Primers for the target genes were designed with Primer 5.0 software, and their sequences are listed in Table 2. Amplification and fluorescence signal acquisition were performed on the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, USA) under the following conditions: initial denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 15 s and 60 °C for 30 s. All samples were run in triplicate for each RT-qPCR assay. Relative transcript levels were analyzed by using the 2−ΔΔCT method.

Table 2.

Immune-related primer sequences.

Gene Accession number Prime sequence (5’ to 3’)
IFN-α XM_038169814.2 F: AACCAGCTTCAGCACCACATC
R: TAGGTGTGGTTCTGGAGGAAGTG
IFN-β NM_001310827.2 F: CACTACATCTACCACCTCGAGCG
R: CGCCGTATTAGCGTGTCCAG
IFN-λ NM_001310417.1 F: GACTTGCCAGACCTACTGCTTG
R: TCTTTAGCATTTCCAAGTACAGGGT
IFITM1 NM_001310823.1 F: ACCCAAGGACTTTGTGCTCTG
R: CTGCCAGAATGACCACAAGGAT
IFITM2 NM_001310785.1 F: TTCTTTCTCTGGTCCCTCTTCA
R: GTGATGACAGCCACGAAGACA
TLR3 NM_001310782.1 F: TTCCAGTTCAGGTTTTCAAGGGT
R: GAGCCAAACACTTCTTCTTCAACT
RIG-I NM_001310380.1 F: GAAGCAAAGCAGCAGGCATAA
R: CTCCGAGCCTTCTTTGTTTCAT
GAPDH XM_038180584.2 F: ACGGGAATGCCATCACCATC
R: TTAGCACCACCCTTCAGGTGAG
Open in a new tab

Serum biochemical parameter analysis

Serum samples collected at 1, 3, 6, 9 and 12 dpi were centrifuged at 5,000 × g for 10 min, and the supernatants were stored at -80°C. Subsequently, serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and uric acid (UA) were determined by a fully automatic biochemical analyzer (URIT Medical Electronic Co., Ltd., Guilin, China) according to the manufacturer’s instructions.

Statistical analysis

Statistical analysis was performed using GraphPad Prism 9.5.0 (GraphPad Software, San Diego, CA, USA). P < 0.05 was considered to indicate a statistical significance, and P < 0.01 was considered to indicate a high degree of significance. The ELD₅₀ and TCID₅₀ were calculated using the Reed-Muench method based on cumulative mortality rates from serial dilutions of the virus.

Results

Pathological autopsy of diseased ducklings

The diseased ducks exhibited symptoms such as mental depression, anorexia, reduced mobility. Necropsy of ducklings revealed numerous hemorrhagic spots in the liver, splenomegaly accompanied by massive hemorrhage, and hemorrhages in the bursa of Fabricius (Fig. 1A). The histopathological lesions were consistent with gross findings (Fig. 1B): hepatocellular degeneration and edema were observed in the liver; splenic architecture was disrupted with necrosis; lymphocyte necrosis with pyknosis and karyorrhexis was noted in the bursa of Fabricius, and fibrous proliferation with inflammatory infiltration was present in the interstitium.

Fig. 1.

Fig. 1

Open in a new tab

Clinical necropsy of diseased ducks. (A) Gross pathological lesions of the liver, spleen and bursa of Fabricius in diseased ducks. (B) Histopathological changes in the liver, spleen and bursa of Fabricius in the diseased ducklings: the liver exhibited fatty degeneration characterized by variably sized cytoplasmic vacuoles (yellow arrows) and marked hydropic degeneration of hepatocytes (blue arrows); the spleen showed disrupted tissue architecture with extensive necrotic areas (black arrows); the bursa of Fabricius displayed considerable lymphocyte necrosis with pyknosis and karyorrhexis (black arrows), interstitial fibrosis with proliferation of fibrous connective tissue (green arrows), and infiltration of abundant inflammatory cells including lymphocytes, heterophils, and macrophages (red arrows). Scale bars = 100 µm.

Virus isolation and identification

After five passages, dead duck embryos within 24-120 hpi were collected. Compared with the control group, dead embryos exhibited thickened allantoic membranes, fetal edema, diffuse systemic hemorrhages, and prominent hemorrhages in the liver (Fig. 2A). Allantoic fluid from the fifth viral passage was harvested and inoculated onto DF‑1 and LMH cells. Typical CPE, including cell rounding, increased refractivity, syncytium formation and extensive cell detachment, was observed in both cell lines at 72 hpi. (Fig. 2B). The supernatants from both cell cultures were harvested and serially passaged, obtaining four NDRV strains (NDRV-JX01, NDRV-JX02, NDRV-JX11, NDRV-JX12).

Fig. 2.

Fig. 2

Open in a new tab

Isolation and identification of NDRV from diseased ducklings. Control means control group; NDRV means infection group. (A) Pathological lesions in duck embryos infected with NDRV. (B) Cytopathic effects (CPE) induced by NDRV in LMH and DF-1 cells. Scale bars = 100 µm.

Virus titer determination

Immunofluorescence staining confirmed that LMH cells infected with the NDRV-JX01 strain exhibited specific green fluorescence targeting the NDRV σC protein, whereas no fluorescent signal was detected in mock-infected cells (Fig. 3). The TCID₅₀ of the virus in LMH cells was 10-5.43/0.1 mL, as determined by the Reed-Muench method (Table S1). After the virus suspension was inoculated via the allantoic route into duck embryos, the ELD₅₀ was determined to be 10-4.57/0.2 mL (Table S2).

Fig. 3.

Fig. 3

Open in a new tab

Indirect immunofluorescence (IFA) analysis of the σC protein in NDRV-infected LMH cells. Scale bars = 50 µm.

System evolution analysis

To clarify the phylogenetic relationships between the four strains and other members of avian reoviruses, a phylogenetic tree was constructed based on the σC gene in this study. As shown in Fig. 4, the phylogenetic tree was divided into two major clades: a chicken-derived branch and a waterfowl-derived branch. The latter was further subdivided into NDRV, MDRV, and GRV lineages. The four strains obtained in this study clustered within the NDRV branch and exhibited high amino acid identity ranging from 98.4% to 99.7%. The amino acid identity between the four strains and other NDRV reference strains ranged from 94.1% to 99.1%, with the highest identity to the recently isolated strain NDRV-CD21 (GenBank: PQ562359.1).

Fig. 4.

Fig. 4

Open in a new tab

Phylogenetic analysis of the σC gene sequences of NDRV isolates with the neighbour-joining method.

Pathogenicity study of the NDRV-JX01 strain in ducklings

Throughout the entire experimental process, no abnormalities were observed in the control group (Fig. 5A). Notably, ducklings in the infected group began to die at 2 dpi, and the mortality rate reaching 33.3% (Fig. 5B-C). From 3 dpi onwards, the body weight of ducklings in the infected group was significantly lower than that of the control group (P < 0.05), with this difference persisting until 15 dpi (Fig. 5D). Gross pathological examination revealed no obvious lesions in ducklings from the infected group at 1 dpi. At 3 dpi, the liver, spleen and bursa of Fabricius were markedly swollen with increased hemorrhagic foci, and focal necrotic lesions were observed in the spleen. Both clinical signs and the pathological lesions were most severe at 3 dpi. Lesions remained severe at 6 dpi and then gradually regressed (Fig. 5E). Simultaneously, viral loads were detected in all examined tissues, with viral copy numbers rising from 1 dpi and peaking at 3 dpi. Among these tissues, the viral copy numbers were highest in the spleen, followed by the liver, bursa of Fabricius, duodenum and kidney (Fig. 5F).

Fig. 5.

Fig. 5

Open in a new tab

Pathogenicity of the NDRV-JX01 strain in ducklings. Control means control group; NDRV means infection group. (A) Control group. (B) Infected group. (C) Survival curve of the NDRV-infected ducklings. (D) Body weight changes in ducklings after NDRV infection. One-day-old ducklings were divided into infected and control groups (n = 60). Body weight was recorded at 1, 3, 6, 9, 12, and 15 dpi, and data are presented as mean ± SD. Statistical significance was determined using an unpaired Student’s t-test (* P < 0.05, ** P < 0.01). (E) Postmortem lesions of ducklings infected with NDRV. (F) Viral load distribution in different tissues from NDRV-infected ducklings.

Pathological changes in tissues induced by the NDRV-JX01 strain

To further determine the pathogenicity of the NDRV-JX01 strain in multiple tissues of mule ducks, we collected tissue samples to analyze the histopathological lesions. The results showed that ducklings in the infected group exhibited varying degrees of pathological lesions in multiple tissues compared with the control group (Fig. 6A). Specifically, the liver exhibited fatty degeneration and congestion; the spleen showed parenchymal necrosis; the bursa of Fabricius displayed considerable lymphocytic necrosis; the duodenum exhibited substantial epithelial cell sloughing. Transmission electron microscope analysis revealed that mature NDRV viral particles were clearly visible in the spleen of the infected group, appearing oval with diameters ranging from 60 to 80 nm. In the liver, mitochondria exhibited severe swelling, blurred membranes, dissolved and pale matrix, and fractured or absent cristae (Fig. 6B). Nevertheless, no lesions were observed in any tissues of the control group. In conclusion, these results indicate the multi-tissues tropism of the NDRV-JX01 strain.

Fig. 6.

Fig. 6

Open in a new tab

Pathological lesions in tissues and organs infected with NDRV. (A) Histopathological changes of the spleen, liver, bursa of Fabricius, and duodenum from ducklings infected with the NDRV-JX01 strain revealed varying degrees of lesions: the liver exhibited fatty degeneration (black arrow) and congestion (yellow arrow); the spleen showed extensive parenchymal cell necrosis (black arrow); the bursa of Fabricius exhibited considerable lymphocytic necrosis (yellow arrow); the duodenum exhibited substantial epithelial cell sloughing (black arrow). (B) Ultrastructural changes in the liver and spleen of ducklings induced by the NDRV-JX01 strain; red arrow indicates viral particles, M indicates mitochondria. Scale bars = 2.0 µm.

Innate immune gene expression in NDRV‑infected ducklings

The mRNA expression levels of pattern recognition receptors (TLR3 and RIG-I), interferons (IFN‑α, IFN‑β, and IFN‑λ), and antiviral effector genes (IFITM1 and IFITM2) in the liver tissues of ducklings were measured by RT-qPCR, and the results are presented in Fig. 7. At various time points post‑NDRV infection, the expression levels of the aforementioned genes were generally elevated compared with the control group, showing an overall upward trend. Specifically, the mRNA expression levels of TLR3 and RIG-I were significantly increased at 1, 3, and 6 dpi (P < 0.05); the mRNA levels of IFN‑α, IFN‑β, and IFN‑λ were significantly upregulated at 3 and 6 dpi (P < 0.05); and the mRNA expression levels of IFITM1 and IFITM2 were significantly elevated at 1, 3, and 6 dpi (P < 0.05). At 9 dpi, no significant differences were observed in the expression levels of all tested genes compared with the control group. Collectively, these results indicate that NDRV infection activates the host innate immune response.

Fig. 7.

Fig. 7

Open in a new tab

Expression profiles of immune-related genes in the liver of NDRV-infected ducks. The samples of viral infected ducks were collected at 1, 3, 6 and 9 dpi. Data were expressed as means ± standard deviation (n = 6). (A-G) The expression of the IFN-α, IFN-β, IFN-λ, IFITM1, IFITM2, TLR3 and RIG-I in turn. Differences were analyzed with Student’s t-test and were considered significant as follows: * P < 0.05; ** P < 0.01.

Changes in biochemical parameters induced by NDRV infection

In this study, serum levels (ALT, AST, UA) were measured by an automatic biochemical analyzer to evaluate the organ damage induced by infection with the NDRV-JX01 strain in ducklings. As hallmark indicators of hepatocellular injury, both ALT and AST activities in the serum of infected ducklings were significantly higher than those in the control group at 1-9 dpi (P < 0.05) (Fig. 8A-B). Serum UA levels in the infected group were slightly elevated throughout the experimental period compared with the control group, but the differences between groups at each time point were not statistically significant (Fig. 8C). These results indicate that NDRV infection induces severe liver damage in ducklings.

Fig. 8.

Fig. 8

Open in a new tab

Dynamics of ALT, AST and UA in serum of the ducklings post artificially infected with NDRV. Note: Data are expressed as the mean ± SD. Asterisks indicate statistically significant differences compared with the control group. * P < 0.05; ** P < 0.01.

Discussion

NDRV was first reported from duck flocks in Fujian Province, China. It subsequently spread rapidly to major duck‑producing regions across the country and has now become a highly prevalent disease in duck farming (Yu, et al., 2021). Compared with DNA viruses, most RNA viruses exhibit high error rates during genome replication, leading to a high mutation rate (Niu, et al., 2021; Sun, et al., 2023). As a multi-segmented double-stranded RNA virus, NDRV strains undergo persistent genetic variations during epidemic spread, resulting in dynamic shifts in viral virulence and pathogenicity, which greatly hinders clinical differential diagnosis and integrated disease prevention and control in duck farming (Zheng, et al., 2016; Yang, et al., 2023).

In this study, four NDRV strains (NDRV-JX01, NDRV-JX02, NDRV-JX11, NDRV-JX12) were successfully isolated from tissue samples of diseased ducks. As a capsid structural protein of viral particles, the σC protein plays a vital role in viral assembly, host recognition, cell invasion and pathogenesis, and it is a key determinant of viral pathogenicity (Zheng, et al., 2016; Zeng, et al., 2025). Phylogenetic analysis based on the σC gene indicated that the four strains isolated in this study all clustered within the evolutionary branch of NDRV. Among them, the NDRV-JX01 strain exhibits strong replication ability in vitro and can induce obvious CPE in LMH and DF-1 cells. Notably, the four strains exhibited high homology and shared the closest genetic relationship with the NDRV-CD21 strain isolated from Beijing in 2024. This result may be closely related to the diversified duck farming models. At present, ducklings are frequently circulated across regions nationwide. Transport vehicles, contaminated feed and infected hosts can all serve as crucial transmission routes for pathogens, thereby accelerating the spread and prevalence of the virus. Frequent duck flock movement has disrupted geographic isolation and promoted gene flow between northern and southern strains, which may partly account for the epidemiological pattern that NDRV isolates rarely form stable, regionally distinct evolutionary clades. Moreover, long-distance transport of live poultry constitutes a factor underlying the nationwide dissemination of the virus and the genetic homogenization of strains among regions.

To evaluate the pathogenicity of the NDRV-JX01 strain, animal infection experiments were conducted in mule ducks. After artificial infection, the NDRV-JX01 strain isolated in this study induced typical clinical symptoms in ducklings, including depression and growth retardation, with the mortality rate of 33.3%. Histopathological analysis revealed severe hemorrhage, necrosis, and inflammatory infiltration in the multiple organs of ducklings. These findings are consistent with previous studies (Zheng, et al., 2016; Luo, et al., 2021). Combined with RT-qPCR results, viral nucleic acid was detected in various tissues of the infected group, further confirming the multi-tissues tropism of the NDRV-JX01 strain. The finding is consistent with previous studies on NDRV infection (Li, et al., 2016; Li, et al., 2023). Moreover, viral RNA levels in the examined tissues peaked at 3 dpi and began to decline at 6 dpi. These results reveal the rapid progression of this disease, which is consistent with the epidemiological pattern that most deaths of infected ducklings occur prior to 6 dpi.

The host innate immune response serves as the first line of antiviral defense and is activated upon pathogen invasion. Host pattern recognition receptors (PRRs) recognize conserved pathogen-associated molecular patterns (PAMPs) derived from invading viruses and initiate downstream signaling cascades to coordinate comprehensive antiviral immune responses (Li, et al., 2016; Wu, et al., 2021; Zhu, et al., 2021). Intracellular double-stranded RNA generated during NDRV replication is recognized by two vital PRRs: RIG-I and TLR3. Once activated, these receptors trigger signal transduction cascades that promote robust transcription and secretion of type I and type III interferons, including IFN‑α, IFN‑β, and IFN‑λ (Yu and Levine, 2011). These interferons further upregulate the transcription of numerous interferon-stimulated genes (ISGs), among which IFITM1 and IFITM2 function as core effector molecules. The protein products of IFITM1 and IFITM2 directly block viral membrane fusion and thereby prevent viral entry and subsequent infection, thus exerting potent antiviral and immunomodulatory effects to limit viral proliferation and spread within host tissues (Loo, et al., 2007; Zhang, et al., 2021). In this study, an overall upregulation in the mRNA expression levels of RIG-I, TLR3, IFN-α, IFN-β, IFN-λ, IFITM1, and IFITM2 was observed during infection, indicating that innate immune responses in ducklings are activated by NDRV infection. Serum ALT and AST were significantly increased in the infected ducklings, whereas UA showed no significant change. The synchronous fluctuation patterns between hepatic viral load and serum liver enzyme activities provided evidence for a direct causality: intensive intracellular NDRV replication compromises hepatocyte membrane integrity, resulting in the release of ALT and AST into the circulation and consequent elevation of serum transaminase levels.

In summary, the isolated NDRV-JX01 strain was used to establish an animal infection model in ducklings. The virus exhibits multi‑tissue tropism and induces severe pathological lesions in these tissues. In this study, we focused on the liver to detect hepatic dysfunction and aberrant expression of immune-related genes. These findings provide experimental evidence for further research on NDRV pathogenesis and integrated control strategies. Nevertheless, this study has certain limitations. The present research merely centered on the σC gene, lacking analyses of the whole-genome profiles. Subsequent research will perform full-genome amplification and sequencing, and further explore the mechanisms of NDRV pathogenicity.

Author Contribution

Zhixian Wang: Developed the preliminary research framework and experimental scheme, took part in the experimental process, sorted and analyzed core experimental data, and drafted the original manuscript. Jia Tan: Collected clinical samples and performed duckling pathogenicity experiments, drafted the original manuscript. Haoran Xi: Performed virus isolation and purification, and participated in pathogenicity experiments, analyzed the data, and critically reviewed the manuscript. Yao Hu: Participated in virus isolation and pathogenicity experiments, analyzed the molecular data, and critically reviewed the manuscript. Xu Lei: Collected clinical samples and performed pathogen detection, interpreted the data, and critically reviewed the manuscript. Meifang Tan: Performed gene amplification and viral sequencing, collected and analyzed the data, and critically reviewed the manuscript. Jiazhen Wei: Analyzed sequencing and phylogenetic data, prepared figures and tables, and critically reviewed the manuscript. Cui Lin: Participated in duckling pathogenicity experiments and recorded clinical data and symptoms, and critically reviewed the manuscript. Fanfan Zhang: Participated in pathogenicity experiments, collected pathological tissues and prepared histological sections, analyzed the data, and critically reviewed the manuscript. Yanbing Zeng: Participated in pathogenicity experiments, analyzed and interpreted the histopathological data, and critically reviewed the manuscript. Chengcheng Wu: Detected and analyzed the expression levels of immune-related genes, analyzed the data, and critically reviewed the manuscript. Na Li: Performed cell experiments, acquired data, and critically reviewed the manuscript. Jiangnan Huang: Completed sample pretreatment and viral nucleic acid extraction, interpreted the data, and critically reviewed the manuscript. Haiqin Li: Designed the research scheme and experimental procedures, critically revised and polished the manuscript, finalized the manuscript, and provided project support for this work. Each author has also agreed to endorse the final manuscript prior to publication, accept individual and public accountability for the whole work, and guarantee that any concerns regarding the accuracy or integrity of the research are thoroughly investigated and resolved.

Ethics statement

Ethical approval for the present study was granted by the Experimental Animal Ethics Committee affiliated with Jiangxi Academy of Agricultural Sciences (JXAAS 2020-0025). All operations involving experimental animals complied with the regulatory requirements formulated in the Guidelines for the Care and Use of Experimental Animals by the Ministry of Agriculture of China.

Ethics declarations

This study was conducted in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. This study was approved by the Experimental Animal Ethics Committee affiliated with Jiangxi Academy of Agricultural Sciences. (Approval No. JXAAS 2020-0025)

Disclosures

The authors declare that there are no commercial or financial relationships that could be construed as a potential conflict of interest in the conduct of this research.

Acknowledgments

This work was supported by Key R&D Program of Jiangxi Province, China (20252BCF320013 and 20261BCF320003), basic research and talent training of Jiangxi Academy of Agricultural Sciences (JXSNKYJCRC202649 and JXSNKYJCRC202439), National Natural Science Foundation of China (32360875).

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2026.107834.

Appendix. Supplementary materials

mmc1.docx (13.7KB, docx)

References

  1. Bi Z., Zhu Y., Chen Z., Li C., Wang Y., Wang G., Liu G. Induction of a robust immunity response against novel duck reovirus in ducklings using a subunit vaccine of sigma C protein. Sci. Rep. 2016;6 doi: 10.1038/srep39092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Cao Y., Sun M., Wang J., Hu X., He W., Su J. Phenotypic and genetic characterisation of an emerging reovirus from Pekin ducks in China. Sci. Rep. 2019;9:7784. doi: 10.1038/s41598-019-44178-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen X., Zheng M., Lin F., Cheng X., Xiao S., Chen S., Chen S. Impacts of novel duck reovirus infection on the composition of intestinal microbiota of Muscovy ducklings. Microb. Pathog. 2019;137 doi: 10.1016/j.micpath.2019.103764. [DOI] [PubMed] [Google Scholar]
  4. Du X., Ding M., Wu Q., Li C.H., Guo H., Liu G., Chen Z. Characterization of a P18 protein in the S1 segment of the novel duck reovirus genome. Acta Virol. 2020;64:59–66. doi: 10.4149/av_2020_108. [DOI] [PubMed] [Google Scholar]
  5. Fang S., Xu C., Zhang J., Yin H., Liu W., Xu B., Li J., Kyaw P.E., Liu S., Song S., Yan L. Development and evaluation of a live-attenuated novel duck reovirus vaccine strain E232-P100 conferring complete protection in ducklings. Vet. Microbiol. 2026;314 doi: 10.1016/j.vetmic.2026.110929. [DOI] [PubMed] [Google Scholar]
  6. Farkas S.L., Lanszki Z., Malik Y.S., Martella V., Palya V., Bányai K. Update on reovirus infections in waterfowls. Animals. 2025;15:3053. doi: 10.3390/ani15203053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Franzo G., Tucciarone C.M., Faustini G., Poletto F., Baston R., Cecchinato M., Legnardi M. Reconstruction of avian reovirus history and dispersal patterns: a phylodynamic study. Viruses. 2024;16:796. doi: 10.3390/v16050796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Huang Q., Yang F., Yu J., Wei W., Wu S. Novel duck reovirus: a comprehensive review of molecular pathogenesis and advances in diagnosis and vaccination. Poult. Sci. 2026;105 doi: 10.1016/j.psj.2026.106468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kong J., Shao G., Zhang Y., Wang J., Xie Z., Feng K., Zhang X., Xie Q. Molecular characterization, complete genome sequencing, and pathogenicity of Novel Duck Reovirus from South Coastal Area in China. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Li B., Jiang X., Zhang S., Wang Q., Cui Y., Wu Q., Jia W., Zhang J., Diao Y., Tang Y. Isolation and pathogenicity analysis of a novel orthoreovirus caused the outbreak of duck viral arthritis in China. Transbound. Emerg. Dis. 2023 doi: 10.1155/2023/8179312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Li L., Lei B., Zhang W., Wang W., Shang C., Hu Y., Zhao K., Yuan W. The disturbance of intestinal microbiome caused by the novel duck reovirus infection in Cherry Valley ducklings can induce intestinal damage. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.104428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Li N., Hong T., Wang Y., Wang Y., Yu K., Cai Y., Liu S., Wei L., Chai T. The pathogenicity of novel duck reovirus in Cherry Valley ducks. Vet. Microbiol. 2016;192:181–185. doi: 10.1016/j.vetmic.2016.07.015. [DOI] [PubMed] [Google Scholar]
  13. Liu C., Kang Q., Wang X., Zeng F., Huang Y., Yang Y., Geng R., Liao J., Luo X., Yan Z., Yin L., Cao S., Chen F., Zhang H., Peng O., Cao Y. Metatranscriptomic analysis of the gut virome in Muscovy ducks reveals a novel duck reovirus potentially associated with hepatic and splenic hemorrhage. Front. Immunol. 2025;16 doi: 10.3389/fimmu.2025.1680275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Liu Q., Zhang G., Huang Y., Ren G., Chen L., Gao J., Zhang D., Han B., Su W., Zhao J. Isolation and characterization of a reovirus causing spleen necrosis in Pekin ducklings. Vet. Microbiol. 2010;148:200–206. doi: 10.1016/j.vetmic.2010.09.016. [DOI] [PubMed] [Google Scholar]
  15. Loo Y.-M., Fornek J., Crochet N., Bajwa G., Perwitasari O., Martinez-Sobrido L., Akira S., Gill M.A., García-Sastre A., Katze M.G., Gale M. Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity. J. Virol. 2007;82:335–345. doi: 10.1128/jvi.01080-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Luo D., Liu R., Weng L., Li K., Qi X., Gao Y., Liu C., Zhang Y., Cui H., Pan Q., Gao L., Wang X. Genomic sequences and pathogenic characteristics of two variant duck reoviruses associated with spleen necrosis. Infect. Genet. Evol. 2021;92 doi: 10.1016/j.meegid.2021.104847. [DOI] [PubMed] [Google Scholar]
  17. Niu X., Kong F., Hou Y.J., Wang Q. Crucial mutation in the exoribonuclease domain of nsp14 of PEDV leads to high genetic instability during viral replication. Cell Biosci. 2021;11:106. doi: 10.1186/s13578-021-00598-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ronca V., Gerussi A., Collins P., Parente A., Oo Y.H., Invernizzi P. The liver as a central "hub" of the immune system: pathophysiological implications. Physiol. Rev. 2024;105:493–539. doi: 10.1152/physrev.00004.2023. [DOI] [PubMed] [Google Scholar]
  19. Sun X., Guo J., Shen J., Guan M., Liu L., Xie Y., Xu H., Wang M., Ren A., Li W., Cong F., Li X. Genetics and biological characteristics of duck reoviruses isolated from ducks and geese in China. Vet. Res. 2025;56:30. doi: 10.1186/s13567-025-01470-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Sun Y., Gong T., Wu D., Feng Y., Gao Q., Xing J., Zheng X., Song Z., Liu X., Chen X., Sun Y., Zhang G., Gong L. Isolation, identification, and pathogenicity of porcine epidemic diarrhea virus. Front. Microbiol. 2023;14 doi: 10.3389/fmicb.2023.1273589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Wang D., Xu F., Ma G., Zhang C., Huang Y., Li H., Zhang D. Complete genomic sequence of a new Muscovy duck-origin reovirus from China. J. Virol. 2012;86 doi: 10.1128/jvi.02230-12. -12445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Wang S., Lin F., Cheng X., Wang J., Zhu X., Xiao S., Zheng M., Huang M., Chen S., Chen S. The genomic constellation of a novel duck reovirus strain associated with hemorrhagic necrotizing hepatitis and splenitis in Muscovy ducklings in Fujian, China. Mol. Cell Probes. 2020;53 doi: 10.1016/j.mcp.2020.101604. [DOI] [PubMed] [Google Scholar]
  23. Wang X., Yan K., Guo M., Bo Z., Zhang X., Zhang C., Wu Y. Genomic characterization and pathogenicity assessment of a novel strain of duck reovirus identified in China. Front. Microbiol. 2026;17 - 2026 doi: 10.3389/fmicb.2026.1750966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wohlleber D., Knolle P.A. Tissue Determinants of Antiviral Immunity in the Liver. Z. Gastroenterol. 2025;63:65–72. doi: 10.1055/a-2365-3900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Wu W., Qiu S., Huang H., Xu R., Bao E., Lv Y. Immune-related gene expression in the kidneys and spleens of goslings infected with goose nephritic astrovirus. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.01.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Xu B., Jiang C., Di L., Zhou L., Wang Z., Tang Y., Fang R., Wang H. Novel Duck Orthoreovirus σA protein inhibits interferon signaling by impeding STAT1/STAT2 nuclear translocation. Transbound. Emerg. Dis. 2025;2025 doi: 10.1155/tbed/8440800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Yang H., Zhang W., Wang M., Yuan S., Zhang X., Wen F., Guo J., Mei K., Huang S., Li Z. Characterization and pathogenicity evaluation of recombinant novel duck reovirus isolated from Southeast China. Front. Vet. Sci. 2023;10 - 2023 doi: 10.3389/fvets.2023.1124999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Yang Y., Li L., Liu X., Jiang M., Zhao J., Li X., Zhao C., Yi H., Liu S., Li N. Quantitative proteomic analysis of duck embryo fibroblasts infected with novel duck reovirus. Front. Vet. Sci. 2020;7 doi: 10.3389/fvets.2020.577370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Yu K., Ti J., Lu X., Pan L., Liu L., Gao Y., Guo X., Hu F., Liu C., Ma X., Li Y., Huang B., Song M. Novel duck reovirus exhibits pathogenicity to specific pathogen-free chickens by the subcutaneous route. Sci. Rep. 2021;11 doi: 10.1038/s41598-021-90979-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Yu M., Levine S.J. Toll-like receptor, RIG-I-like receptors and the NLRP3 inflammasome: key modulators of innate immune responses to double-stranded RNA viruses. Cytokine Growth Factor Rev. 2011;22:63–72. doi: 10.1016/j.cytogfr.2011.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Yun T., Hua J., Ni Z., Ye W., Chen L., Zhu Y., Zhang C. Distinct whole transcriptomic profiles of the bursa of fabricius in muscovy ducklings infected by novel duck reovirus with different virulence. Viruses. 2022;15:111. doi: 10.3390/v15010111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Yun T., Hua J., Ye W., Yu B., Chen L., Ni Z., Zhang C. Comparative proteomic analysis revealed complex responses to classical/novel duck reovirus infections in Cairna moschata. Sci. Rep. 2018;8 doi: 10.1038/s41598-018-28499-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Zeng Q., Hu Y., Nie J., Liang H., Wu X., Chen Z., Xie H., Gao X., Guo X., Wu H. Pathogenicity difference analysis of novel duck reovirus NY01 between in semi-muscovy duck and shelduck. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhang H., Song X., Li T., Wang J., Xing B., Zhai X., Luo J., Hu X., Hou X., Wei L. DDX1 from Cherry valley duck mediates signaling pathways and anti-NDRV activity. Vet. Res. 2021;52:9. doi: 10.1186/s13567-020-00889-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhang S., Li W., Liu X., Li X., Gao B., Diao Y., Tang Y. A TaqMan-based real-time PCR assay for specific detection of novel duck reovirus in China. BMC Vet. Res. 2020;16:306. doi: 10.1186/s12917-020-02523-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zheng X., Wang D., Ning K., Liang T., Wang M., Jiang M., Zhang D. A duck reovirus variant with a unique deletion in the sigma C gene exhibiting high pathogenicity in Pekin ducklings. Virus Res. 2016;215:37–41. doi: 10.1016/j.virusres.2016.01.020. [DOI] [PubMed] [Google Scholar]
  37. Zhu Z., Liao L., Su J., Liu Z., Pan S., Huang Y., Wu Y. Interactions of Muscovy duck reovirus, gut microbiota, and host innate immunity: transcriptome and gut microbiota analysis. Vet. Microbiol. 2021;264 doi: 10.1016/j.vetmic.2021.109286. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (13.7KB, docx)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES