Chlorogenic acid attenuates LPS-induced hepatic oxidative stress in broilers by regulating cyclooxygenase-2 expression

Abstract

Immune stress can impair growth performance and induce hepatic oxidative injury; however, the protective potential and underlying mechanisms of the dietary phenolic compound chlorogenic acid (CGA) remain unclear. In this study, we investigated whether CGA alleviates lipopolysaccharide (LPS)-induced hepatic oxidative damage in broilers and explored the involvement of cyclooxygenase-2 (COX-2). Since LPS challenge markedly upregulated PTGS2 (encoding COX-2) and COX-2 is closely associated with redox homeostasis, the selective COX-2 inhibitor celecoxib was included as a pharmacological comparator to determine whether the hepatoprotective effects of CGA are associated with COX-2 regulation. LPS challenge impaired growth performance, as indicated by decreased average daily gain and increased feed conversion ratio, elevated serum corticosterone levels, reduced hepatic antioxidant capacity and antioxidant enzyme activities (CAT and SOD), and increased lipid peroxidation (MDA). Dietary supplementation with CGA (1000 mg/kg) partially reversed these alterations. Transcriptome analysis suggested the involvement of FoxO signaling, and CGA downregulated PTGS2 and NOX1 while upregulating Nrf2, HO-1, FoxO1/3, GPX1, and GST expression. Celecoxib partially reproduced the effects of CGA by reducing PTGS2 and NOX1 expression and increasing FoxO3 expression. Collectively, CGA alleviates LPS-induced hepatic oxidative stress and partially improves growth performance, potentially by suppressing a COX-2-associated NOX1-mediated pro-oxidant response and enhancing Nrf2/FoxO3/GPX1-dependent antioxidant defenses.

Introduction

The modern broiler industry faces multiple stressors associated with intensive production systems, including high stocking density, frequent vaccination, ambient temperature fluctuations, poor ventilation, and pathogen exposure. These factors impair immune function, increase susceptibility to pathogens(Niu et al., 2022), activate the hypothalamic-pituitary-adrenal (HPA) axis, elevate corticosterone levels, disrupt hepatic metabolism(Zhong et al., 2024), depress growth performance, and reduce economic returns. Immune stress refers to systemic responses caused by excessive activation of the immune system by exogenous or endogenous stimuli, among which bacterial lipopolysaccharide (LPS) is a widely used immunological stressor. Intraperitoneal LPS challenge has been shown to impair growth performance in broilers(Liu et al., 2023b), induce intestinal inflammation(Hu et al., 2024), cause gut microbiota dysbiosis and barrier dysfunction(Tan et al., 2023), and disrupt hepatic metabolism and antioxidant capacity(Zhong et al., 2024). As the central organ responsible for metabolism, detoxification, and immune regulation, the liver plays a critical role in broiler growth and development, and hepatic injury can severely compromise overall health. For example, heat stress induces mitochondrial and endoplasmic reticulum dysfunction in the liver, reducing antioxidant capacity and promoting abnormal lipid and glycogen deposition(Jing et al., 2023); intraperitoneal LPS weakens hepatic antioxidant defenses and disrupts energy metabolism(Zhong et al., 2024); and ochratoxin A (OTA) induces hepatic oxidative stress, endoplasmic reticulum stress, and mitochondrial homeostasis disruption(Zou et al., 2024). Hepatic redox homeostasis is a key component of antioxidant defense, maintaining the balance of reactive oxygen species (ROS) and reactive nitrogen species (RNS) to prevent oxidative damage and preserve systemic homeostasis. Disruption of this balance contributes to oxidative stress and the development of various liver disorders. In mammalian models, for example, virus-induced oxidative stress promotes hepatocarcinogenesis(Ivanov et al., 2017) and iron overload exacerbates non-alcoholic fatty liver disease(Corradini and Pietrangelo, 2012). Therefore, diverse environmental and immunological stressors compromise hepatic health in broilers, impair growth, and negatively affect poultry production.

Plant-derived polyphenols, owing to their natural antioxidant and anti-inflammatory properties, have emerged as promising anti-stress feed additives, and these plant extracts are increasingly considered potential alternatives to in-feed antibiotics. Chlorogenic acid (CGA) is a polyphenolic compound widely distributed in plants and particularly abundant in honeysuckle (Lonicera japonica), Eucommia ulmoides, and coffee beans. CGA has been reported to alleviate hepatic lipid accumulation by restoring autophagic flux under a high-fat diet(Meng et al., 2023), attenuate renal injury, inflammation, and fibrosis by modulating the TLR4/NF-κB pathway(Jiao et al., 2024), and protect against acetaminophen-induced hepatotoxicity by activating Nrf2 while suppressing MAPK/NF-κB and NLRP3 signaling pathways(Chen et al., 2024; Wei et al., 2018). Furthermore, CGA mitigates LPS-PG-induced inflammation by inhibiting TLR4/MYD88-mediated NF-κB, PI3K/Akt, and MAPK signaling(Park and Yoon, 2022), and promotes ferroptosis through the PTGS2/AKR1C3/GPX4 axis to inhibit proliferation, migration, and invasion of hepatocellular carcinoma (HCC) cells(Wu et al., 2025), highlighting its potential to regulate cyclooxygenase-2 (COX-2) related pathways under pathological conditions. Overall, these findings suggest that CGA alleviates inflammation and oxidative injury through regulation of key pathways, including TLR4/NF-κB and Nrf2/HO-1 signaling, and may protect against liver dysfunction. In poultry, CGA likewise exhibits multiple beneficial effects: dietary CGA supplementation alleviates LPS-induced intestinal barrier damage and growth suppression in broilers(Tan et al., 2023), enhances antioxidant capacity, restores intestinal barrier integrity, and improves beneficial microbiota profiles under high-density stress(Bai et al., 2022; Liu et al., 2023c); supplementation with 1000 mg/kg CGA mitigates the adverse effects of heat stress on growth performance and meat quality while improving oxidative stability and fatty acid profiles of breast muscle(Zhao et al., 2019); and CGA alleviates DQ-induced growth depression, oxidative stress, and hepatic inflammation(Zha et al., 2023). These findings support CGA as a promising functional feed additive for broilers.

In summary, although CGA has demonstrated antioxidant, anti-inflammatory, and hepatoprotective activities across various models, its specific role and underlying mechanisms in regulating hepatic redox homeostasis and overall health in broilers under immune stress remain unclear. Therefore, this study aimed to investigate the protective effects of dietary CGA supplementation under LPS-induced immune stress conditions and provide insights into its potential application as an anti-stress feed additive and a partial alternative to antibiotics in broiler production.

Materials and methods

Chlorogenic acid composition, purity, and structural identification

Mass spectrometric identification

CGA in the sample was qualitatively identified by electrospray ionization mass spectrometry (ESI-MS) in negative ion mode. Methanol, acetonitrile, formic acid, and ultrapure water (resistivity ≥ 18.2 MΩ·cm) were used for sample preparation and mobile phase preparation. The mass spectrometer equipped with an ESI source was operated in negative ion mode with a spray voltage of −3.5 kV, ion source temperature of 350°C, drying gas flow rate of 10 L/min, drying gas temperature of 300°C, and scan range of m/z 50-2000. The sample was dissolved in methanol, filtered, and subjected to MS analysis. Mass spectra were recorded, and characteristic ion peaks were analyzed to confirm the presence of chlorogenic acid.

HPLC determination of purity

The sample was dissolved in acetonitrile and water, thoroughly mixed, and filtered through a microporous membrane. The filtrate was collected for subsequent HPLC analysis. A C18 reversed-phase column was used, with methanol and water as the mobile phase after degassing. The HPLC system was operated at a flow rate of approximately 1.0 mL/min, a column temperature of 30-40°C, and a detection wavelength of 325 nm. A defined volume of the filtered sample solution was injected into the HPLC system. Chlorogenic acid and other components were separated on the column and detected by a UV detector, generating chromatograms based on absorbance intensity over time. The purity of chlorogenic acid was calculated using the area normalization method according to the following equation:

$$\text{Purity}(\%)=\frac{A_{\text{CGA}}}{{\sum }_{i=1}^n{A}_i}\times 100$$

where $A_{\text{CGA}}$ represents the chromatographic peak area of chlorogenic acid, $A_i$represents the peak area of the $i$th detected component, and $n$represents the total number of detected components.

Fourier-transform infrared (FT-IR) spectroscopy

An appropriate amount of potassium bromide (KBr) was weighed into an agate mortar, followed by the addition of 1-2 mg of chlorogenic acid standard. The mixture was ground thoroughly until a homogeneous powder was obtained. The powder was transferred into a die and pressed into a transparent KBr pellet under a pressure of approximately 10 MPa using a hydraulic press. After warming up and calibrating the FT-IR spectrometer, the KBr pellet was placed in the sample holder and scanned. Spectra were collected over the range of 4000-500 cm⁻¹ with a resolution of 4 cm⁻¹ and 32 scans. The FT-IR spectra were processed using dedicated software (including baseline correction and smoothing), and the obtained spectra were compared with reference spectra of chlorogenic acid to confirm structural characteristics.

¹H NMR analysis

CGA was dissolved in an appropriate volume of dimethyl sulfoxide-d₆ (DMSO-d₆) to prepare a solution suitable for NMR analysis. The solution was heated at 100°C for 1 h to ensure complete dissolution. After cooling, 0.1 mL of deuterium oxide (D₂O) was added and mixed gently to allow hydrogen-deuterium exchange. The mixture was transferred into an NMR tube and analyzed using a Bruker ARX-500 NMR spectrometer. The ¹H NMR spectrum was recorded at 600 MHz and 70°C. Chemical shifts and signal intensities were compared with those of reference standards to obtain structural information and confirm the identity of chlorogenic acid.

Animals and treatments

A total of 360 one-day-old male Arbor Acres broiler chicks were purchased from Henan Quanda Poultry Breeding Co., Ltd. (Henan, China). Birds were randomly assigned to five treatment groups, with six replicates per group and 12 birds per replicate: Saline, Saline + CGA, LPS, LPS + CGA, and LPS + Celecoxib.

Birds in the LPS group received intraperitoneal injections of lipopolysaccharide (LPS, 0.5 mg/kg) starting at 14 days of age and continuing every 24 h. In the LPS + Celecoxib group, birds were intraperitoneally injected once with celecoxib (10 mg/kg, dissolved in DMSO; Sigma) 15 min before the first LPS injection at 14 days of age, followed by LPS administration as described for the LPS group. Celecoxib was included as a selective COX-2 inhibitor to evaluate whether inhibition of COX-2 could partially reproduce the protective effects observed with CGA treatment. LPS (Escherichia coli serotype O55:B5) was purchased from Sigma, and celecoxib was obtained from Selleck. The remaining groups received intraperitoneal injections of an equal volume of physiological saline (0.9%).

The experimental period lasted 23 days. CGA (purity, 99%) was obtained from Changsha Staherb Natural Ingredients Co., Ltd. (Changsha, China) and incorporated into the basal diet at 1 g/kg. The dosage was selected based on previous work from our laboratory(Tan et al., 2023). CGA-supplemented diets were provided from day 1 until the end of the experiment. Broilers were housed in cages with free access to feed and water. Environmental conditions, including temperature, humidity, and lighting, were controlled throughout the experiment. The initial temperature was maintained at approximately 34°C and gradually reduced by 2°C per week until reaching approximately 24°C. Continuous lighting was provided during the first 3 days, followed by a 23 h light/1 h dark cycle thereafter.

All experimental procedures were performed in accordance with animal welfare guidelines and approved by the Animal Protection and Use Committee of Henan University of Science and Technology (approval No. DWFL36891-2023).

Growth performance

After an 8-h feed withdrawal period, birds in each cage were weighed on days 14, 15, 17, 19, 21, and 23. Body weight (BW) was recorded from 0 h after the first LPS injection, with the first measurement interval set at 24 h and subsequent intervals at 48 h. Average body weight (BW), body weight gain (BWG), feed intake (FI), and feed conversion ratio (FCR) were calculated for each interval between consecutive weighing points.

Sample collection

Samples were collected at 2, 4, 24, and 72 h after the first LPS injection (four time points in total). At each time point, one bird per replicate was randomly selected from each treatment group, resulting in 30 birds sampled per time point. Blood samples were collected from the wing vein before euthanasia, and birds were subsequently euthanized by cervical dislocation. Liver samples were collected from the same region of the left hepatic lobe, immediately placed into RNase-free EP tubes, snap-frozen in liquid nitrogen, and stored at −80°C until analysis. Blood samples were centrifuged at 3000 × g for 15 min, and the obtained serum was collected and stored at −80°C for subsequent analysis.

Determination of stress-related biochemical indicators

Serum corticosterone (CORT), malondialdehyde (MDA), and glutathione (GSH) concentrations, as well as catalase (CAT) and superoxide dismutase (SOD) activities, were measured using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.

Transcriptome sequencing and data analysis

Total RNA was extracted from liver samples collected at 17 days of age. RNA concentration and purity were assessed by RNA-specific agarose gel electrophoresis and an Agilent 2100 Bioanalyzer. Poly(A)+ mRNA was enriched based on polyadenylated tails and fragmented into 200-300 bp fragments by ion shearing. First-strand cDNA was synthesized from fragmented RNA using random hexamer primers and reverse transcriptase, followed by second-strand cDNA synthesis. The resulting cDNA was amplified by PCR to construct sequencing libraries with an insert size of approximately 300-400 bp. Library quality and size distribution were evaluated using an Agilent 2100 Bioanalyzer, and library concentration was determined using fluorescence-based quantification methods. Qualified libraries were subsequently sequenced on an Illumina platform.

Raw sequencing reads were subjected to quality control and mapped to the reference genome. Gene expression levels were quantified, followed by gene expression profiling, differential expression analysis, and functional enrichment analysis (including KEGG pathway analysis). Additional bioinformatic analyses, including volcano plot visualization, hierarchical clustering, trend analysis, protein-protein interaction (PPI) network analysis, and transcription factor analysis, were performed to explore differentially expressed genes and their potential biological functions.

Real-time quantitative PCR validation of gene expression

Total RNA was extracted from liver samples using TRIzol® Reagent (Invitrogen, Thermo Fisher Scientific, Scotland, UK). RNA concentration and purity were assessed by measuring the A260/A280 ratio using a nucleic acid spectrophotometer. Complementary DNA (cDNA) was synthesized from total RNA using the Evo M-MLV reverse transcription premix kit with gDNA remover for qPCR (Accurate Biology) according to the manufacturer’s protocol.

Real-time quantitative PCR was performed using the SYBR Green Pro Taq HS premix qPCR kit (Accurate Biology). Primer sequences were designed based on sequences obtained from the NCBI database, and the specific primer pairs are listed in Table 1. Relative gene expression levels were calculated using the 2^-ΔΔCt method.

Table 1.

Primer sequences used for real-time PCR.

Name	Forward Primer, Reverse Primer (5′−3′)	GenBank Number
PTGS2 NOX1 NOX4 Nrf2 HO-1 FoxO1 FoxO3 GPX1 GST GAPDH	CCTGGAGAAAGGAGACCTCG TGGGTAACAGCAGTCACCAG CGGTACTTCTACACCAGGGC TCCTGCAGCACGAGAAGC CTGGCTCTCACTGAACGTGT GCTAACACACAATCCTAGCCCT GTCAGATCCCCTCTGCGTTC AGCAGCAAGGGTTGGAGTG ACACAACGCTGAAAGCATGT GATGAAGTACAGGGACGCCG TAGGATGTAGTAGGAGGCTACGG TGCTGCCAACTCTGACGAAA CTCATGGATGCAGATGGGCT CAGTTTGAGGGCCTGTTTGC CCAATTCGGGCACCAGGAGAA CTCTCTCAGGAAGGCGAACAG TTTCCCCTCTTGCAGAGTTTT TCACTCCACTTATCAGCAAACAGA TCGGAGTCAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC	NM_001167718.1 NM_001101830.3 NM_001101829.3 NM_001167718.2 NM_205344.2 NM_204328.2 XM_001234495.7 NM_001277853.3 NM_001001777.2 NM_204305.2

Statistical analysis

Statistical analyses were performed using SPSS Statistics software (Version 26.0 for Windows, IBM Corp., Armonk, NY, USA). Data distribution was assessed for normality, and homogeneity of variance was evaluated before statistical testing. Differences among groups were analyzed using one-way analysis of variance (one-way ANOVA), followed by Duncan’s multiple range test for multiple comparisons. Statistical significance was set at P < 0.05. All data are presented as mean ± standard error of the mean (SEM). Graphs were generated using GraphPad Prism 8.0 to visualize the experimental results.

Results

CGA composition characterization

In the negative ion mode mass spectrum, the quasi-molecular ion [M−H]⁻ was detected at m/z 353, accompanied by a characteristic fragment ion at m/z 191 corresponding to 1,3,4,5-tetrahydroxycyclohexanecarboxylic acid and a dimer ion at m/z 707. These spectral characteristics were consistent with those of the chlorogenic acid standard, confirming the presence of chlorogenic acid in the sample (Fig. 1). In the HPLC chromatogram, chlorogenic acid appeared as the predominant peak, indicating that it was the major component of the sample. The purity of chlorogenic acid was determined to be 99.18% using the area normalization method (Fig. 2).

Fig. 1.

Mass spectrum of chlorogenic acid.

Fig. 2.

HPLC chromatogram of chlorogenic acid.

The FT-IR spectrum of chlorogenic acid (Fig. 3), recorded in the range of 4000-400 cm⁻¹, exhibited absorption bands consistent with previously reported characteristic peaks. Specifically, the broad absorption band at 3362 cm⁻¹ was assigned to O—H stretching vibrations. The prominent peak at 1690 cm⁻¹ was attributed to C O stretching, whereas the absorption peaks at 1630 cm⁻¹ and 1597 cm⁻¹ were associated with C C stretching vibrations. The peak at 1521 cm⁻¹ was attributed to C O-related vibrations, while the peaks at 1445 cm⁻¹ and 1382 cm⁻¹ corresponded to methyl bending vibrations. Absorption bands at 1286, 1175, 1120, 1087, 1038, and 973 cm⁻¹ were assigned to C—O-C stretching vibrations. Bands at 850 and 818 cm⁻¹ were attributed to out-of-plane bending vibrations, and the characteristic peak at 613 cm⁻¹ was associated with symmetric stretching vibrations of the ring structure. These characteristic absorption bands further supported the structural identity of the sample as chlorogenic acid.

Fig. 3.

FT-IR spectra of chlorogenic acid.

The ¹H NMR spectrum of CGA (Fig. 4) showed characteristic proton signals ranging from δ 2.0 to 7.5 ppm. In the caffeoyl moiety, aromatic proton signals were observed between δ 6.80 and 7.50 ppm. A doublet at δ 7.50 ppm (1H) and another doublet at δ 7.16 ppm (1H) were assigned to the trans-olefinic protons (H-7′ and H-8′, respectively). A doublet of doublets at δ 7.00 ppm (1H) corresponded to an ortho-coupled aromatic proton (H-2′), and a doublet at δ 6.80 ppm (1H) was attributed to the aromatic proton at H-5′. In the quinic acid moiety, a multiplet at δ 5.36-5.42 ppm (1H) was assigned to the methine proton adjacent to the ester linkage (H-3). A multiplet at δ 4.20 ppm (1H) was attributed to H-4, while a doublet of doublets at δ 3.70-3.80 ppm (1H) corresponded to H-5. A multiplet at δ 2.00-2.30 ppm (2H) was assigned to methylene protons (H-2). The chemical shifts were consistent with previously reported NMR data for CGA derivatives by Clifford et al. The integration ratio of aromatic protons (δ 6.80-7.50 ppm) to aliphatic protons (δ 2.00-5.42 ppm) was approximately 1:3, consistent with the molecular formula C₁₆H₁₈O₉, further confirming the molecular structure of CGA(Clifford et al., 2003).

Fig. 4.

¹H NMR spectrum of chlorogenic acid.

Fig. 5.

Effects of LPS and chlorogenic acid (CGA) on serum corticosterone concentration and hepatic antioxidant parameters. (A) Serum corticosterone (CORT) levels; (B) hepatic total antioxidant capacity (T-AOC); (C) hepatic catalase (CAT) activity; (D) hepatic superoxide dismutase (SOD) activity; (E) hepatic malondialdehyde (MDA) content. Data are expressed as means ± SEM. (n = 6). Bars without common letters indicate significant differences (P < 0.05).

Effects of CGA on LPS-induced growth performance and serum corticosterone levels

As shown in Table 2, compared with the control group, the LPS-challenged group exhibited significantly reduced mean body weight at 24 h and at 3, 5, 7, and 9 days after the first intraperitoneal LPS injection (P < 0.05). In contrast, dietary supplementation with 0.1% CGA in the LPS-challenged group did not significantly differ from the LPS group, CGA group, or control group.

Table 2.

Effect of CGA on LPS-induced growth performance in broilers.

Items	Saline	LPS	LPS+CGA	Saline+CGA	SEM1	P-value
BW (g)
14d	363.04	358.85	357.62	361.25	1.556	0.639
15d	412.15	407.17	399.72	409.72	2.557	0.363
17d	520.24a	476.20c	490.54bc	506.48ab	4.687	0.002
19d	655.75a	594.97c	617.63bc	643.31ab	6.937	0.004
21d	802.38a	737.89c	746.60bc	786.07ab	9.095	0.023
23d	962.17a	881.38b	892.93bc	930.28ab	11.593	0.044
BWG (g/bird/day)
14-15d	49.11	48.32	42.09	48.47	1.412	0.264
15-17d	53.16a	39.35c	44.44b	50.56a	1.401	<0.001
17-19d	62.46	59.15	61.04	63.58	2.458	0.953
19-21d	73.32	70.08	68.87	71.38	1.288	0.669
21-23d	77.83	78.03	73.22	72.1	1.717	0.532
ADFI (g/bird/day)
14-15d	62.27	65.76	61.62	62.25	1.190	0.628
15-17d	67.76a	59.68b	59.07b	68.08a	1.129	<0.001
17-19d	86.50a	79.29ab	70.64b	83.24a	2.152	0.026
19-21d	95.25	93.93	89.22	93.24	1.187	0.330
21-23d	108.74	105.66	96.53	103.97	2.011	0.212
FCR (g/g)
14-15d	1.24c	1.45a	1.36ab	1.29bc	0.025	0.005
15-17d	1.27c	1.41a	1.33b	1.33b	0.014	0.001
17-19d	1.37	1.34	1.30	1.33	0.035	0.946
19-21d	1.31	1.37	1.27	1.33	0.023	0.071
21-23d	1.33	1.44	1.29	1.34	0.025	0.184

BW: body weight, BWG: body weight gain, ADFI: average daily feed intake, FCR: feed conversion ratio. a, b, c Means in the same row without common superscripts differ significantly (P < 0.05).

¹SEM: standard error of the mean.

For average daily gain (ADG), the LPS group showed a significant decrease during days 15-17 compared with the control group (P < 0.05). However, dietary CGA supplementation significantly increased ADG compared with the LPS group (P < 0.05). Feed intake (FI) was significantly reduced in the LPS group during days 15-17 compared with the control group (P < 0.05), whereas the CGA group alone showed no significant difference compared with the control group. Furthermore, LPS challenge significantly increased the FCR during days 14-15 and 15-17 compared with the control group (P < 0.05). Dietary CGA supplementation significantly decreased FCR during days 15-17 compared with the LPS group (P < 0.05).

As shown in Fig. 5A, serum corticosterone concentration was significantly elevated in the LPS group at 17 days of age compared with the control group. Dietary CGA supplementation significantly attenuated the LPS-induced increase in corticosterone concentration.

Fig. 6.

Statistical and enrichment analysis of hepatic differentially expressed genes (DEGs) in 17-day-old broilers (Control vs. LPS and LPS vs. LPS+CGA). (A) Bar chart of DEGs; (B) Venn diagram of DEGs; (C) volcano plot of DEGs; (D) scatter plot of KEGG pathway enrichment analysis. In panels A and C, red and blue dots/bars represent upregulated and downregulated genes, respectively. In panel D, the circle size represents the number of enriched genes, and the color gradient from red to blue represents the P-value from lowest to highest.

Effects of CGA on LPS-induced hepatic antioxidant status and lipid peroxidation

Compared with the control group, the LPS group showed a significant decrease in hepatic total antioxidant capacity (T-AOC, P < 0.05). However, dietary CGA supplementation in LPS-challenged broilers did not significantly alter T-AOC levels compared with the LPS group (Fig. 5B).

Similarly, LPS administration significantly reduced CAT activity compared with the control group (P < 0.05), whereas SOD activity showed a decreasing trend without statistical significance (P > 0.05). Dietary CGA supplementation significantly increased both CAT and SOD activities compared with the LPS group (P < 0.05, Fig. 5C, D). No significant changes in these enzyme activities were observed in the CGA group.

Furthermore, hepatic MDA content was significantly increased in the LPS group compared with the control group (P < 0.05). Dietary CGA supplementation significantly reduced the LPS-induced increase in MDA content (Fig. 5E), whereas the CGA group showed no significant alteration.

Effects of CGA on hepatic transcriptome and oxidative stress-related gene expression

As shown in Fig. 6A, compared with the control group, LPS challenge resulted in 121 upregulated and 73 downregulated genes. Compared with the LPS group, dietary CGA supplementation in LPS-challenged broilers resulted in 184 upregulated and 44 downregulated genes (Fig. 6A). Among the differentially expressed genes (DEGs) identified across the three groups, 32 genes were consistently differentially expressed in all comparisons (Fig. 6B). Volcano plots in Fig. 6C illustrate the DEGs between the LPS and control groups, as well as between the CGA-supplemented LPS group and the LPS group. The significantly upregulated and downregulated genes are indicated by red and blue dots, respectively (P < 0.05). KEGG pathway enrichment analysis identified the top 20 significantly enriched pathways among the DEGs (Fig. 6D).

Fig. 7.

Real-time quantitative PCR (qPCR) validation of hepatic differentially expressed genes in 17-day-old broilers. Data show the protective effects of dietary chlorogenic acid (CGA) supplementation against LPS-induced injury. Bars without common letters indicate significant differences (P < 0.05). Data are expressed as means ± SEM (n = 6).

Overall, transcriptomic analysis revealed marked changes in hepatic gene expression, with the FoxO signaling pathway emerging as a key enriched pathway associated with oxidative stress regulation. The expression levels of selected oxidative stress-related genes were further validated by fluorescence quantitative PCR (Fig. 7). Compared with the control group, PTGS2 expression was significantly upregulated in the LPS group (P < 0.05), whereas dietary CGA supplementation significantly reduced the LPS-induced increase in PTGS2 expression (P < 0.05).

Fig. 8.

Effects of chlorogenic acid (CGA) and celecoxib on serum corticosterone concentration and hepatic antioxidant indices under LPS challenge. (A) Serum CORT levels; (B) hepatic T-AOC; (C) hepatic CAT activity; (D) hepatic SOD activity; (E) hepatic MDA content. Abbreviations: CORT, corticosterone; T-AOC, total antioxidant capacity; CAT, catalase; SOD, superoxide dismutase; MDA, malondialdehyde. Bars without common letters indicate significant differences (P < 0.05). Data are expressed as means ± SEM (n = 6).

Regarding glutathione S-transferase (GST), LPS challenge decreased GST expression, although the difference did not reach statistical significance (P > 0.05). Compared with the LPS group, CGA supplementation significantly increased GST expression (P < 0.05). Similarly, LPS challenge did not significantly alter GPX1 expression compared with the control group, whereas CGA supplementation significantly increased GPX1 expression (P < 0.05).

For Nrf2, LPS challenge significantly decreased its expression level compared with the control group (P < 0.05), while CGA supplementation significantly increased Nrf2 expression compared with the LPS group (P < 0.05). Although FoxO1 expression showed a decreasing trend after LPS challenge, the difference was not statistically significant; however, CGA supplementation significantly increased FoxO1 expression compared with the LPS group (P < 0.05).

Furthermore, LPS challenge significantly reduced FoxO3 expression (P < 0.05), whereas CGA supplementation significantly increased FoxO3 expression compared with the LPS group (P < 0.05). LPS challenge did not significantly affect HO-1 expression, but CGA supplementation significantly increased HO-1 expression (P < 0.05).

Regarding oxidative stress-related genes, NOX1 expression was significantly increased in the LPS group compared with the control group (P < 0.05), while CGA supplementation significantly decreased NOX1 expression compared with the LPS group (P < 0.05). No significant differences were observed in NOX4 expression among the groups.

Effects of selective COX-2 inhibition on growth performance, serum corticosterone, and hepatic oxidative stress in LPS-challenged broilers

As shown in Table 3, celecoxib administration did not significantly alleviate the LPS-induced reduction in growth performance. However, compared with the LPS group, celecoxib administration significantly reduced serum corticosterone concentrations at 14 and 17 days of age (Fig. 8A).

Table 3.

Effect of celecoxib on LPS-induced growth performance in broilers.

Items	LPS	LPS+CGA	LPS+Celecoxib	SEM1	P-value
BW (g)
14d	358.85	357.62	365.85	2.053	0.219
15d	397.50	399.72	410.52	3.088	0.185
17d	476.20	490.54	473.45	4.625	0.269
19d	594.97	617.63	578.33	8.084	0.113
21d	737.89	746.60	728.00	9.608	0.748
23d	881.38	892.93	855.78	12.609	0.466
BWG (g/bird/day)
14-15d	48.32	42.09	44.67	1.889	0.426
15-17d	39.35b	44.44a	34.23c	1.474	0.005
17-19d	59.15	61.04	46.11	3.264	0.100
19-21d	70.08	68.87	73.53	2.098	0.658
21-23d	78.03	73.22	68.56	2.208	0.261
ADFI (g/bird/day)
14-15d	65.76	61.62	63.03	1.638	0.605
15-17d	59.68	59.07	50.22	1.874	0.074
17-19d	79.29	70.64	72.53	2.536	0.428
19-21d	93.93	89.22	90.59	1.297	0.392
21-23d	105.66	96.53	100.01	2.181	0.272
FCR (g/g)
14-15d	1.45	1.36	1.44	0.0341	0.6136
15-17d	1.41a	1.33b	1.35ab	0.0148	0.0728
17-19d	1.34	1.30	1.41	0.0280	0.3208
19-21d	1.37	1.27	1.32	0.0239	0.2904
21-23d	1.44	1.29	1.39	0.0351	0.1847

BW: body weight, BWG: body weight gain, ADFI: average daily feed intake, FCR: feed conversion rate. a, b, c Means in the same row without common superscripts differ significantly (P < 0.05).

¹SEM, standard error of the mean.

Fig. 9.

Real-time quantitative PCR (qPCR) analysis of target genes in the liver of 17-day-old broilers. Data show the effects of the selective COX-2 inhibitor celecoxib against LPS-induced injury. Bars without common letters indicate significant differences (P < 0.05). Data are expressed as means ± SEM (n = 6).

Compared with the LPS group, celecoxib administration significantly increased CAT and SOD activities (P < 0.05, Fig. 8C and D) and significantly decreased hepatic MDA content (Fig. 8E), showing similar effects to those observed with CGA supplementation.

As shown in Fig. 9, compared with the LPS group, celecoxib administration significantly decreased PTGS2 expression (P < 0.05) and increased GPX1 expression (P < 0.05). Furthermore, celecoxib administration significantly increased FoxO3 expression compared with the LPS group (P < 0.05), consistent with the changes observed following CGA supplementation.

In addition, celecoxib administration significantly increased HO-1 expression and decreased NOX1 expression compared with the LPS group (P < 0.05), which was comparable to the effects observed in the CGA-supplemented group.

Discussion

Various exogenous and endogenous stressors within the intensive farming environment often adversely affect broiler health. LPS, a major component of the outer membrane of Gram-negative bacteria, is a potent pro-inflammatory stimulus that triggers host immune stress and systemic inflammatory cascades (Maldonado et al., 2016). Accumulating evidence indicates that inflammatory responses are inextricably linked to systemic redox homeostasis, the disruption of which severely compromises animal health (Bellanti et al., 2025; Zhong et al., 2024). As a central metabolic and detoxification organ, the liver plays a pivotal role in antioxidant defense. Therefore, maintaining hepatic redox homeostasis is crucial for mitigating inflammatory damage and promoting recovery.

CGA, a natural plant-derived polyphenol, has been extensively documented to possess robust anti-inflammatory and antioxidant properties (Bai et al., 2022; Gu et al., 2023; Jiao et al., 2024; Li et al., 2023). Previous studies have demonstrated that CGA can alleviate LPS-induced intestinal inflammation, mitigate endoplasmic reticulum stress(Liu et al., 2024), restore intestinal barrier integrity(Tan et al., 2023), enhance the antioxidant status of broilers under heat stress(Chen et al., 2021), and reduce oxidative damage induced by avian pathogenic E. coli. In this study, dietary supplementation with CGA significantly reversed the LPS-induced increase in serum corticosterone levels at 17 days of age. Given that corticosterone serves as a key endocrine indicator of HPA axis activation and systemic stress, this finding suggests that CGA exerts protective effects against LPS-induced immune stress. Furthermore, CGA has been proven to improve poultry growth performance. For instance, dietary supplementation with 1000 mg/kg CGA was shown to rescue the elevated FCR induced by LPS in broilers. Similarly, dietary supplementation with 800 mg/kg CGA alleviated the hydrogen peroxide-induced increase in FCR in laying hens(Zhao et al., 2024) and restored the decreased ADG and increased FCR induced by dexamethasone (DEX) in broilers (Liu et al., 2023a). Consistent with these reports, our results demonstrate that dietary CGA supplementation during days 15-17 significantly restored the LPS-induced decrease in ADG and elevation in FCR, thereby improving broiler growth performance. However, the precise underlying mechanisms require further investigation.

The liver is a primary target of ROS attack and a critical site for oxidative damage. Severe oxidative stress leads to excessive ROS generation, which cross-talks with inflammatory signaling pathways (such as NF-κB), induces apoptosis and autophagy, and disrupts cellular metabolic balance, ultimately impairing growth performance and increasing FCR in poultry(Chen et al., 2018; Oke et al., 2024; Rehman et al., 2018). Consequently, sustaining hepatic redox balance is vital for poultry growth. Numerous studies have highlighted the potent radical-scavenging properties of CGA. Specifically, dietary CGA supplementation enhances antioxidant capacity, reversing the depletion of SOD and CAT activities, while suppressing the accumulation of MDA induced by hydrogen peroxide or DEX(Zha et al., 2023; Zhao et al., 2024). This study also confirms that CGA effectively restores LPS-induced deficits in antioxidant enzyme activities and alleviates lipid peroxidation, thereby mitigating hepatic oxidative damage. In summary, CGA ameliorated the LPS-induced oxidative stress state, though the discrete molecular mechanisms require further exploration.

The liver acts as a major site for ROS production, originating from various sources such as peroxisomes and enzymatic complexes like NOX enzymes(Allameh et al., 2023). Under normal conditions, ROS generated by NOX enzymes are promptly cleared by the antioxidant defense system to maintain redox homeostasis. However, when NOX enzyme activity becomes aberrant or the antioxidant system is compromised, ROS accumulation leads to oxidative damage(Bedard and Krause, 2007). The results of this study show that LPS challenge significantly upregulates hepatic NOX1 mRNA expression, while dietary CGA intervention effectively reduces it. Previous studies indicate that LPS can promote ROS production by enhancing NOX enzyme expression in macrophages(Kim et al., 2010), and NOX1-dependent ROS plays a pathogenic role in various diseases(Liu et al., 2015). Concurrently, CGA has been demonstrated to inhibit excessive ROS production by modulating NOX activity, thereby improving antioxidant defenses(Shi et al., 2016). Collectively, our findings suggest that LPS may promote ROS accumulation and induce hepatic oxidative stress by upregulating NOX1 expression, while dietary CGA reduces upstream ROS accumulation mediating oxidative damage by downregulating NOX1 expression, thereby partially restoring hepatic redox balance.

In addition to mitigating NOX-mediated oxidative signaling, the response of downstream glutathione-related enzymes further reveals the comprehensive protective effects of CGA on hepatic redox homeostasis. GST has been reported to alleviate oxidative stress-induced apoptosis and cellular injury by reducing lipid peroxidation(Singhal et al., 2015). This study found that dietary CGA alleviated the LPS-induced down-regulation of GST expression, helping maintain redox homeostasis. This aligns with related studies indicating that CGA exerts antioxidant and chemoprotective effects by regulating phase II detoxifying enzymes, including GST and NQO1(Feng et al., 2005).

Moreover, glutathione peroxidase 1 (GPX1) is another core antioxidant enzyme that scavenges intracellular peroxides, protects cells from oxidative damage, and maintains cellular redox balance by regulating mitochondrial function(Lennicke and Cocheme, 2021). In this study, GPX1 was significantly upregulated in the CGA treatment group, which correlated with decreased MDA content, suggesting that CGA enhances peroxide scavenging capacity by upregulating glutathione-related antioxidant enzymes like GPX1, thereby mitigating lipid peroxidation and oxidative stress caused by excessive upstream ROS generation.

To further elucidate the transcriptional mechanisms underlying CGA-mediated protection, we performed transcriptomic sequencing. The results revealed that DEGs between the LPS group and the LPS + CGA group were significantly enriched in the FoxO signaling pathway. FoxO transcription factors play a critical role in counteracting oxidative damage, not only by regulating the expression of antioxidant enzymes but also by influencing the cell cycle, metabolism, and stem cell function to maintain tissue homeostasis(Rodriguez-Colman et al., 2024). Previous research has shown that CGA upregulates FoxO expression under hydrogen peroxide challenge (Li et al., 2012) and improves glucose metabolism by activating the AKT/GSK3β/FoxO1 axis by targeting the AKT PH domain(Gao et al., 2018). Furthermore, FoxO3a can inhibit excessive ROS production, thereby dampening oxidative stress responses(Joseph et al., 2016). In this study, LPS significantly downregulated hepatic FoxO3 expression, whereas dietary CGA significantly restored its expression and further upregulated FoxO1. This expression trend matches the upregulation of antioxidant enzymes like GPX1, suggesting that CGA participates in antioxidant defense by modulating the expression of FoxO-related genes.

Concurrent with the activation of the FoxO pathway, changes in the Nrf2/HO-1 axis further emphasize the multidimensional regulation of the hepatic antioxidant defense system by CGA. Numerous studies indicate that CGA enhances antioxidant capacity by activating the Nrf2/HO-1 signaling pathway(Bao et al., 2018; Han et al., 2019), regulates mitochondrial function to alleviate hepatotoxicity(Wang et al., 2023), and upregulates Nrf2 downstream antioxidant genes such as HO-1, NQO1, and GCLC(Shi et al., 2016; Wang et al., 2018). Additionally, it can mitigate ferroptosis by activating the Nrf2/GPX4 pathway(Shan et al., 2024). We found that CGA significantly increased the mRNA expression of hepatic Nrf2 and HO-1, consistent with improvements in T-AOC, elevated antioxidant enzyme activities, and decreased MDA levels. This indicates that CGA concurrently activates key transcription factors like Nrf2 and FoxO, synergistically enhancing the glutathione and peroxide scavenging systems to establish a robust antioxidant barrier. Integrating evidence such as NOX1 downregulation, GST/GPX1 restoration, and FoxO/Nrf2 signaling enhancement, we speculate that LPS-induced immune stress involves the synergistic inhibition of multiple antioxidant axes by upstream pro-inflammatory/pro-oxidative pathways, while CGA achieves its protective effects by regulating key nodes within this network.

Notably, transcriptomics revealed that hepatic PTGS2 (cyclooxygenase-2, COX-2) expression was significantly upregulated in the LPS group compared to the saline group, suggesting the involvement of this gene and its related pathways in LPS-induced inflammation and oxidative stress. Cyclooxygenase-2 is a key enzyme for prostaglandin (PG) synthesis, catalyzing the conversion of arachidonic acid (AA) to PGG2/PGH2, which is further metabolized into various bioactive PGs. COX-2 products promote ROS generation during inflammatory responses, thereby amplifying oxidative stress(Rouzer and Marnett, 2009). Research shows that TAK1 activation can induce MAPK and NF-κB phosphorylation, upregulating COX-2 and PGE2, whereas antioxidants (e.g., N-acetylcysteine) can inhibit ROS-induced COX-2 expression, suggesting a mutually reinforcing pathological link between oxidative stress and aberrant COX-2 activation(Onodera et al., 2015).

This interplay holds significant pathophysiological importance in the development of oxidative stress-related diseases. For instance, particulate matter (PM)-induced pulmonary inflammation is accompanied by increased COX-2 and mitochondrial ROS, and glucocorticoids inhibit COX-2 by reducing mitochondrial ROS, further supporting this close relationship(Park et al., 2023). Furthermore, oxidative stress drives various inflammation-related pathological changes by regulating COX-2 activity and PGE2 production, establishing COX-2 as a key effector molecule in oxidative stress-mediated inflammatory responses and tissue damage(Ilari et al., 2020). Combined with previous reports on the role of COX-2 in PG synthesis and ROS amplification, we hypothesized that PTGS2 might be an important candidate node regulating liver injury in this model.

Based on this, a selective COX-2 inhibitor (celecoxib) treatment group was included to compare its effects with the LPS group regarding oxidative damage indicators and key signaling molecule expression, providing a horizontal comparison with the CGA group. Celecoxib is a selective COX-2 inhibitor. Research shows that celecoxib can inhibit NOX activity by suppressing COX-2 activity, thereby reducing ROS generation(Tai et al., 2021), and it can restore hepatic antioxidant capacity by activating the Nrf2/HO-1 signaling pathway(Khaleel et al., 2023). Furthermore, oxidative stress is considered an important inducer of COX-2(Feng et al., 1995), suggesting that COX-2 sits at the intersection of inflammatory signaling and ROS amplification, serving as a key molecular node connecting upstream immune stress and downstream oxidative damage. This intervention aims to assess whether pharmacological PTGS2 inhibition can partially replicate the protective effects of CGA, thereby providing preliminary evidence on whether CGA's mode of action involves the PTGS2/COX-2 pathway.

Our experimental results show that celecoxib treatment significantly reduced LPS-induced serum corticosterone levels, increased CAT and SOD activities, and decreased MDA content, indicating its ability to alleviate immune stress, improve redox homeostasis, and mitigate LPS-induced hepatic oxidative damage. At the molecular level, celecoxib significantly downregulated PTGS2 and NOX1 expression, while upregulating the mRNA levels of FoxO3, GPX1, and HO-1. Previous studies have shown that enhanced NOX activity leads to excessive ROS generation, which not only promotes COX-2 expression but also stimulates monocyte differentiation into macrophages(Barbieri et al., 2003). Conversely, upregulated COX-2 and its metabolites participate in ROS generation and inflammatory amplification, forming a self-sustaining positive feedback loop.

In this study, selective COX-2 inhibition downregulated NOX expression and upregulated antioxidant-related molecules, supporting its role in breaking this feedback loop via intervention in the NOX1-ROS-COX-2 interaction axis. This disruption effectively alleviates LPS-induced oxidative stress and inflammatory responses. Furthermore, celecoxib significantly increased FoxO3 expression levels. Because FoxO3 can form a PGE2-FoxO3 regulatory network with COX-2 catalytic products to alleviate inflammatory responses(Heller et al., 2016), the upregulation of FoxO3 may be an important mechanism by which celecoxib reduces LPS-induced inflammation. Additionally, the upregulation of GPX1 suggests that celecoxib enhances antioxidant defenses to scavenge excess peroxides and maintain cellular redox homeostasis.

Research shows that increased ROS levels induced by NOX enzymes can activate the downstream PI3K/AKT/NF-κB signaling pathway, thereby promoting high COX-2 expression(Lin et al., 2012). Combined with previous reports that CGA can downregulate COX-2 and exhibit anti-inflammatory/antioxidant effects(Gu et al., 2023; Ontawong et al., 2023; Tai et al., 2021), our finding that injecting celecoxib before LPS treatment similarly alleviated hepatic oxidative damage suggests the possible involvement of a common pathway. It is therefore speculated that the protective effect of chlorogenic acid may partially involve the PTGS2/COX-2 signaling axis, although the specific target sites and causal relationships require further investigation.

Conclusions

In summary, intraperitoneal LPS challenge impaired growth performance and induced hepatic oxidative imbalance in broilers. Dietary supplementation with 1000 mg/kg CGA restored LPS-induced hepatic oxidative stress. and partially improved growth performance. The protective effects of CGA were associated with enhanced antioxidant defense, including increased expresson of Nrf2-, FoxO-, HO-1-, GST-, and GPX1-related antioxidant factors. Furthermore, pharmacological inhibition of COX-2 using celecoxib partially reproduced the antioxidant effects of CGA, including reductions in PTGS2 and NOX1 expression and increases in antioxidant-related gene expression. These findings suggest that PTGS2/COX-2-associated regulation may contribute to the protective effects of CGA against LPS-induced hepatic oxidative stress, potentially through modulation of NOX1-related oxidative signaling and FoxO3/GPX1-dependent antioxidant responses. Overall, dietary CGA supplementation may serve as a promising nutritional strategy for alleviating immune stress-associated oxidative injury in broilers. This study provides preliminary evidence supporting the application of CGA as an antioxidant and anti-stress feed additive in poultry production.

Financial support statement

This study was supported by the National Key Research and Development Program of China(#2024YFE0111600), Key Research and Development Program of Henan Province (#241111113800), Key Research and Development (Science and Technology Project) Program of Henan Province (#262102110051), Natural Science Foundation of Henan Province(#252300421652, #262300420139, #262300420439).

Data availability

The RNA sequencing data generated in this study have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under the BioProject accession number PRJNA1398771. The data are publicly available at the NCBI SRA database under this accession number.

Author contributions

Dongying Bai contributed to the investigation, formal analysis, data curation, and preparation of the original manuscript draft. Xueqing Xiao contributed to the investigation, experimental methodology, data curation, and preparation of the original manuscript draft. Wenrui Zhen contributed to the investigation, formal analysis, data curation, and critical revision of the manuscript. Yi Zhang and Ziyue Zhao contributed to the experimental methodology, data analysis, and formal analysis. Keyuan Lei and Chengjie Zhang contributed to the experimental methodology, data analysis, and formal analysis. Fangshen Guo and Cai Zhang contributed to the experimental methodology, data analysis, and critical revision of the manuscript. Bingkun Zhang and Yushu Zhang contributed to data curation and critical revision of the manuscript. Yanbo Ma supervised the study and was responsible for project administration. All authors critically reviewed the manuscript, approved the final version for publication, and agreed to be accountable for the accuracy and integrity of the work.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.