Generation of two induced pluripotent stem cell lines from Marfan syndrome patients carrying FBN1 mutations

Abstract

Marfan syndrome is a connective tissue disorder affecting the cardiovascular, skeletal, and ocular systems. Here, we generated and characterized induced pluripotent stem cell (iPSC) lines derived from two Marfan syndrome patients with mutations in the FBN1 gene (c.3333C > A and c.8854_8562delinsTATCAC). Both lines exhibited typical iPSC morphology, normal karyotype, undifferentiated states, and trilineage differentiation capacity. These iPSCs serve to enable investigation into the mechanisms underlying Marfan syndrome for therapeutic discovery.

Resource Table

Unique stem cell line identifier	1. SCVIi150-A 2. SCVIi151-A
Alternative name(s) of stem cell line	1. GSB-L157 (SCVIi150-A) 2. GSB-2728 (SCVIi151-A)
Institution	Stanford Cardiovascular Institute
Contact information of the distributor	Joseph C. Wu, joewu@stanford.edu
Type of cell line	iPSCs
Origin	Human
Additional human source info	Age: 42 (SCVIi150-A); 38 (SCVIi151-A)
required	Sex: Female (both lines)
for human ESC or iPSC	Ethnicity (if known): White/Caucasian
Cell Source	PBMC
Clonality	Clonal
Method of reprogramming	Sendai virus vectors expressing Oct4, Sox2, Klf4, and c-Myc
Genetic Feature(s)	Inherited mutation
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	RT-qPCR
Associated disease	Marfan syndrome
Gene/locus	FBN1 (15q21.1) SCVIi150-A: FBN1 c.3333C > A (p. Cys1111Ter) SCVIi151-A: FBN1 c.8854_8562delinsTATCAC
Date archived/stock date	August 12th, 2025
Cell line repository/bank	https://hpscreg.eu/cell-line/SCVIi150-A https://hpscreg.eu/cell-line/SCVIi151-A
Ethical approval	The generation of two lines was approved by the Administrative Panel on Human Subjects Research (IRB) under IRB #29904 “Derivation of Human Induced Pluripotent Stem Cells (Biorepository)“

1. Resource Utility

Marfan syndrome patients suffer from chronic pain, vision problems, and physical activity restrictions that significantly reduce their quality of life. Knowledge gaps remain in understanding how FBN1 mutations drive the disease at a molecular level. These iPSCs provide a platform to elucidate Marfan syndrome’s disease mechanisms and discover new therapies to address this unmet clinical need.

2. Resource details

Marfan syndrome is a hereditary, autosomal dominant connective tissue disorder caused by mutations in the FBN1 gene, which encodes fibrillin-1 (Dietz, 1991). FBN1 is a 350-kD glycoprotein that is present in the extracellular matrix of various tissues, including the skin, lung, and vasculature (Sakai et al., 1986). It provides mechanical support in many load-bearing connective tissues and serves as a scaffold for elastic fiber assembly (Thomson, 2019). Marfan syndrome affects approximately 1 in 5,000 people and involves the cardiovascular, skeletal, and ocular systems (Judge and Dietz, 2005). Patients often present with long limbs, pectus deformities, scoliosis, lens dislocation, and most critically, aortic root dilatation which can lead to life-threatening aortic dissection or rupture (Judge and Dietz, 2005). Multidisciplinary management includes regular cardiovascular monitoring; slowing aortic root growth; aortic root surgery when dilatation reaches critical thresholds; orthopedic interventions for skeletal complications; and ophthalmologic care for lens and retinal issues (Pyeritz and McKusick, 1979). With appropriate surveillance and treatment, life expectancy has improved significantly and can approach that of the general population. Still, no cure for Marfan syndrome exists, and many patients experience morbidities that include chronic pain, and activity restrictions. Additionally, many questions remain regarding variability in the clinical phenotype, underlying non-structural disease mechanisms, and potential therapeutic targets. As such, developing Marfan syndrome iPSC models may provide insights into these domains and facilitate the development of new therapeutics.

Here, we reprogrammed two human iPSC lines (SCVIi150-A and SCVIi151-A) derived from peripheral blood mononuclear cells (PBMCs) of a 42-year-old (c.3333C > A, encoding p.Cys1111Ter) and a 38-year-old (c.8554_8562delinsTATCAC) white, female Marfan syndrome patients carrying heterozygous mutations in FBN1 (Resource Table). We reprogrammed the PBMCs into iPSCs using Sendai virus vectors expressing Oct4, Sox2, Klf4, and c-Myc. When expanded, the resulting iPSCs were compact with smooth edges, which are typical morphologies (Fig. 1A; scale bars, 250 μm). We performed short tandem repeat (STR) analysis to verify that the iPSC lines (passage 25) were derived from their corresponding donor PBMCs (Table 1, data archived). At passage 22, the undifferentiated iPSC state was confirmed by gene expression of SOX2 and NANOG compared to a previously characterized iPSC line (SCVIi145-A) and iPSC-derived cardiomyocytes from the same line as controls (Chorsi, 2026) (Fig. 1B).

Fig. 1.

Characterization and validation of two iPSC lines derived from Marfan syndrome patients.

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography bright field	Normal	Fig. 1A
Characterization of undifferentiated state	Qualitative analysis: RT-qPCR Immunofluorescence staining	NANOG and SOX2 highly expressed alongside SCVIi145-A and compared to SCVIi145-A-derived cardiomyocytes Positive expression of undifferentiated iPSC state markers SOX2, OCT3/4, and NANOG	Fig. 1B Fig. 1D
Genomic stability	Whole genome array (low-pass whole-genome sequencing) Resolution 1–2 Mb	1. SCVIi150-A: 46XX 2. SCVIi151-A: 46XX	Fig. 1H
mtDNA analysis (IF APPLICABLE)	Sanger sequencing, Deep sequencing, analysis software (Mitopore https://www.mitopore.de, mtDNA-Server 2, etc)	N/A	N/A
Cell line identity verification	Microsatellite PCR (mPCR) or STR analysis	N/A 16 loci tested with match between iPSCs and PBMCs	N/A Submitted in archive with the journal
Mutation analysis (IF APPLICABLE)	Next generation sequencing	1. SCVIi150-A: heterozygous FBN1 c.3333C > A 2. SCVIi151-A: heterozygous FBN1 c.8854_8562delinsTATCAC	Fig. 1F
	Southern blot or WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by luminescence: Negative	Fig. 1G
Characterization of the differentiated state	Directed tri-lineage differentiation	Positive expression of 3 germ layer markers via immunofluorescence staining	Fig. 1E
List of recommended differentiated state germ layer markers	Expression of these markers has to be demonstrated at mRNA (RT PCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer	Positive expression of germ layer markers via immunofluorescence: Ectoderm: OTX2/PAX6 Mesoderm: BRACHYURY, HAND1 Endoderm: SOX17/FOXA2	Fig. 1E
Donor screening (OPTIONAL)	HIV 1 + 2, Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

We corroborated these results by performing immunofluorescence staining of SOX2, OCT3/4, and NANOG at passage 25 (Fig. 1D; scale bars, 100 μm). Both iPSC lines lost the expression of Sendai virus genome by passage 17 (SCVIi150-A) and passage 21 (SCVIi151-A), with passage 10 SCVIi145-A as control (Fig. 1C). By staining for germ layer-specific markers, we also showed that both lines could be successfully differentiated into ectoderm, mesoderm, and endoderm cells at passage 28 (Fig. 1E, scale bars, 50 μm). By amplicon sequencing of cells at passage 25, we further demonstrated that SCVIi150-A contained a heterozygous substitution and SCVIi151-A a heterozygous insertion-deletion in FBN1. We confirmed that both iPSC lines were negative for mycoplasma contamination at passage 25 (Fig. 1G), and low-pass whole-genome sequencing showed normal karyotypes (Fig. 1H).

3. Materials and methods

3.1. Reprogramming

Whole blood samples from two patients with Marfan syndrome were collected for reprogramming into human iPSCs. PBMCs were isolated using Percoll density gradient medium (GE Healthcare, Cat #17089109) and washed several times with DPBS (ThermoFisher Scientific, Cat #14190144). The purified PBMCs were cultured in StemPro^™-34 SFM medium (ThermoFisher Scientific, Cat #10639011) supplemented with 100 ng/mL SCF (Peprotech, Cat #300–07), 100 ng/mL FLT3 (ThermoFisher Scientific, Cat #PHC9414), 20 ng/mL IL-3 (Peprotech, Cat #200–3), 20 ng/mL IL-6 (ThermoFisher Scientific, Cat #PHC0063), and 20 ng/mL EPO (ThermoFisher Scientific, Cat #PHC9631). Reprogramming was carried out using the CytoTune^™-iPSC 2.0 Sendai Reprogramming Kit (ThermoFisher Scientific, Cat #A16517). Transduced cells were plated on Matrigel-coated 6-well plates and maintained in StemPro^™-34 medium for 7 days. On day 7, the medium was replaced with StemMACS^™ iPS-Brew XF medium (Miltenyi Biotec, Cat #130–104–368), which was refreshed every 2 days. Between days 10–15, emerging iPSC colonies were identified, selected, and expanded for downstream differentiation and cryopreservation (Yildirim, 2022).

3.2. Cell culture

iPSCs were maintained in StemMACS^™ iPS-Brew XF medium (Miltenyi Biotec, Cat #130–107–086) supplemented with its companion additive (Miltenyi Biotec, Cat #130–107–087) on Matrigel-coated plates. Cells at 85–90% confluency were passaged using 0.5 mM EDTA (Invitrogen, Cat #15575–038) as single cells and replated in iPS-Brew XF medium containing 5 μM ROCK inhibitor (Selleck Chemicals, Y27632). After 24 h, the ROCK inhibitor was removed, and cells were maintained in iPS-Brew XF medium with daily changes. Cultures were kept in a humidified incubator at 37°C and 5% CO₂.

3.3. Trilineage differentiation

To test the trilineage potential of iPSCs, cells at passage 28 were differentiated into endoderm, mesoderm, and ectoderm lineages. Endoderm induction followed the protocol from the StemDiff^™ Definitive Endoderm Differentiation Kit (STEMCELL^™ Technologies, Cat #05110). Ectoderm differentiation was carried out using the Human Pluripotent Stem Cell Functional Identification Kit (R&D Systems, Cat #SC027B). Mesoderm differentiation was achieved by culturing iPSCs in RPMI medium containing B27 Minus Insulin supplement (Gibco, Cat #11875–085 and Cat #A18956–01) and 7 μM CHIR99021 (Selleck Chemicals, Cat #S2924) for 48 h.

3.4. Immunofluorescent staining

Cells at passage 25 were fixed with 4% paraformaldehyde for 10 min and permeabilized with 0.5% Triton X-100 in DPBS for 10 min at room temperature. Blocking was performed for 30 min at room temperature in 5% BSA with 0.1% Triton X-100 (blocking buffer). Cells were then incubated overnight at 4°C with primary antibodies diluted in blocking buffer (Table 2). The next day, secondary antibodies (Table 2) and DAPI were applied for 1 h at room temperature. Imaging was performed using an ECHO Revolve microscope.

Table 2.

Reagent details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Undifferentiated iPSC state marker	Mouse IgG1κ Anti-Sox2	1:100	Santa Cruz Biotechnology Cat #sc-365823	RRID:AB_10842165
Undifferentiated iPSC state marker	Rabbit Anti-Nanog	1:100	Proteintech, Cat #142951–1-AP	RRID:AB_1607719
Undifferentiated iPSC state marker	Mouse IgG2bκ anti-Oct-3/4	1:100	Santa Cruz Biotechnology Cat #sc-5279	RRID:AB_628051
Differentiation marker: Ectoderm	Goat anti-OTX2	1:200	R&D Systems Cat #963273	RRID:AB_2157172
Differentiation marker: Ectoderm	Rabbit anti-PAX6	1:200	Thermo Fisher Scientific Cat #42–6600	RRID:AB_2533534
Differentiation marker: Endoderm	Goat anti-SOX17	1:200	R&D Systems Cat #AF1924	RRID:AB_355060
Differentiation marker: Endoderm	Rabbit anti-FOXA2	1:200	Thermo Fisher Scientific Cat #701698	RRID:AB_2576439
Differentiation marker: Mesoderm	Goat anti-BRACHYURY	1:200	Thermo Fisher Scientific Cat #PA5-46984	RRID:AB_2610378
Differentiation marker: Mesoderm	Rabbit anti-HAND1	1:200	Santa Cruz Biotechnology Cat # sc-390376	RRID:AB_2935660
Secondary antibody	Alexa Fluor 488 Goat anti-Mouse IgG1	1:500	Thermo Fisher Scientific Cat #A-21121	RRID:AB_2535764
Secondary antibody	Alexa Fluor 647 Goat anti-Mouse IgG2b	1:500	Thermo Fisher Scientific Cat #A-21242	RRID:AB_2535811
Secondary antibody	Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific Cat #A-21428	RRID:AB_2535849
Secondary antibody	Alexa Fluor 488 Donkey Anti-Goat IgG (H + L)	1:500	Thermo Fisher Scientific Cat #A-11055	RRID:AB_2534102
Secondary antibody	Alexa Fluor 555 Donkey Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific Cat #A-31572	RRID:AB_162543
	Primers
	Target	Size of the band	Forward/Reverse primer (5′–3′)
Sendai virus plasmids (qPCR)	Sendai virus genome	181 bp	Mr04269880_mr
Undifferentiated iPSC state marker (qPCR)	SOX2	258 bp	Hs04234836_s1
Undifferentiated iPSC state marker (qPCR)	NANOG	327 bp	Hs02387400_g1
Housekeeping gene (qPCR)	18S	187 bp	Hs99999901_s1
Genotyping	SCVIi150-A: heterozygous FBN1 0c.3333C > A	251	Forward: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNTGCAGACTGATTCCTAACTTCACT Reverse: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACGAATGCCGCATATCTCCT
Genotyping	SCVIi151-A: heterozygous FBN1 0c.8854_8562delinsTATCAC	353	Forward: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNTAGTCACCTGTACCTTGCTTTG Reverse: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGGGATCAGCTACCTCCACTTC

3.5. RT-qPCR

RT-qPCR was used to confirm pluripotency undifferentiated iPSC state at passage 22 and assess residual Sendai virus expression in reprogrammed iPSCs at passage 17 (SCVIi150-A) and passage 21 (SCVIi151-A). Cells were lysed in TRIzol^™ Reagent (Thermo Fisher Scientific, Cat #15596026), and total RNA was extracted using the Direct-zol^™ RNA Miniprep Kit (Zymo Research, Cat #R2052). cDNA was synthesized using the iScript cDNA Synthesis Kit (BioRad, Cat #1708891). qPCR was performed using the TaqMan Fast Advanced Gene Expression Assay (Applied Biosystems, Cat #4444557) with SOX2, NANOG, and SEV primers (Table 2). Using a previously characterized cell line, early passage 10 SCVIi145-A, passage 18 SCVIi145-A, and SCVIi145-A-differentiated cardiomyocytes served as controls (Chorsi, 2026).

3.6. Short Tandem repeat (STR) analysis

Genomic DNA was isolated from PBMCs and iPSCs (passage 25) using the DNeasy Blood & Tissue Kit (Qiagen, Cat #69504). STR profiling was performed using the CLA IdentiFiler^™ Direct PCR Amplification Kit (ThermoFisher Scientific, Cat #A44661). Capillary electrophoresis was carried out by GENEWIZ.

3.7. Amplicon sequencing

To characterize FBN1 mutations in iPSCs at passage 25, DNA fragments flanking the mutation sites were PCR-amplified using KOD One^™ PCR Master Mix (Cat #KMM-101, TOYOBO) with primers containing partial Illumina P5 and P7 adapter overhangs. The PCR protocol was as follows: initial denaturation at 98°C for 5 s; 32 cycles of 98°C for 10 s, 58°C (SCVIi150-A primer) or 63°C (SCVIi151-A primer) for 5 s, and 68°C for 3 s; and ended with a final 1 min extension at 68°C. 3 μL of the PCR product was loaded on an agarose gel for size confirmation and quality check, and the rest were purified through AMPure XP beads purification (Cat #A63881, Beckman Coulter). The purified PCR product was sent for sequencing by GENEWIZ. Processed fastq files were analyzed for mutation and allele frequency using CRISPResso2 (RRID: SCR_024503).

3.8. Karyotyping

Low-pass whole-genome sequencing (LP-WGS) was performed for each iPSC at passage 25 line to assess the karyotype. For each iPSC line, LP-WGS was performed to 1 × coverage with 150-bp paired-end reads on a NovaSeq platform (Tan, 2025). Reads were aligned to the human reference genome (GRCh38) using Bowtie2 (RRID: SCR_016368). SAMtools (RRID: SCR_002105) was used to convert, sort, and index BAM files. GATK MarkDuplicates (RRID: SCR_001876) was used to flag Duplicate reads. The sequencing depth per-site was generated using SAMtools, and karyotype plots were produced using the R package karyoploteR (RRID: SCR_021824). A Log R Ratio plot was made to assess genome-wide copy number and ploidy stability; however, this approach cannot detect balanced rearrangements, inversions, small structural variants, or low-level mosaicism. The approximate resolution is 500 kb to 1 Mb, with reliable detection of variants greater than 1 Mb.

3.9. Mycoplasma detection

Cell culture supernatant from cells at passage 25 was collected after 24 h of normal culture and tested for mycoplasma contamination using the MycoAlert^™ Detection Kit (Lonza, Cat #LT07–518), which included positive and negative controls.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2026.104087.

Data availability

Data will be made available on request.