Isolation, identification and phylogenetic analysis of a novel goose astrovirus 2 strain

Abstract

An outbreak of acute nephritis and growth retardation occurred on a goose farm in Jiangsu Province, China, in 2025. Affected goslings exhibited typical symptoms of gout, and RT-PCR confirmed infection with goose astrovirus 2 (GAstV-2) alone. A novel strain, designated JSYC2503, was isolated from liver tissue using Leghorn male hepatoma (LMH) cells. This strain induced clear cytopathic effects within 72 h and remained stable after 20 serial blind passages. The complete genome of JSYC2503 consisted of 7,180 nucleotides and displayed the typical astrovirus genome organization, including a conserved ribosomal frameshift signal and a stem-loop II-like motif (s2m) in the 3′-UTR. Phylogenetic analysis placed JSYC2503 within the GAstV-2 clade, showing the highest sequence identity to the Chinese GAstV-2 strain JXNC1 (99.6% at the whole-genome level) but much lower identity (29.9%–47.1%) to other avian astroviruses. In an experimental infection study, 3-day-old goslings inoculated intraperitoneally with JSYC2503 developed clinical signs, showed 50% mortality by day 6, and exhibited pathological changes including splenomegaly, bursal atrophy, and urate deposition in the kidneys. Viral shedding was continuously detected in cloacal swabs. These results indicate that JSYC2503 is a highly pathogenic GAstV-2 strain that may pose a substantial threat to goose health, and its genomic characterization provides insight into the evolution and pathogenesis of goose astroviruses.

Introduction

Goose astrovirus 2 (GAstV-2) has emerged as a major pathogen responsible for visceral gout and high mortality in goslings across major waterfowl-producing regions of China, causing substantial economic losses to the goose industry (Wei et al., 2023; Ren et al., 2025).

GAstV-2 belongs to the genus Avastrovirus and is characterized by a single-stranded positive-sense RNA genome consisting of a 5′-untranslated region (UTR), three open reading frames (ORFs), a 3′-UTR, and a poly(A) tail (Cortez et al., 2017; Chen et al., 2020). Phylogenetic analysis based on ORF2 sequences has classified goose astroviruses into two distinct genotypes, with GAstV-2 being the predominant genotype associated with clinical gout outbreaks (Wei et al., 2023; Xu et al., 2024b). However, the genetic diversity and pathogenic heterogeneity of circulating field strains remain poorly defined.

Field strains can be isolated through several complementary approaches, including inoculation into susceptible avian embryos, infection of continuous cell lines, and propagation in primary cell cultures. For GAstV-2, the Leghorn male hepatoma (LMH) cell line and goose embryos have been most widely used for primary virus isolation (Xiang et al., 2024; Xu et al., 2024a). Successful adaptation of a field strain to a suitable culture system is a prerequisite for vaccine development and detailed pathogenesis studies. Although several GAstV-2 isolates have been obtained using these platforms, systematic characterization of their in vivo pathogenicity—particularly with respect to tissue tropism and transmission dynamics—remains limited (Cui et al., 2022; Xu et al., 2024a). Furthermore, continuous surveillance of emerging variants is essential for informing effective control strategies (Cui et al., 2022).

In this study, we isolated a GAstV-2 strain, designated JSYC2503, from a clinical gout outbreak in Jiangsu Province. We determined its complete genome sequence, analyzed its phylogenetic relationship and recombination potential, and evaluated its pathogenicity in experimentally infected goslings. Our findings provide a contemporary reference strain and contribute to a better understanding of GAstV-2 pathogenesis and evolution.

Materials and methods

Ethics statement

This animal experiment was approved by the Animal Ethics Committee of Yangzhou University (approval no. 202509006) and was conducted in accordance with the principles and specific guidelines set forth in the Guide for the Care and Use of Agricultural Animals in Research and Teaching, 4th edition, 2020.

Samples and cells

In March 2025, liver and kidney tissue samples were aseptically collected from 10-day-old diseased goslings on a large-scale goose farm in Yancheng, Jiangsu Province, China, where an outbreak of acute nephritis and growth retardation had occurred. The samples were stored at −80°C until use. The LMH cell line was kindly provided by Professor Jianqiang Ye, College of Veterinary Medicine, Yangzhou University.

PCR for virus detection

Typing primers were designed as previously described to amplify target fragments for GAstV genotyping (Yu, 2024). Meanwhile, the processed clinical samples were tested for common pathogens, including goose parvovirus (GPV) (Jiang et al., 2025b), novel duck reovirus (NDRV) (He et al., 2025), avian influenza virus (AIV) (Dai et al., 2024), duck Tembusu virus (DTMUV) (Cao et al., 2025) and goose circovirus (GoCV) (Yao et al., 2022), in order to exclude co-infection. The primers used for virus detection are listed in Table 1.

Table 1.

Primers used for GAstV typing and exclusion of other viral pathogens.

Name	Primer sequence (5′−3′)	Length (bp)
GAstV-1-F	ATGGCCGACAAGGTCACT	632
GAstV-1-R	CCAGTATCCATATTCCACCA
GAstV-2-F	GAAGGTGACCAAGAAGGTTAC	299
GAstV-2-R	GAGTTGCTGTTTGCCCATTTTC
GPV-F	CAACGCAGGATCAGACGAAGAC	314
GPV-R	AGCGAACATGCTATGGAAAGGA
NDRV-F	TCTGTACTATGGTGCCCCT	181
NDRV-R	CGCCTCATCATAGTAATCTGC
AIV-F	ACTGTTGGGAGGAAGAGAATGGTC	243
AIV-R	CAACCATCTCATGCTTCTGTAG
DTMUV-F	AGCAAATCCCTGATAGAGC	387
DTMUV-R	TTACATCCCTTCCAACCC
GoCV-F	TTAATAACCCTACCTTTGAAGA	543
GoCV-R	CCGTCCCACCACTTCCCG

Virus isolation

Tissue samples exhibiting obvious gout lesions were collected aseptically, minced with sterile scissors, mixed with PBS containing penicillin and streptomycin, and homogenized using a biological sample homogenizer. The homogenates were subjected to three freeze–thaw cycles at −80°C and then centrifuged at 1,000 × g for 10 min. The supernatant was filtered through a 0.22-μm syringe filter, and the resulting filtrate, designated the tissue processing solution, was either directly used to inoculate cells or stored at −20°C until use. The tissue processing solution was inoculated onto confluent LMH cells at a 1:10 ratio and incubated at 37°C in a 5% CO₂ incubator. Cytopathic effects (CPE) were observed daily. When CPE reached 70%–80%, the culture supernatant was harvested. If no CPE was observed, the medium was harvested at 5 days post-infection, subjected to three freeze–thaw cycles, and the supernatant was used to inoculate fresh LMH cells. This process was repeated for 20 blind passages. The 20th-passage cell culture was used as the seed virus stock and stored at −80°C.

Whole genome sequence determination

To determine the full-length nucleotide sequence of the virus, total RNA was extracted from the viral suspension using FreeZol Reagent (Vazyme, China). First-strand cDNA was synthesized from 1 μg of RNA using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, China) according to the manufacturer’s instructions. The 5′ and 3′ terminal sequences were amplified by rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR) using the SMARTer RACE 5′/3′ Kit (Takara Bio, China) following the manufacturer’s protocol. Positive PCR products were cloned into the pMD19-T vector (Takara Bio, China) and sequenced. Based on the GAstV genome sequences available in GenBank, five pairs of primers were designed using Primer 6.0 software (Table 2) to amplify overlapping fragments covering the complete genome of the isolate. The positive amplicons were sequenced, and the resulting sequences were assembled using SnapGene software before submission to GenBank.

Table 2.

GAstV-2 whole-genome amplification primers.

Name	Primer sequence (5′−3′)	Length (bp)
GAst-2-F1	GCTACAATGCTCGCTGAA	3085
GAst-2-R1	GCCAATGCTCAACCAAGT
GAst-2-F2	CGCAAGAAGGACACTCAA	2261
GAst-2-R2	GACAACCGAGCCAAGAAT
GAst-2-F3	CCGACGCTCAGATTACTC	2455
GAst-2-R3	GGTGGAAGTCAGTCTCATC
GAst-2-5-F	GCATGGGGAAACAGCGAT	539
GAst-2-5-R	CAACCATCTCATGCTTCTGTAG
GAst-2-3-F	AACGGAACTCAGGAATCG	631
GAst-2-3-R	ACGATTTGTGTGGGTGAC
5′RACE	TCAGCGAGCATTGTAGCCTCTGTGTT	NA
3′RACE	AACGGAACTCAGGAATCGGCTCAACATC	726

Sequence analysis

ORFs in the genome were predicted using ORFfinder at NCBI (ORFfinder Home - NCBI). Domains, repeats, motifs, and other features of the three ORFs were predicted using the SMART tool (Simple Modular Architecture Research Tool) (SMART: Main page). Nuclear localization signals were predicted using NLStradamus (NLStradamus). Nucleic acid stem–loop structures were analyzed using the Rfam tool (Rfam: The RNA families database). Reference sequences of other avian astroviruses were downloaded from GenBank. Multiple sequence alignments were performed using MUSCLE in MEGA 11.0(Tamura et al., 2021). Phylogenetic trees were constructed using the neighbor-joining method with the maximum composite likelihood model in MEGA 11.0, and tree robustness was assessed using 1,000 bootstrap replicates.

Experimental replication of the disease

To assess the pathogenicity of the isolated GAstV-2 strain, an experimental infection was performed using 20 healthy 3-day-old goslings obtained from Yangzhou Xiaopeng Agricultural Technology Co., Ltd. The goslings were randomly divided into two groups (control and challenge groups, n = 10) and housed in separate isolators. Goslings in the challenge group were inoculated intraperitoneally with 0.4 mL of viral inoculum containing 10^6.68 TCID₅₀/mL, whereas those in the control group received 0.4 mL of sterile PBS (pH 7.2) as a negative control. Clinical signs were recorded daily for 14 days. Seven days after inoculation, several goslings per group were humanely euthanized using cervical dislocation. Post-mortem examination was conducted to assess pathological alterations, and liver and spleen tissues were sampled for histopathological assays.

Results

Clinical diagnosis and viral typing

In 2025, an outbreak of acute nephritis accompanied by growth retardation occurred on a goose farm in Jiangsu Province, China. Affected goslings exhibited typical symptoms of gout, including depression, paralysis, and enlargement of the leg joints. Postmortem examination revealed urate deposits in the liver and heart of dead goslings (Fig. 1A). RT-PCR analysis showed specific amplification only with GAstV-2-specific primers (Fig. 1B). To further confirm the etiology, we screened for common pathogens, including GPV, NDRV, AIV, DTMUV and GoCV, all of which tested negative (Fig. 1C), indicating that the outbreak was caused by infection with GAstV-2 alone.

Fig. 1.

Clinical diagnosis and viral typing. (A) Renal enlargement and urate deposition. (B) RT-PCR detection of clinical samples. M: DL2000 marker; lane 1: liver sample, GAstV-1 detection; lane 2: liver sample, GAstV-2 detection; lane 3: GAstV-1 positive control; lane 4: GAstV-2 positive control; lane 5: GAstV-1 negative control; lane 6: GAstV-2 negative control. (C) Detection of exogenous viruses. M: DL2000 marker; lanes 1–5: GPV, NDRV, AIV, DTMUV, and GoCV, respectively; lane 6: GAstV-2 negative control; lane 7: GAstV-2 detection.

Virus isolation and identification

To obtain a cultivable virus isolate, liver tissue homogenates from clinically affected goslings were inoculated into the LMH chicken hepatocellular carcinoma cell line for in vitro culture. Following inoculation, typical CPE, including cell rounding and extensive detachment, was observed within 72 h (Fig. 2A). RT-PCR analysis of the culture supernatant from cells exhibiting CPE yielded a positive result for GAstV-2 (Fig. 2B). To further purify the virus, the cell supernatant was serially passaged for 20 blind passages, with consistent induction of typical CPE at each passage. The complete genome of the 20th-passage virus culture was amplified and sequenced, confirming that it was a goose astrovirus isolate. This isolate was designated JSYC2503.

Fig. 2.

Pathological changes in virus-infected cells and PCR identification results. (A)Cytopathic effects induced by GAstV-2 JSYC2503 infection in LMH cells (× 50). Representative phase-contrast images of uninfected LMH cells (left) and LMH cells infected with GAstV-2 JSYC2503 (right) at 72 h post-infection. (B)Electrophoresis results of PCR using cell culture supernatant. M: DL2000 DNA Marker; lane 1: positive control; lane 2: cell culture supernatant; lane 3: negative control.

Genome sequence analysis

Whole-genome amplification of strain JSYC2503 was performed using five pairs of whole-genome amplification primers and two rapid amplification of cDNA ends (RACE) primers. The amplification products are shown in Fig. 3A and B. The complete genome sequence was obtained after sequencing and assembly and has been deposited in GenBank under accession number PX548819.1.

Fig. 3.

Molecular identification and genomic characterization of GAstV-2 strain JSYC2503. (A) M: DL5000 DNA Marker; lane 1: GAst-2-5′; lane 2: GAst-2-1; lane 3: GAst-2-2; lane 4: GAst-2-3; lane 5: GAst-2-3′. (B)M: DL2000 DNA Marker; lane 1: 5′RACE; lane 2: 3′RACE. (C) Schematic diagram of the nucleotide positions of the three predicted ORFs, including stop codons, in the genome. The translation start sites of ORF1a and ORF2 are indicated by black triangles, and the start site of the ribosomal frameshift signal sequence AAAAAAC is indicated by a gray triangle. Abbreviations: CC, coiled-coil domain; TM, transmembrane domain; Pro, protease; NLS, nuclear localization signal; Znf, zinc finger-like motif; ORF, open reading frame; RFS, ribosomal frameshift signal; RdRp, RNA-dependent RNA polymerase; s2m, stem-loop II-like motif.

Analysis revealed that the complete genome of GAstV strain JSYC2503 is 7,180 nt in length (Fig. 3C), comprising an 18-nt 5ʹ-UTR, three overlapping open reading frames (ORF1a: 3,255 nt; ORF1b: 1,560 nt; ORF2: 2,115 nt), and a 232-nt 3ʹ-UTR.

ORF1a (nt 19–3273) encoded a nonstructural polyprotein of 1085 amino acid(aa), including a trypsin-like serine protease domain (aa 554–706), a nuclear localization signal (₇₇₃KKKGKTKKTARGN₇₈₅), two coiled-coil domains (aa 134–177 and aa 735–762), four potential transmembrane domains (aa 231–248, aa 384–406, aa 421–443, and aa 455–477), and a conserved zinc finger-like DNA-binding motif (aa 1057–1077).

ORF1b (nt 3264–4814) encoded an RNA-dependent RNA polymerase (RdRp) consisting of 387 amino acids. A heptameric ribosomal frameshift signal (AAAAAAC) (nt 3264–3270), located in the linker region between ORF1a and ORF1b, was identified, followed by a stem-loop structure. ORF2 (nt 4833–6947), the most variable region, encoded the capsid precursor protein.

The astrovirus-conserved CCGAA motif was present at the 5′ end of the genome and within the 18-nt intergenic region between the ORF1b stop codon and the ORF2 start codon. Based on Rfam analysis, an s2m motif was identified in the 3′-UTR region (nt 6958–7000).

We aligned the amino acid sequences of the three ORFs and the complete genome sequence of strain JSYC2503 with those of representative members of the genus Avastrovirus; the results are summarized in Table 3. Strain JSYC2503 showed the highest sequence identity to goose astrovirus strain JXNC1 at both the whole-genome level (99.6%) and the amino acid level (ORF1a, 99.8%; ORF1b, 99.4%; ORF2, 99.7%). In contrast, strain JSYC2503 exhibited relatively low sequence identity to other avian astroviruses, including the FLX strain also isolated from geese, at the whole-genome level (29.9%–47.1%) and at the amino acid level (ORF1a, 29.8%–58.9%; ORF1b, 53.7%–70.9%; ORF2, 29.9%–56.6%).

Table 3.

Percentage identity of the complete genome sequence and deduced amino acid sequences of the three ORFs of GAstV-2 strain JSYC2503 compared with representative members of the genus Avastrovirus.

				Sequence identity (%)
Avastrovirus species	Virus	Strain	GenBank accession no.	Genome (nt)	ORF1a (aa)	ORF1b (aa)	ORF2 (aa)
Avastrovirus 1	TAstV-1	-	NC_002470	36.5%	41.0%	58.1%	40.5%
Avastrovirus 2	ANV	G-4260	NC_003790	29.9%	29.8%	53.7%	29.9%
Avastrovirus 3	TAstV-2	-	NC_005790	47.1%	58.9%	70.9%	56.6%
	DAstV-1	C-NGB	FJ434664	42.6%	48.9%	65.7%	56.2%
Unassigned	DAstV-2	SL1	KF753804	44.6%	58.5%	69.9%	38.6%
	DAstV-3	CPH	KJ020899	41.0%	49.9%	67.2%	38.7%
	DAstV-4	YP2	JX624774	36.6%	42.5%	62.9%	36.1%
	CAstV-A	G059	KT886453	39.0%	48.3%	67.2%	37.7%
	CAstV-B	GA2011	JF414802	41.4%	48.6%	66.9%	38.1%
	GAstV-2	SD01	MF772821	96.6%	99.4%	99.6%	97.2%
	GAstV-1	FLX	KY271027	40.5%	47.1%	63.1%	42.0%
	GAstV-2	JXNC1	PV524668	99.6%	99.8%	99.4%	99.7%

Phylogenetic analysis

To elucidate the evolutionary relationship between strain JSYC2503 and other members of the genus Avastrovirus, phylogenetic trees were reconstructed based on the full-length genome (Fig. 4A) and the ORF1a (Fig. 4B), ORF1b (Fig. 4C), and ORF2 (Fig. 4D) nucleotide sequences. The datasets included representative sequences of GAstV, duck astrovirus (DAstV), turkey astrovirus (TAstV), chicken astrovirus (CAstV), and avian nephritis virus (ANV) available in GenBank. Phylogenetic trees were constructed using the neighbor-joining method with maximum composite likelihood distances and 1,000 bootstrap replicates in MEGA 11.

Fig. 4.

Phylogenetic analysis of goose astrovirus. Phylogenetic trees were constructed based on the complete genome sequence (A) and the amino acid sequences of ORF1a (B), ORF1b (C) and ORF2 (D), using the neighbour-joining method with 1,000 bootstrap replicates and the maximum composite likelihood model. The GAstV-2 JSYC2503 isolate identified in this study is indicated by a black circle.

In all four phylogenetic reconstructions, strain JSYC2503 consistently clustered within the GAstV clade, forming a well-supported monophyletic group with other goose-origin astroviruses. Specifically, in the full-genome analysis, JSYC2503 exhibited the closest genetic affinity with GAstV isolates JXNC1 and HNIG, sharing a common ancestor with bootstrap support greater than 95%. This topological consistency was maintained in the individual ORF1a, ORF1b, and ORF2 gene trees, in which JSYC2503 grouped tightly with Chinese GAstV variants identified over the past decade (e.g., SDXT, CXZ/18, and GTF-07). In contrast, JSYC2503 was genetically distant from DAstV, TAstV, CAstV, and ANV reference strains, which formed distinct, well-separated clades corresponding to their host species. No significant topological incongruence was observed among the full-genome and individual ORF phylogenies that would suggest interspecies recombination events involving JSYC2503.

Experimental replication of the disease

To determine the in vivo pathogenicity of the JSYC2503 isolate, an animal challenge study was conducted using 3-day-old healthy goslings via intraperitoneal inoculation. Following challenge, mortality began on day 2 post-infection, with a cumulative mortality rate of 50% by day 6. Surviving animals exhibited typical clinical symptoms, including depression, reduced feed intake and growth retardation (Fig. 5A), as well as swelling of the leg joints, inability to stand and difficulty in walking (Fig. 5B).

Fig. 5.

Clinical symptoms and autopsy lesions of GAstV-infected geese. (A) Infected geese show lethargy, crouching, diarrhea, drowsiness, and clustering; (B) Infected geese exhibit swollen leg joints, inability to stand or walk; (C) Liver; (D) Kidneys; (E) Uric acid deposits.

At necropsy on day 7 post-infection, the predominant pathological changes were observed in the liver, spleen, bursa of Fabricius, and kidneys. The liver was enlarged and discolored (Fig. 5C), the spleen was markedly enlarged, and the bursa showed obvious atrophy. In addition, the kidneys exhibited severe swelling accompanied by extensive urate deposition (Fig. 5D and E), which is consistent with the characteristic lesions of visceral gout.

Discussion

Goose astrovirus 2 (GAstV-2) has become a major viral pathogen of goslings in China because of its close association with visceral gout, growth retardation, and substantial mortality. In the present study, we isolated and characterized a contemporary GAstV-2 strain, JSYC2503, from goslings affected by acute nephritis and gout in Jiangsu Province. The high nucleotide sequence identity (>99%) between JSYC2503 and previously reported GAstV-2 strains indicates that this isolate is part of the dominant lineage currently circulating in eastern China rather than a newly emerged variant (Jiang et al., 2025a; Li et al., 2025a). This interpretation is further supported by phylogenetic analysis, which consistently placed JSYC2503 within the GAstV-2 clade with strong bootstrap support, reinforcing the view that goose-origin astroviruses have undergone host-associated adaptation and are phylogenetically distinct from astroviruses circulating in ducks and chickens (Guo et al., 2023; Liu et al., 2025).

The pathogenicity experiments demonstrated that JSYC2503 is highly virulent in young goslings. The principal clinical and pathological manifestations observed after experimental infection, particularly severe visceral gout and 50% mortality, closely mirrored those described in naturally occurring outbreaks (Zhang et al., 2018; Liu et al., 2022; Zhu et al., 2024). Beyond the typical renal and serosal urate deposition, the concomitant occurrence of splenomegaly and bursal atrophy suggests that GAstV-2 may also target lymphoid tissues. Such lymphotropism may compromise host immune competence and thereby predispose infected birds to secondary bacterial infections (Ding et al., 2021, 2024; Li et al., 2025c).

The lesions documented in this study also provide clues to the pathogenesis of GAstV-2-associated gout. On the basis of the present findings, a dual-pathway model appears plausible. First, direct viral injury to renal tubular epithelial cells may disrupt uric acid excretion, potentially through interference with urate transporters such as ABCG2 and SLC2A9 (Wu et al., 2020; Bi et al., 2024; Jia et al., 2024). Second, the hepatic enlargement and multifocal necrosis observed in infected goslings suggest that liver injury, whether secondary to systemic inflammation or attributable to direct viral replication, may further exacerbate purine metabolic disturbances and favor urate deposition in visceral tissues(Wang et al., 2023; Fan et al., 2025). Although these mechanisms remain to be experimentally validated, they offer a coherent framework linking viral replication, organ injury, and metabolic dysregulation.

An additional feature of interest is the presence of a stem-loop II-like motif (s2m) within the 3′ untranslated region (3′UTR). This highly conserved RNA element has been identified in astroviruses, coronaviruses, avian infectious bronchitis virus, and other unrelated viruses, and has been implicated in viral replication and natural recombination (Jonassen et al., 1998). Given its high degree of conservation, the s2m element may represent a functionally important determinant of viral fitness. Reverse genetics approaches targeting this region are therefore warranted to clarify whether it contributes directly to replication efficiency, host adaptation, or immune evasion in geese (Tengs et al., 2013; Lulla et al., 2021).

Another notable observation is the apparent genetic stability of JSYC2503. The absence of detectable recombination signals is encouraging from a vaccine-development perspective, as it suggests a lower likelihood of rapid recombination-associated attenuation or immune escape (Li et al., 2025a). Nevertheless, the co-circulation of GAstV-2 with novel goose nephritis viruses and Goose circovirus (GoCV) in Chinese waterfowl populations underscores the importance of continued molecular surveillance, particularly for detecting cross-species transmission and potential genetic exchange among co-infecting viruses (Li et al., 2025b).

Several limitations of the present study should be acknowledged. First, the intraperitoneal challenge route bypasses the natural oral–fecal route of infection and therefore may not fully recapitulate early host–pathogen interactions at the mucosal surface. Future studies using oral inoculation would be valuable for clarifying the contribution of mucosal immunity to disease progression (Wang et al., 2023). Second, quantitative analysis of viral loads in individual organs was not performed. Such data would strengthen understanding of the relationship between viral replication kinetics and the dysregulation of uric acid metabolism observed during infection (Zhu et al., 2024).

Taken together, JSYC2503 represents a well-characterized contemporary GAstV-2 strain with stable genetic features, efficient replication in vitro, and reproducible pathogenicity in vivo. These properties make it a valuable reference strain for future studies of GAstV-2 pathogenesis and for vaccine challenge models. More broadly, the genomic and biological data generated here provide a useful foundation for the development of improved diagnostic strategies and ORF2-based subunit vaccines.

Conclusion

In summary, a novel GAstV-2 strain, designated JSYC2503, was isolated from goslings with gout in Jiangsu Province, China. The virus was successfully propagated in LMH cells and showed stable infectivity in vitro. Genomic and phylogenetic analyses confirmed that JSYC2503 belongs to the GAstV-2 clade and is closely related to recently circulating Chinese strains. Experimental infection demonstrated that this isolate is highly pathogenic to young goslings, causing severe clinical disease, characteristic gout lesions, and substantial mortality. These results provide valuable insight into the molecular evolution and pathogenicity of GAstV-2 and establish an important reference for the prevention and control of goose astrovirus infection.

Funding

This work was supported by the Earmarked Fund for Modern Agro-industry Technology Research System in Waterfowl Industry [grant number CARS-42-3], the National Natural Science Foundation of China grant [grant number 32272860], and the Priority Academic Program Development of Jiangsu Higher Education Institutions (Animal Science).

Authorship contributions

Yingjie Gu conducted virus isolation from clinical goose samples, performed RT-PCR assays, carried out the formal data analysis, prepared figures and tables, and drafted the original manuscript. Xuming Hu conceptualized the study, designed the overall experimental protocols, supervised the laboratory work, and revised the final manuscript. Huangjun Shen contributed to the methodological design of the detection assays and the sequencing experiments, provided key clinical samples, and curated the raw sequencing data for genome assembly. Huixian Wu participated in the virus isolation work and critically reviewed and revised the manuscript for important intellectual content. Guangzhong Peng participated in the quality assessment of sequencing data, optimized the assembly strategy, and assisted in sequence alignment and preliminary analysis of genetic variation sites. Suyu Fan participated in the design of RT-PCR primers and optimization of the reaction system, and performed confirmatory analysis and result interpretation of selected sequencing data. Xiao Wang participated in part of the formal data analysis and data visualization. Qi Xu established the study framework, interpreted the epidemiological and phylogenetic results, and contributed to the final revision of the manuscript. All authors reviewed and approved the final version of the manuscript and agree to be accountable for all aspects of this work.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.