Skip to main content
NCBI home page
International Journal for Parasitology: Parasites and Wildlife logoLink to International Journal for Parasitology: Parasites and Wildlife
. 2026 Sep 18;31:101293. doi: 10.1016/j.ijppaw.2026.101293

Myxobolus binotati n. sp. (Myxozoa: Myxobolidae) from the ovaries of spotted barb, Barbodes binotatus (Valenciennes, 1842) in Terengganu, Malaysia

Nadhirah Syafiqah Suhaimi a,b, Csaba Székely a, Gábor Cech a, Muhammad Hafiz Borkhanuddin c, Boglárka Sellyei a,⁎
PMCID: PMC13635390  PMID: 42835486

Abstract

To date, only 14 species have been reported worldwide from the ovaries of fish hosts. In the present study, a novel species, Myxobolus binotati n. sp., was described from the ovary of Barbodes binotatus. Spores were oval in frontal view and lemon-shaped in sutural view, measuring 10.7 × 8.3 × 6.2 μm. They possessed two unequal pyriform polar capsules, with larger measuring 4.8 ± 0.4 (4.0–5.8) μm in length, 2.8 ± 0.2 (2.4–3.4) μm in width, while smaller measuring 2.7 ± 0.3 (2.1–3.1) μm in length, 1.6 ± 0.2 (1.3–1.9) μm in width. Polar tubules coiled 7–8 and 4 turns in the larger and smaller capsules, respectively. The spores lacked an intercapsular appendix, iodinophilous vacuole, and mucous envelope, and possessed 8–10 asymmetrically distributed sutural markings. Molecular analysis of 18S rDNA gene revealed that the new species shared the highest sequence similarity (87.3%) with Myxobolus abitus found in the gills of Hypophthalmichthys molitrix. Phylogenetic analyses placed M. binotati n. sp. within a clade comprising species infecting the gills, fins, skin, scales, and ovaries, including several taxa characterized by unequal polar capsules. However, it formed a distinct lineage within this clade. The combined morphological, molecular, and phylogenetic evidence supports the establishment of M. binotati n. sp. as a new species.

Keywords: Fish, Myxozoa, Myxosporean, Taxonomy, Morphology, 18S rDNA, Ovary of Barbodes binotatus

Graphical abstract

graphic file with name ga1.webp

Open in a new tab

Highlights

  • •

    First record of a Myxobolus species from Barbodes binotatus.

  • •

    First report of a myxozoan parasite infecting the ovaries of a fish in Malaysia.

  • •

    Provides new insights into the diversity of Myxobolus species infecting ovary in Malaysia.

1. Introduction

Myxozoans are the most common microscopic parasites that infect fish in both wild and aquaculture environments, where they can cause disease and significant economic losses through reduced growth, lowered market value, and increased mortality (Bergersen and Anderson, 1997; Feist and Longshaw, 2006; Okamura et al., 2015). Their pathogenic effects vary depending on the infected tissue and parasite species, which may include reduced respiratory capacity due to gill infection (Stilwell et al., 2024), body deformation (Dyková et al., 2002), degenerative cardiomyopathy (Yokoyama et al., 2005), and intestinal necrosis (Branson et al., 1999; Alvarez-Pellitero et al., 2008).

At present, 3043 valid myxozoan species are recorded (Whipps et al., 2025), and about 950 species belong to the genus Myxobolus Bütschli, 1882 (Eiras et al., 2005, 2014, 2021). Of the known Myxobolus species, only around 16 have been described from Malaysia to date, highlighting the limited knowledge of the diversity of this genus in Malaysian freshwater fishes (Molnár et al., 2006; Székely et al., 2009a, 2009b, 2012; Borkhanuddin et al., 2014; Samshuri and Borkhanuddin, 2024; Suhaimi et al., 2025). Myxozoan parasites rarely infect gonadal tissues (ovaries and testes), with only 20 species reported to date, including 12 species belonging to the genus Myxobolus. In freshwater fishes, ovarian infections have been recorded in 10 species belonging to genera Myxobolus (9) and Henneguya (1), whereas testicular infections have been reported less frequently. A comprehensive list of myxozoan species reported from fish gonads, together with their hosts, infection sites, ecosystems and geographic distributions, is provided in Table 1. To date, no gonadal myxozoan infections have been reported from Malaysia.

Table 1.

Myxozoan species reported from fish gonads, including host, infected tissue, ecosystem, locality and reference.

Species Host Infection site Ecosystem Country Reference
Myxobolus aculeatus Macrognathus aculeatus Ovary Freshwater China Xu et al. (2025)
Myxobolus barakensis Xenentodon cancila Ovary Freshwater India Lebanan and Mohilal (2021)
Myxobolus ovarium Brycon orthotaenis Ovary Freshwater Brazil Naldoni et al. (2020)
Henneguya oviperda Esox lucius Ovary Freshwater Russia Sokolov et al. (2019)
Myxobolus batalhensis Salminus hilarii Ovary, liver Freshwater Brazil Vieira et al. (2017)
Myxobolus dahomeyensis Synodontis ansorgii Ovary Freshwater Dahomey Gbankoto et al. (2015)
Myxobolus sp. Clarias gariepinus Ovary Freshwater Benin Gbankoto et al. (2015)
Kudoa saudiensis Rastrelliger kanagurta Ovary Marine Saudi Arabia Mansour et al. (2015)
Kudoa azavedoi Trachurus Ovary Marine Tunisia Mansour et al. (2013)
Myxidium sp. Lutjanus monostigma Testes Marine Saudi Arabia Al-Jahdali and Hassanine (2010)
Myxobolusdjoudjensis Coptodon guineensis Ovary Marine Senegal Damanka et al. (2007)
Myxobolus testicularis Hemiodopsis microlepis Testes Freshwater Brazil Tajdari et al. (2005)
Myxobolus gariepinus Clarias gariepinus Ovary Freshwater Botswana Reed et al. (2003)
Kudoa ovivora Thalassoma bifasciatum Ovary Marine Panama Swearer and Robertson (1999)
Myxobolus liangshanensis Garra imberba Ovary Freshwater China Chen and Ma (1998)
Myxobolusalgonquinensis Notemigonus crysoleucas Ovary Freshwater Canada Xiao and Desser (1997)
Henneguya testicularis Moenkhausia oligolepis Testes Freshwater Brazil Azevedo et al. (1997)
Henneguya amazonica Hoplosternum littorale Testes Freshwater Brazil Rocha et al. (1992)
Sphaerospora testicularis Dicentrarchus labrax Testes Marine Spain Sitja-bobadilla and Alvarez-Pellitero (1990)
Myxoboluslutzi Poecilia vivipara Testes Marine Brazil Aragão (1919)
Open in a new tab

Barbodes binotatus is a common freshwater fish in Southeast Asia (Kottelat, 2013). This species has a wide distribution includes Malaysia (Ng et al., 2017; Zakaria-Ismail et al., 2019; Kottelat and Lim, 2021), Indonesia (Bariche, 1998; Kottelat, 2000), Brunei (Kottelat and Lim, 1995), Cambodia (Rainboth, 1996), Laos (Kottelat, 2013), Myanmar (Kottelat, 2013), Thailand (Pethiyagoda et al., 2012; Tongnunui and Beamish, 2017), Vietnam (Khoa and Huong, 1993) and the Philippines (Alonzo et al., 2024). It typically occurs in streams, rivers and lakes with clear water and a range of flow conditions from slow to fast. This fish is widely used as a bio-indicator of habitat degradation and freshwater ecosystem health (Isa et al., 2010; Zakeyudin et al., 2012). It is also common in the ornamental fish trade, and in Sabah, this species is consumed as a popular deep-fried delicacy. To date, there have been no records of myxozoan parasites infecting B. binotatus. Therefore, this study presents the first record of a Myxobolus species infecting the ovaries of B. binotatus in Malaysia.

Considering that no myxozoan parasites had been reported from B. binotatus, we conducted a comprehensive survey of this fish. In this study, plasmodia containing myxospores morphologically consistent with Myxobolus were observed in the ovaries. The main goal of this study was to identify and compare the myxobolid species using morphological and molecular data and to assess their phylogenetic relationship within the Myxobolidae.

2. Materials and methods

2.1. Sample collection and microscopic study

A total of thirteen fish specimens of B. binotatus were obtained from a local fish market in Kuala Terengganu, Terengganu, Malaysia. These fish originated from the river of Sungai Nerus in Kuala Nerus, Terengganu. The fish were purchased every two-week intervals over two periods: July to August 2023 and September to November 2024.

Live specimens were transported in oxygenated plastic bags to the Marine Science Biodiversity Laboratory of the Faculty of Science and Marine Environment at Universiti Malaysia Terengganu. Upon arrival, the fish were maintained in aerated tanks until dissection. Taxonomic identification of the fish specimens was performed based on morphological characteristics. In the laboratory, the fish were euthanized by cranial spiking and dissected. Major organs including fins, gills, skin, intestine, stomach, kidney, gallbladder, and muscles were thoroughly examined for the presence of plasmodia of myxosporean parasites. Initial observations were conducted with naked eye, followed by detailed examination using an Olympus SZX7 dissecting microscope (Olympus Corporation, Japan) and a light microscope to confirm the presence of the plasmodia.

Plasmodia were isolated from the ovary of a single individual, ruptured and the released spores were examined on glass slides (wet mount) using an Olympus CX33 biological microscope (Olympus Corporation, Japan). Following microscopic assessment, the remaining ovary tissues with plasmodia were preserved in 90% ethanol for molecular analyses and in 10% neutral buffered formalin for morphological analysis. All fixed specimens were subsequently transported to the Fish Pathology and Parasitology Laboratory at the HUN-REN Veterinary Medical Research Institute (Budapest, Hungary) for further investigation. Photomicrographs were obtained using an Olympus SZX16 stereo-microscope and an Olympus BX53 light microscope equipped with an Olympus DP74 digital camera (Olympus Corporation, Japan). Spore measurements from formalin-fixed specimens were performed in accordance with the guidelines of Lom and Arthur (1989) using ImageJ software. All measurements are reported as mean ± standard deviation (SD), with ranges given in parentheses and expressed in micrometers (μm). Line drawings of Myxobolus spores were prepared from original digital images using Inkscape (Free Software Foundation, Inc., MA, USA).

2.2. Molecular analysis

Genomic DNA was extracted from spores previously preserved in 90% ethanol. Prior to extraction, the samples were centrifuged at 13,000 rpm for 15 min, after which the ethanol was carefully removed by pipetting. The resulting spore pellets were rinsed twice with 10 mM Tris-HCl (pH 8.5) to remove any residual ethanol. DNA isolation was carried out using the Geneaid Tissue Genomic DNA Mini Kit (Geneaid Biotech Ltd., Taiwan), following the manufacturer's protocol for animal tissue samples.

The 18S rDNA gene was amplified by direct polymerase chain reaction (PCR) using multiple primer sets, including ACT1F-ACT1R and Myxgen4F-ERIB10 (Table 2). Each PCR was carried out in a final volume of 25 μL, containing 2 μL of template DNA, 1 × DreamTaq buffer (10×; Thermo Scientific), 0.2 mM dNTP mix (10 mM; Thermo Scientific), 1.25 U DreamTaq polymerase (5 U; Thermo Scientific), 12.5 pmol of each primer, and molecular grade water. The amplification conditions were identical for all primer pairs: an initial denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 45 s, annealing at 55 °C for 50 s, and extension at 72 °C for 1 min with a final elongation step at 72 °C for 10 min. PCR amplification was performed using a Doppio Gradient Thermal Cycler (VWR).

Table 2.

Primers used for PCR amplification and sequencing of Myxobolus binotati n. sp. F forward primer, R reverse primer.

Primer Application Sequence (5’ – 3′) Reference
F: Myxgen4F PCR and sequencing GTGCCTTGAATAAATCAGAG Diamant et al. (2004)
R: ERIB10 PCR and sequencing CTTCCGCAGGTTCACCTACGG Barta et al. (1997)
F: ACT1F PCR and sequencing GGCAGCAGGCGCGCAAATTACCCAA Hallett and Diamant (2001)
R: ACT1R PCR and sequencing AATTTCACCTCTCGCTGCCA Hallett and Diamant (2001)
R: Myxgen4R Sequencing CTYTGATTTATTCAAGGCAC Køie et al. (2008)
Open in a new tab

PCR products were visualized by agarose gel electrophoresis. Bands of the expected size were cut from the gel and purified using the DNA Fragment Purification Kit (InViTek GmbH, Berlin, Germany). Purified amplicons were sequenced bidirectionally using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and sequencing reactions were read on an ABI PRISM 3100 Genetic Analyzer at Delta Bio 2000 Ltd., Szeged, Hungary, using the primers listed in Table 2.

2.3. Phylogenetic analyses

The obtained 18S rDNA sequences were visualized, corrected if necessary based on the chromatogram, and assembled using Geneious Prime v11.1 (Bio-matters; Auckland, New Zealand; https://www.geneious.com/) (Kearse et al., 2012). Phylogenetic analyses were conducted using one sequence obtained in this study together with 46 related sequences retrieved from the GenBank database using a threshold of ≥85% identity and ≥80% query coverage, including available sequences of other freshwater ovary-infecting species and Malaysian freshwater myxobolid sequences. The 85% similarity threshold was applied to retain potentially related and phylogenetically informative Myxobolus sequences while excluding highly divergent sequences that were less informative for assessing the phylogenetic position of the new species. Sequences with lower identity (<85%) or poor support were excluded. Chloromyxum cristatum (AY604198) was designated as the outgroup. Multiple sequence alignment was performed using the ClustalW algorithm (Thompson et al., 1994) implemented in MEGA X (Molecular Evolutionary Genetics Analysis, 64-bit version; https://www.megasoftware.net/) (Kumar et al., 2018). Phylogenetic tree was reconstructed using the Maximum Likelihood method with 1000 bootstrap replicates in MEGA X, and Bayesian Inference conducted in MrBayes v3.2.443 (Ronquist et al., 2012). Gaps were treated using partial deletion with 75% site coverage cut-off for ML. The best-fit mucleotide substitution model (GTR + G + I) was selected based on the Akaike information criterion (AIC) and Bayesian Information Criterion (BIC) executed in jModelTest 2.1.10 v2016030344 (Darriba et al., 2012). For Bayesian analysis, Markov Chain Monte Carlo (MCMC) simulations were run for 1,000,000 generations, with the initial 25% discarded as burn-in. A consensus tree was generated from the remaining sampled topologies. Clades were considered well supported when bootstrap values (BS) were ≥ 70% for ML and posterior probabilities (PP) were ≥ 0.90 for BI analysis. The resulting tree topologies were visualized in MEGA X and FigTree v. 1.4.445 (Rambaut, 2018), and further refined graphically using Inkscape software. Pairwise genetic distances were calculated in MEGA X using p-distance model, accounting for both transitions and transversions.

3. Results

A parasitological examination of B. binotatus revealed no parasites other than myxospores. Among the 13 fish specimens examined, myxospores exhibiting the characteristic morphology of the genus Myxobolus were detected in the ovaries of a single individual. No myxospores or plasmodia were observed in any other tissues or organs, either by visual inspection or under a stereomicroscope. Morphological and molecular analyses confirmed that the detected Myxobolus species represents a novel species.

The assembled nucleotide sequence of the 18 S rDNA region was 1591 bp long. Phylogenetic analysis of multiple-sequence alignment comprising 1788 nucleotide positions, including 807 conserved and 929 variable sites.

3.1. Description of novel myxobolus species

3.1.1. Myxobolus binotati n. sp

Plasmodia: Found in the ovaries, oval in shape (Fig. 1A). Spore: Oval in both frontal (Fig. 1B and F), lemon-shaped in sutural view (Fig. 1C and F), 10.7 ± 0.4 (10.0–11.4) μm long, 8.3 ± 0.3 (7.8–8.9) μm wide, 6.2 ± 0.3 (5.9–6.8) μm thick (n = 10). Polar capsule: Two, pyriform, unequal. Larger: 4.8 ± 0.4 (4.0–5.8) μm long, 2.8 ± 0.2 (2.4–3.4) μm wide. Smaller: 2.7 ± 0.3 (2.1–3.1) μm long, 1.6 ± 0.2 (1.3–1.9) μm wide. Intercapsular appendix: Absent. Polar tubule: Coiled seven to eight times in larger capsule, four times in smaller capsule, positioned perpendicularly to capsule axis (Fig. 1D). Sutural ridge: Eight to ten sutural markings, unsymmetrically distributed (Fig. 1E). Sporoplasm: Binucleate, iodinophilous vacuole absent, mucous envelope absent. Measurements from 30 formalin-fixed spores.

Fig. 1.

Fig. 1

Open in a new tab

A) Plasmodia of Myxobolus binotati n. sp. in the ovary of Barbodes binotatus (black arrow). B) Formalin-fixed spore in frontal view. C) Spore in sutural view. D) Spore with polar capsules containing eight polar tubule coils in larger capsule (PT). D) Spore showing ten sutural markings (SM). E) Schematic drawings of Myxobolus binotati n. sp. in frontal and sutural views. Scale bars = 10 μm except (A) 500 μm.

3.1.2. Taxonomic summary

Class: Myxosporea Bütschli, 1881

Order: Bivalvulida Shulman, 1959.

Family: Myxobolidae Thélohan, 1892.

Genus: Myxobolus Bütschli, 1882

Host: Barbodes binotatus Valenciennes, 1842 (Order: Cypriniformes). Average length between 8.0 and 11.5 cm.

Locality: Sungai Nerus, Kuala Nerus, Terengganu, Malaysia.

Infection site: Ovaries.

Prevalence: 7.69% (1/13).

Type material: Phototypes were deposited in the parasitological collection of the Zoological Department, Hungarian Natural History Museum, Budapest, Coll. No. HNMPCC-HNHM-PAR-72094. GenBank accession numbers for partial 18 S rDNA sequence: PZ741002 (1,591bp).

Etymology: The specific epithet binotati is derived from the name of the host species, Barbodes binotatus.

Molecular data: Partial 18S rDNA sequence of Myxobolus binotati n. sp. (1,591bp) did not match any of myxozoan sequences available in GenBank. Pairwise distance estimation indicated the highest similarity of 87.3% to Myxobolus abitus (MG520367) (Table 3). Phylogenetic analyses placed M. binotati n. sp. close to a group comprising species infecting the gills, fins, skin, scales, ovaries and several species that possess unequal polar capsules. However, M. binotati n. sp. occupied an independent phylogenetic position and did not cluster closely with any previously described species (Fig. 2).

Table 3.

Similarity matrix for 18S rDNA of Myxobolus binotati n. sp. and closely related myxozoan species. The lower triangle region shows genetic p-distance, and the upper triangle region shows the percentage (%) of sequence similarities.

1 2 3 4 5 6 7 8
1 Myxobolus binotati n. sp. PZ741002 87.3 87.1 87.0 87.0 87.0 87.0 86.9
2 Myxobolus abitus MG520367 0.127 91.6 90.9 92.4 91.6 91.3 92.5
3 Myxobolus diversus PV162749 0.129 0.084 90.6 93.8 94.8 93.6 94.3
4 Thelohanellus catlae KJ476881 0.130 0.091 0.094 90.0 90.0 90.5 90.3
5 Myxobolus tsangwuensis KJ561441 0.130 0.076 0.062 0.100 94.0 96.5 93.5
6 Myxobolus elliptoides OQ725580 0.130 0.084 0.052 0.100 0.060 94.4 93.8
7 Myxobolus basilamellaris MZ343303 0.130 0.087 0.064 0.095 0.035 0.056 92.7
8 Myxobolus acutus MZ782721 0.131 0.075 0.057 0.097 0.065 0.062 0.073
Open in a new tab
Fig. 2.

Fig. 2

Open in a new tab

Maximum likelihood (ML) phylogenetic tree of 18S rDNA sequences of Myxobolus binotati n. sp. and related species. Chloromyxum cristatum was used as the outgroup. Nodal supports are indicated for ML at 1000 replicates and Bayesian Inference (BI). Only values with ≥ 70% bootstrap (BS) and ≥ 0.90 posterior probabilities (PP) support are presented. The names of the parasite species are presented before GenBank accession numbers, following the host species, predilection site and locality. Sequence obtained in the present study is shown in bold within colored box. The scale bar indicates the expected number of substitutions per site.

Remarks: The morphology and morphometrics of Myxobolus binotati n. sp. are distinct from any previously described Myxobolus species with unequal polar capsules. It closely resembles Myxobolus terengganuensis Székely, Shaharom-Harrison, Cech, Ostoros et Molnár et al., 2006 from Malaysia and Myxobolus nekrasovae Batueva, Vlasenko, Solovyev et Abasheev, 2023 (Table 4) from Russia, however both species are larger and lack sutural markings. Remarkably, M. nekrasovae can be distinguished by the presence of a mucus envelope, which is absent in M. binotati n. sp. Morphometrically, M. binotati n. sp. is most similar to Myxobolus pavlovskii described from the gill filaments of Hypophthalmichthys molitrix, but differs mainly in the presence of sutural markings and the number of polar tubule coils. Other species listed in Table 4 differs in most measurements and share only a few overlapping characteristics.

Table 4.

Comparative data on spore measurements (mean ± standard deviation [SD], with ranges in parentheses) for Myxobolus binotati n. sp. and species with unequal polar capsules. All measurements are in μm.

Species Host Infection site SL SW ST Large
 Small
 SM Reference
PCL PCW PFC PCL PCW PFC
Myxobolus binotati n. sp. Barbodes binotatus Ovary 10.7 ± 0.4 (10.0–11.4) 8.3 ± 0.3 (7.8–8.9) 6.2 ± 0.3 (5.9–6.8) 4.8 ± 0.4 (4.0–5.8) 2.8 ± 0.2 (2.4–3.4) 6–8 2.7 ± 0.3 (2.1–3.1) 1.6 ± 0.2 (1.3–1.9) 4 8–10 Present study
M. pavlovskii Hypophthalmichthys molitrix Gill filaments (9.0–12.0) (8.5–9.0) (7.0–8.0) (4.0–6.0) (2.0–3.0) – (2.0–3.0) (1.6–2.3) 3–4 – Lucký (1978)
M. iwagiensis Oryzias latipes Brain tissue 12.1 ± 0.4 (11.3–12.8) 9.8 ± 0.3 (9.1–10.5) 7.9 ± 0.2 (7.5–8.2) 6.4 ± 0.2 (5.9–6.9) 4.0 ± 0.2 (3.4–4.4) 6–8 5.8 ± 0.3 (5.3–6.5) 3.5 ± 0.2 (3.1–4.0) 4–6 – Kawano et al. (2025)
M. terengganuensis Osteochilus hasselti Muscle 12.7 ± 0.5 (12.0–13.4) 7.4 ± 0.5 (6.7–8.3) 5.0 ± 0.2 (4.8–5.2) 6.8 ± 0.4 (6.2–7.3) 2.3 ± 0.1 (2.2–2.6) – 5.0 ± 0.4 (4.4–5.5) 2.3 ± 0.1 (2.2–2.6) – – Székely et al. (2009a)
M. csabai O. hasselti Kidney 12.9 ± 0.5 (12.1–14.0) 8.6 ± 0.4 (8.2–9.6) 5.0 ± 0.4 (4.7–5.6) 6.1 ± 0.2 (6.4–6.8) 3.8 ± 0.1 (3.7–4.0) 6 3.6 ± 0.5 (3.3–4.8) 2.3 ± 0.3 (2.0–2.9) 6 – Székely et al. (2009a)
M. acutus C. auratus auratus Gills, kidney 13.6 ± 0.9 (11.4–15.3) 10.2 ± 0.9 (7.5–12.8) 7.6 ± 0.6 (6.9–8.3) 6.2 ± 0.4 (5.1–7.5) 3.8 ± 0.4 (2.8–4.7) 5–8 2.7 ± 0.4 (1.7–3.7) 1.4 ± 0.4 (0.9–1.9) 2–3 – Shi et al. (2022)
M. calbasui C. mrigala, C. reba Intestine, liver 13.8 ± 0.4 (13.0–14.6) 9.8 ± 0.6 (8.8–10.7) 7.3 ± 0.2 (6.7–7.8) 5.2 ± 0.3 (4.6–6.0) 3.4 ± 0.2 (3.1–3.9) 5–6 2.7 ± 0.2 (2.3–3.0) 1.8 ± 0.3 (1.3–2.3) 3–4 – Chaudhary et al. (2024)
M. nekrasovae C. auratus gibelio Gill arch 13.8 ± 0.4 (12.2–15.0) 9.7 ± 0.2 (8.5–10.7) 6.7 ± 0.1 (6.0–7.6) 6.3 ± 0.1 (5.4–7.4) 3.4 ± 0.04 (3.1–4.0) 7 2.8 ± 0.1 (2.1–3.5) 1.4 ± 0.03 (1.0–1.6) 4 – Batueva et al. (2023)
M. paratypicus H. molitrix Gill filaments 13.8 (12.9–14.9) 9.9 (9.2–11.1) 7.0 7.5 (6.2–8.2) 5.0 (4.2–5.6) 7–8 2.7 (2.1–3.6) 1.4 (1.1–1.9) – – Xi et al. (2019)
M. tauricus Barbus barbus, Luciobarbus bocagei Pin bones and fins 14.0 ± 0.5 (13.4–15.4) 10.2 ± 0.6 (8.8–11.0) 8.4 ± 0.1 (8.2–8.6) 7.2 ± 0.5 (6.6–7.8) 3.9 ± 0.4 (3.2–4.2) 6–7 5.3 ± 0.4 (5.0–5.9) 3.1 ± 0.3 (2.5–3.7) 5 – Molnár et al. (2012)
M. shuifuensis Cirrhinus mrigala Kidney 15.6 ± 0.8 (13.9–17.1) 11.4 ± 0.5 (10.3–12.3) 7.9 ± 0.3 (7.5–8.5) 6.5 ± 0.3 (5.8–7.7) 4.0 ± 0.2 (3.5–4.6) 8–10 5.8 ± 0.3 (5.1–6.6) 3.5 ± 0.1 (3.1–3.8) 6–9 – Zhang et al. (2023)
Open in a new tab

SL spore length, SW spore width, ST spore thickness, PCL polar capsule length, PCW polar capsule width, PFC polar filament coils, SM sutural marking, – no data.

In comparison with other Myxobolus species infecting the ovaries of fish, M. binotati n. sp. differs markedly in several morphological characteristics. All previously described ovary-infecting Myxobolus species possess equal-sized polar capsules, whereas the polar capsules of M. binotati n. sp. are distinctly unequal. In addition, sutural markings are absent or have not been reported in the other ovary-infecting species (Table 5). Morphometrically, M. binotati n. sp. most closely resembles M. batalhensis from Brazil in terms of spore width, polar capsule width, and the number of polar tubule coils in the larger polar capsule. The number of polar capsule coils is almost similar to M. barakensis and M. batalhensis. Most notably, M. binotati n. sp. differs from other ovary-infecting Myxobolus species in its spore length and thickness, further supporting its morphological distinctiveness (Table 5). It should be noted that all morphometric measurements in this study were obtained from spores fixed in 10% neutral buffered formalin, which may cause slight shrinkage or distortion of structures and potentially influence fine-scale comparisons with descriptions based on fresh material.

Table 5.

Comparative data on spore measurements for Myxobolus binotati n. sp. and other ovary-infecting Myxobolus species in freshwater fishes. All measurements are in μm. SL spore length, SW spore width, ST spore thickness, PCL polar capsule length, PCW polar capsule width, PFC polar filament coils, SM sutural marking, L large, S small, – no data.

Species Host SL SW ST PCL PCW PFC SM Reference
Myxobolus binotati n. sp. Barbodes binotatus 10.7 ± 0.4a (10.0–11.4)b 8.3 ± 0.3 (7.8–8.9) 6.2 ± 0.3 (5.9–6.8) L: 4.8 ± 0.4 (4.0–5.8)
S: 2.7 ± 0.3 (2.1–3.1) 		L: 2.8 ± 0.2 (2.4–3.4)
S: 1.6 ± 0.2 (1.3–1.9) 		L: 6–8
S: 4 		8–10 Present study
M. ovarium Brycon orthotaenis 9.8 ± 0.4 (9.2–11.0) 6.5 ± 0.3 (5.9–6.9) 4.9 ± 0.1 (4.6–5.0) 4.7 ± 0.5 (3.9–6.2) 2.1 ± 0.2 (1.8–2.4) 9 – Naldoni et al. (2020)
M. barakensis Xenentodon cancila 9.71 ± 0.27 (9.45–9.97) 5.59 ± 0.42 (5.25–6.3) 4.16 ± 0.24 (3.86–4.69) 4.77 ± 0.46 (4.2–5.25) 2.12 ± 0.42 (2.10–2.20) 6–7 – Lebanan and Mohilal (2021)
M. liangshanensis Garra imberba 9.1 (8.1–10.1) 7.9 (7.3–8.1) 5.5 (5.1–5.6) 5.0 (4.8–5.6) 2.8 (2.4–3.2) – – Chen and Ma (1998)
Myxobolus sp. Clarias gariepinus 11.5c 8.2 – 4.3 3.1 4–5 – Gbankoto et al. (2015)
M. djoudjensis Coptodon guineensis 11.4 (11.0–13.0) 11.4 (11.0–13.0) – 4.3 (4.0–5.0) 4.0 (4.0–4.5) – – Damanka et al. (2007)
M. dahomeyensis Synodontis ansorgii 12.0 6.0 – (4.0–5.0) – – – Gbankoto et al. (2015)
M. aculeatus Macrognathus aculeatus 13.0 ± 0.2 (11.5–14.0) 6.4 ± 0.3 (6.0–7.2) 5.3 ± 0.2 (4.9–5.6) 4.5 ± 0.2 (3.5–4.7) 2.4 ± 0.1 (2.3–2.6) 5–6 – Xu et al. (2025)
M. gariepinus C. gariepinus 13.9 (13.7–15.0) 10.8 (10.0–11.2) – 6.2 (6.0–6.2) 3.5 (3.0–3.7) 5–6 – Reed et al. (2003)
M. algonquinensis Notemigonus crysoleucas 14.7 (13.6–15.4) 10.9 (10.1–12.1) 5.8 (5.0–6.9) 5.3 (5.1–5.5) 2.8 (2.6–3.0) 4–6 – Xiao and Desser (1997)
M. batalhensis Salminus hilarii 15.2 ± 0.8 (14.0–15.4) 8.5 ± 0.5 (8.0–8.7) 5.2 ± 0.3 (5.0–5.2) 5.2 ± 0.3 (5.0–5.5) 2.8 (2.0–3.0) 6–9 – Vieira et al. (2017)
Open in a new tab
a

Mean ± SD.

b

Minimum-maximum.

c

Mean.

4. Discussion

To date, no species have been reported or described from the ovaries of fish hosts in Malaysia and Southeast Asia. Although the gonads of fish are not among the most common sites of myxosporean infection, several myxobolids have been reported from the ovaries and testes of fish. In this study, a novel Myxobolus species, Myxobolus binotati n. sp. was identified from the ovaries of B. binotatus. This species was characterized based on its morphological features and molecular analysis of the 18 S rDNA gene sequences.

The incidence of M. binotati n. sp. was relatively low in the present study, with the parasite detected in only one of the 13 B. binotatus examined. Although this single observation is sufficient to describe the new species, the small sample size limits the ability to draw reliable conclusions about its prevalence, distribution, or epidemiological significance. Further studies involving larger numbers of B. binotatus from different localities and sampling seasons are needed to determine the prevalence, distribution, and potential epidemiological significance of this parasite.

Myxosporean infections of the gonads can have significant pathological consequences for their hosts. Severe infections have been associated with reduced reproductive success, gonadal regression and even parasitic castration (Gbankoto et al., 2001; Sitjà-Bobadilla, 2009). For example, an unidentified Myxobolus species infecting the ovaries of the African catfish, C. gariepinus (Gbankoto et al., 2015), and M. batalhensis infecting the ovaries of S. hilarii (Vieira et al., 2017) caused deformation and degeneration of oocytes due to extensive spore proliferation, ultimately resulting in impaired reproductive capacity and reduced fertilization success. Similarly, M. dahomeyensis infecting the ovaries of several tilapia species in Benin was reported to destroy oocytes and induce host castration (Grankoto et al., 2001). However, the severity of the pathological effect appears to vary depending on the site and extent of parasite development within the ovary. Infections restricted to the ovarian stroma tend to exhibit lower pathogenicity and are often not associated with inflammatory responses or disruption of oocyte structure (Azevedo et al., 1997; Tajdari et al., 2005; Gbankoto et al., 2015; Xu et al., 2025). Unfortunately, histopathological examination was not possible in the present study because of the limited number of infected specimens available for analysis. Consequently, the exact site of development of M. binotati n. sp. within the ovary could not be determined, and it remains unclear whether the parasite develops within or around the oocytes or within the ovarian stroma. Any potential effects of M. binotati n. sp. on ovarian structure or host reproduction remain speculative at this stage. Further investigations incorporating larger numbers of infected fish and detailed histopathological analyses are required to identify the precise infection site, evaluate the associated pathological effects, and assess the potential impact of M. binotati n. sp. on oocyte development and the reproductive fitness of its host.

Phylogenetic analysis based on 18S rDNA sequences revealed that M. binotati n. sp. formed a distinct lineage within the broader Myxobolus-Thelohanellus assemblage. Notably, this species did not cluster with other ovary-infecting myxobolid species included in the analysis, such as M. algonquinensis, M. batalhensis, M. aculeatus, and H. oviperda, despite sharing the same predilection site. Instead, M. binotati n. sp. was positioned separately from these taxa, indicating that ovarian tissue tropism alone does not necessarily reflect phylogenetic relationships among ovary-infecting myxobolids. A similar discrepancy between infection site and phylogenetic relationships has been observed in myxosporeans, in which species infecting the same tissue are not necessarily closely related. Previous studies have demonstrated that closely related myxobolid species may infect different organs of the same or related hosts, whereas morphologically similar species occupying the same tissue may belong to distantly related lineages (Salim and Desser, 2000; Molnár et al., 2002; Eszterbauer, 2004; Molnár and Eszterbauer, 2015). Therefore, the phylogenetic separation of M. binotati n. sp. from other ovary-infecting species suggests that infection of ovarian tissue may have arisen independently in different Myxobolus lineages or may represent a trait that has been gained or lost during the evolutionary history of the group. The separated phylogenetic placement of M. binotati n. sp. together with its morphological, morphometric, and molecular characteristics, supports its recognition as a distinct species.

The present phylogenetic analysis included sequences focused primarily on taxa with relatively high sequence similarity to M. binotati n. sp. including more divergent Myxobolus species would probably reveal more basal branching patterns and relationships within the genus, however it would be indifferent to direct phylogenetic position of M. binotati n. sp. The new species was consistently placed in a similar position in both ML and BI, supporting the reliability of its inferred phylogenetic placement.

The phylogenetic position of M. binotati n. sp. also appears not to be strongly associated with geographic origin. Although the analysis included numerous Myxobolus and related myxosporean sequences obtained from freshwater fishes in Malaysia, the new species did not cluster closely with these Malaysian taxa. Instead, several Malaysian Myxobolus species were distributed across different parts of the phylogenetic tree, including species infecting the gills, muscles, kidneys, fins, skin and ovaries. This pattern suggests that geographic proximity does not necessarily correspond to close phylogenetic relationships among Malaysian myxobolids. The distribution of Malaysian taxa across multiple lineages may reflect the high diversity of Myxobolus in freshwater fishes and potentially multiple independent evolutionary lineages occurring within the same geographic region. The distinct predilection of M. binotati n. sp., despite its occurrence in the same geographic region as several other sampled myxobolids, further supports its genetic distinctiveness and suggests that neither geographic origin nor predilection site alone can explain its evolutionary relationships. The discovery of M. binotati n. sp. therefore highlights both the diversity of myxosporeans in the Malaysian ichthyofauna and the importance of investigating non-traditional infection sites, such as reproductive organs, to better understand patterns of host specificity, tissue tropism, and parasite evolution.

CRediT authorship contribution statement

Nadhirah Syafiqah Suhaimi: Writing – review & editing, Writing – original draft, Visualization, Validation, Software, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Csaba Székely: Writing – review & editing, Validation, Supervision, Resources, Project administration, Funding acquisition, Conceptualization. Gábor Cech: Writing – review & editing, Validation, Software, Methodology, Data curation. Muhammad Hafiz Borkhanuddin: Writing – review & editing, Resources, Funding acquisition, Conceptualization. Boglárka Sellyei: Writing – review & editing, Validation, Supervision, Data curation.

Ethical approval

All applicable institutional, national, and international guidelines for the care and use of animals were followed.

Funding

This work was supported by the Stipendium Hungaricum Program.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

We thank the staff members at the Biodiversity Laboratory, Faculty of Science and Marine Environment, Universiti Malaysia Terengganu, for their assistance during the investigation.

References

  1. Al-Jahdali M.O., Hassanine R.M.E.S. Ovarian abnormality in a pathological case caused by Myxidium sp. (Myxozoa, Myxosporea) in onespot snapper fish Lutjanus monostigma (Teleostei, Lutjanidae) from the Red Sea. Acta Parasitol. 2010;55(1):1–7. [Google Scholar]
  2. Alonzo C.S.P., Diamante E.J.Y., Vitor-Maluya K.C.A., Alimbon J.A. First Report of Ichthyofaunal Composition in the River of Maduao, Maco, Davao de Oro, Philippines. Philipp. J. Fish. 2024;31(1) [Google Scholar]
  3. Alvarez-Pellitero P., Palenzuela O., Sitjà-Bobadilla A. Histopathology and cellular response in Enteromyxum leei (Myxozoa) infections of Diplodus puntazzo (Teleostei) Parasitol. Int. 2008;57(2):110–120. doi: 10.1016/j.parint.2007.09.004. [DOI] [PubMed] [Google Scholar]
  4. Aragão M. Myxobolus lutzi n. sp. Rev. Soc. Brasil Ciênc. 1919;3:325. [Google Scholar]
  5. Azevedo C., Corral L., Matos E. Light and ultrastructural data on Henneguya testicularis n. sp. (Myxozoa, Myxobolidae), a parasite from the testis of the Amazonian fish Moenkhausia oligolepis. Syst. Parasitol. 1997;37(2):111–114. [Google Scholar]
  6. Bariche M. 1998. Le Complexe Puntius Binotatus (Pisces, Cyprinidae) De Java Et Sumatra Estil Formé D'Une Ou Plusieurs Espèces?: Statut D'Une Population Cavernicole De Java (Doctoral Dissertation, Éditeur Inconnu) [Google Scholar]
  7. Barta J.R., Martin D.S., Liberator P.A., Dashkevicz M., Anderson J.W., Feighner S.D., Elbrecht A., Perkins-Barrow A., Jenkins M.C., Danforth H.D., Ruff M.D., Profous- Juchelka H. Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. J. Parasitol. 1997;83:262–271. doi: 10.2307/3284453. [DOI] [PubMed] [Google Scholar]
  8. Batueva M.D., Vlasenko P., Solovyev M.M., Abasheev R.Y. Myxobolus nekrasovae n. sp. (Cnidaria, Myxozoa) is a new species parasitizing the gills of the gibel carp, Carassius auratus gibelio. Microb. Pathog. 2023;185 doi: 10.1016/j.micpath.2023.106454. [DOI] [PubMed] [Google Scholar]
  9. Bergersen E.P., Anderson D.E. The distribution and spread of Myxobolus cerebralis in the United States. Fisheries. 1997;22(8):6–7. doi: 10.1577/15488446(1997)022<0006:TDASOM>2.0.CO;2. [DOI] [Google Scholar]
  10. Borkhanuddin M.H., Cech G., Mazelan S., Shaharom-Harrison F., Molnár K., Székely C. Myxobolus ophiocarae sp. n. (Myxozoa: myxosporea: Bivalvulida) infecting the gill of wild goby, Ophiocara porocephala (Perciformes: gobioidei) in Malaysia. Parasitol. Res. 2014;113(1):29–37. doi: 10.1007/s00436-013-3622-x. [DOI] [PubMed] [Google Scholar]
  11. Branson E., Riaza A., Alvarez‐Pellitero P. Myxosporean infection causing intestinal disease in farmed turbot, Scophthalmus maximus (L.), (Teleostei: scophthalmidae) J. Fish. Dis. 1999;22(5):395–399. [Google Scholar]
  12. Chaudhary A., Garg A., Goswami U., Chiary H.R., Sharma B., Singh H.S. Molecular identification of seven myxobolus species (Myxosporea: myxobolidae) in cyprinids from India. Int. J. Zool. Appl. Biosci. 2024;7(1):1–18. doi: 10.23880/izab-16000550. [DOI] [Google Scholar]
  13. Chen Q.L., Ma C.L. Science Press; 1998. Myxozoa: Myxosporea. [Google Scholar]
  14. Damanka A., Faye N., Fall M., Toguebaye B.S. Myxosporidian parasites of the genus Myxobolus butschli, 1882 found for the first time in Cichlid fishes from Senegal River (West Africa) Acta Protozool. 2007;46(3):257. [Google Scholar]
  15. Darriba D., Taboada G.L., Doallo R., Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nat. Methods. 2012;9:772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Diamant A., Whipps C.M., Kent M.L. A new species of Sphaeromyxa (Myxosporea: Sphaeromyxina: Sphaeromyxidae) in devil firefish, Pterois miles (Scorpaenidae), from the northern Red Sea: morphology, ultrastructure, and phylogeny. J. Parasitol. 2004;90:1434–1442. doi: 10.1645/GE-336R. [DOI] [PubMed] [Google Scholar]
  17. Dyková I., Fiala I., Nie P. Myxobolus lentisuturalis sp. n. (Myxozoa: myxobolidae), a new muscle-infecting species from the Prussian carp, Carassius gibelio from China. Folia Parasitol. 2002;49(4):253–258. doi: 10.14411/fp.2002.048. [DOI] [PubMed] [Google Scholar]
  18. Eiras J., Molnár K., Lu Y. Synopsis of the species of Myxobolus bütschli, 1882 (Myxozoa: myxosporea: myxobolidae) Syst. Parasitol. 2005;61:1–46. doi: 10.1007/s11230-004-6343-9. [DOI] [PubMed] [Google Scholar]
  19. Eiras J.C., Cruz C.F., Saraiva A., Adriano E.A. Synopsis of the species of Myxobolus (Cnidaria, Myxozoa, Myxosporea) described between 2014 and 2020. Folia Parasitol. 2021 doi: 10.14411/fp.2021.012. [DOI] [PubMed] [Google Scholar]
  20. Eiras J.C., Zhang J., Molnár K. Synopsis of the species of Myxobolus Bütschli, 1882 (Myxozoa: myxosporea, Myxobolidae) described between 2005 and 2013. Syst. Parasitol. 2014;88:11–36. doi: 10.1007/s11230-014-9484-5. [DOI] [PubMed] [Google Scholar]
  21. Eszterbauer E. Genetic relationship among gill-infecting Myxobolus species (Myxosporea) of cyprinids: molecular evidence of importance of tissue-specificity. Dis. Aquat. Org. 2004;58:35–40. doi: 10.3354/dao. [DOI] [PubMed] [Google Scholar]
  22. Feist S.W., Longshaw M. In: Fish Diseases and Disorders, Protozoan and Metazoan Infections. Woo P.T.K., editor. CABI; Wallingford UK: 2006. Phylum myxozoa; pp. 230–296. [Google Scholar]
  23. Gbankoto A., Pampoulie C., Marques A., Sakiti G.N. Occurrence of myxosporean parasites in the gills of two tilapias species from Lake Nokoué (Benin, West Africa): effect of host size and sex, and seasonal patterns of infection. Dis. Aquat. Org. 2001;44:217–222. doi: 10.3354/dao044217. [DOI] [PubMed] [Google Scholar]
  24. Gbankoto A., Tossavi N.D., Sindété M., Sakiti G.N., Moutaïrou K., Ribou A.C. Some pathophysiological insights into ovarian infestation by Myxobolus sp. (Myxozoa: Myxosporea) in Clarias gariepinus (Clariids: silurids) from Bénin (West Africa) Parasitol. Res. 2015;114(8):2941–2949. doi: 10.1007/s00436-015-4496-x. [DOI] [PubMed] [Google Scholar]
  25. Grankoto A., Pampoulie C., Marques A., Sakiti G.N. Myxobolus dahomeyensis infection in ovaries of Tilapia species from Benin (West Africa) J. Fish. Biol. 2001;58(3):883–886. doi: 10.1111/j.1095-8649.2001.tb00539.x. [DOI] [Google Scholar]
  26. Hallett S.L., Diamant A. Ultrastructure and small subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillago analis (Sillaginidae) from the coast of Queensland, Australia. Dis. Aquat. Org. 2001;46:197–212. doi: 10.3354/dao046197. [DOI] [PubMed] [Google Scholar]
  27. Isa M.M., Rawi C.S.M., Rosla R., Shah S.A.M., Shah A.S.R.M. Length- weight relationships of freshwater fish species in Kerian River Basin and Pedu Lake. Res. J. Fish. Hydrobiol. 2010;5(1):1–8. [Google Scholar]
  28. Kawano K.M., Sakurai M., Yanagida T. Description of Myxobolus iwagiensis n. sp. (Myxosporea: myxobolidae), infecting medaka Oryzias latipes (Temminck & Schlegel, 1846) (Beloniformes: adrianichthyidae) in Japan. Parasitol. Int. 2025;108 doi: 10.1016/j.parint.2025.103074. [DOI] [PubMed] [Google Scholar]
  29. Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz S., Duran C., Thierer T., Ashton B., Meintjes P., Drummond A. Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Khoa T.T., Huong T.T.T. Khoa Thuy San Truong Dai Hoc Can Tho; 1993. Dinh Loai Cá Nuóc Ngot Vùng Dông Bang Sông Cuu Long; pp. 3–8. [Google Scholar]
  31. Køie M., Karlsbakk E., Nylund A. The marine herring myxozoan Ceratomyxa auerbachi (Myxozoa: ceratomyxidae) uses Chone infundibuliformis (Annelida: polychaeta: sabellidae) as invertebrate host. Folia Parasitol. 2008;55:100–104. doi: 10.14411/fp.2008.013. [DOI] [PubMed] [Google Scholar]
  32. Kottelat M. Diagnoses of a new genus and 64 new species of fishes from Laos (Teleostei: cyprinidae, Balitoridae, Bagridae, Syngnathidae, Chaudhuriidae and Tetraodontidae) South Asian Nat. Hist. 2000;5(1):37–82. [Google Scholar]
  33. Kottelat M. The fishes of the inland waters of Southeast Asia: a catalogue and core bibliography of the fishes known to occur in freshwaters, mangroves and estuaries. Raffles Bull. Zool. 2013:1. [Google Scholar]
  34. Kottelat M., Lim K.K.P. Freshwater fishes of Sarawak and Brunei Darussalam: a preliminary annotated check-list. Sarawak Mus. J. 1995;48:227–256. [Google Scholar]
  35. Kottelat M., Lim K.K.P. Two new species of Barbodes from the Malay Peninsula and comments on 'cryptic species' in the B. binotatus group (Teleostei: cyprinidae) Raffles Bull. Zool. 2021;69(1):522–540. [Google Scholar]
  36. Kumar S., Stecher G., Li M., Knyaz C., Tamura K. Mega X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018;35:547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lebanan K., Mohilal N. Myxobolus barakensis sp. n. and one known species of Henneguya (Cnidaria: Myxosporea) from the freshwater fishes of Barak Valley, Assam. J. Exp. Zool. 2021;24(2):1267–1274. [Google Scholar]
  38. Lom J., Arthur J.R. A guideline for the preparation of species descriptions in Myxosporea. J. Fish. Dis. 1989;12:151–156. [Google Scholar]
  39. Lucký Z. Occurrence of Myxobolus pavlovskii - the parasite of Hypophthalmichthys molitrix and Aristichthys nobilis in the Fish Ponds in Czechoslovakia. Acta Vet. 1978;47:2039–2208. [Google Scholar]
  40. Mansour L., Harrath A.H., Abdel-Baki A.A.S., Alwasel S., Al-Quraishy S., Al Omar S.Y. Kudoa saudiensis sp. n. (Myxosporea: multivalvulida) infecting oocytes of the Indian mackerel Rastrelliger kanagurta (Perciformes: Scombridae) Folia Parasitol. 2015;62(2015.010):10–14411. doi: 10.14411/fp.2015.010. [DOI] [PubMed] [Google Scholar]
  41. Mansour L., Thabet A., Chourabi K., Harrath A.H., Gtari M., Al Omar S.Y., Ben Hassine O.K. Kudoa azevedoi n. sp.(Myxozoa, Multivalvulida) from the oocytes of the Atlantic horse mackerel Trachurus trachurus (Perciformes, Carangidae) in Tunisian coasts. Parasitol. Res. 2013;112(4):1737–1747. doi: 10.1007/s00436-013-3332-4. [DOI] [PubMed] [Google Scholar]
  42. Molnár K., Eszterbauer E. Myxozoan Evolution, Ecology and Development. Springer; Cham: 2015. Specificity of infection sites in vertebrate hosts; pp. 295–313. [Google Scholar]
  43. Molnár K., Eszterbauer E., Marton S., Székely C., Eiras J.C. Comparison of the Myxobolus fauna of common barbel from Hungary and Iberian barbel from Portugal. Dis. Aquat. Org. 2012;100:231–248. doi: 10.3354/dao02469. [DOI] [PubMed] [Google Scholar]
  44. Molnár K., Eszterbauer E., Székely C., Dán Á., Harrach B. Morphological and molecular biological studies on intramuscular Myxobolus spp. of cyprinid fish. J. Fish. Dis. 2002;25(11):643–652. doi: 10.1046/j.1365-2761.2002.00409.x. [DOI] [Google Scholar]
  45. Molnár K., Székely C., Mohamed K., Shaharom-Harrison F. Myxozoan pathogens in cultured Malaysian fishes. I. Myxozoan infection of the sutchi catfish Pangasius hypophthalmus in freshwater cage cultures. Dis. Aquat. Org. 2006;68:209–218. doi: 10.3354/dao. [DOI] [PubMed] [Google Scholar]
  46. Naldoni J., Pereira J.O., Milanin T., Adriano E.A., da Silva M.R., Maia A.A. Taxonomy, phylogeny and host-parasite interaction of two novel Myxobolus species infecting Brycon orthotaenia from the São Francisco River, Brazil. Parasitol. Int. 2020;76 doi: 10.1016/j.parint.2020.102061. [DOI] [PubMed] [Google Scholar]
  47. Ng C.K.T., Abdullah F., Biun H., Ibrahim M.K., Mustapha S., Sade A. A working checklist of the freshwater fish diversity for habitat management and conservation work in Sabah, Malaysia, North Borneo. Biodiversitas. 2017;18(2):560–574. [Google Scholar]
  48. Okamura B., Gruhl A., Bartholomew J.L. In: Myxozoan Evolution, Ecology and Development. Okumura B., Gruhl A., Bartholomew J.L., editors. Springer; Cham: 2015. An introduction to Myxozoan evolution, ecology and development; pp. 281–295. [Google Scholar]
  49. Pethiyagoda R., Meegaskumbura M., Maduwage K. A synopsis of the South Asian fishes referred to Puntius (Pisces: cyprinidae). Ichthyol. Explor. Freshw. 2012;23:69–95. [Google Scholar]
  50. Rainboth W.J. FAO; Rome: 1996. Fishes of the Cambodian Mekong. [Google Scholar]
  51. Rambaut A. 2018. Figtree V. 1.4.4: Tree Figure Drawing Tool. http//tree.bio.ed.ac.uk/software/figtree/ [Google Scholar]
  52. Reed C.C., Basson L., Van As L.L. Myxozoans infecting the sharptooth catfish, Clarias gariepinus in the Okavango River and Delta, Botswana, including descriptions of two new species. Henneguya samochimensis sp. n. and Myxobolus gariepinus sp. n. Folia parasitologica. 2003;50(3):183–189. doi: 10.14411/fp.2003.033. [DOI] [PubMed] [Google Scholar]
  53. Rocha E., Matos E., Azevedo C. Henneguya amazonica n. sp. (Myxozoa, Myxobolidae), parasitizing the gills of Crenicichla lepidota Heckel, 1840 (Teleostei, Cichlidae) from Amazon River. Europ. Protistol. 1992;28(3):273–278. doi: 10.1016/S0932-4739(11)80233-6. [DOI] [PubMed] [Google Scholar]
  54. Ronquist F., Teslenko M., van Der Mark P., Ayres D.L., Darling A., Hӧhna S., Larget B., Liu L., Suchard M.A., Huelsenbeck J.P. MrBayes 3.2: efficient bayesian phylogenetic inference and model choice across large model space. Syst. Biol. 2012;61:539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Salim K.Y., Desser S.S. Descriptions and phylogenetic systematics of Myxobolus spp. from cyprinids in Algonquin Park, Ontario. J. Eukaryot. Microbiol. 2000;47(3):309–318. doi: 10.1111/j.1550-7408.2000.tb00052.x. [DOI] [PubMed] [Google Scholar]
  56. Samshuri M.Á., Borkhanuddin M.H. Myxobolus acanthogobii Hoshina, 1952 and Myxobolus selari n. sp. (Myxosporea: myxobolidae) infecting brain of commercial fishes in Terengganu, Malaysia. Syst. Parasitol. 2024;101:39. doi: 10.1007/s11230-024-10162-3. [DOI] [PubMed] [Google Scholar]
  57. Shi X.W., Wang M., Chen H.Z., Gao L., Liu X.C., Yang C.Z., Zhao Y.J. Redescription and molecular phylogenetic analysis on Myxobolus acutus Wu and Chen, 1987 (Myxozoa: myxobolidae) Acta Hydrobiol. Sin. 2022;46:555–562. [Google Scholar]
  58. Sitjà-Bobadilla A. Can Myxosporean parasites compromise fish and amphibian reproduction? Proc. R. Soc. B: Biol. Sci. 2009;276:2861–2870. doi: 10.1098/rspb.2009.0368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sitja‐bobadilla A., Alvarez‐Pellitero P. Sphaerospora testicularis sp. nov.(Myxosporea: sphaerosporidae) ) in wild and cultured sea bass, Dicentrarchus labrax (L.), from the Spanish Mediterranean area. J. Fish. Dis. 1990;13(3):193–203. doi: 10.1111/j.1365-2761.1990.tb00774.x. [DOI] [Google Scholar]
  60. Sokolov S.G., Lebedeva D.I., Murzina S.A., Parshukov A.N., Bystrova K.A., Ieshko E.P. Morphology and phylogeny of Henneguya oviperda infecting oocytes of Esox lucius, with description of parasite-induced histopathology. Dis. Aquat. Org. 2019;133:91–98. doi: 10.3354/dao03331. [DOI] [PubMed] [Google Scholar]
  61. Stilwell J.M., Griffin M.J., Leary J.H., Khoo L.H., Camus A.C. Massive branchial henneguyosis of catfish: a distinct, myxozoan-induced gill disease caused by severe interlamellar Henneguya exilis infection in catfish aquaculture. Vet. Pathol. 2024;61(6):965–972. doi: 10.1177/0300985824125918. [DOI] [PubMed] [Google Scholar]
  62. Suhaimi N.S., Székely C., Molnár K., Cech G., Sellyei B., Borkhanuddin M.H. Biodiversity and five novel species of myxozoan parasites in Barbonymus spp. (Cyprinidae, Cypriniformes) from Malaysia. Sci. Rep. 2025;15(1) doi: 10.1038/s41598-025-14254-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Swearer S.E., Robertson D.R. Life history, pathology, and description of Kudoa ovivora n. sp. (Myxozoa, Myxosporea): an ovarian parasite of Caribbean labroid fishes. J. Parasitol. 1999:337–353. doi: 10.2307/3285645. [DOI] [PubMed] [Google Scholar]
  64. Székely C., Shaharom F., Cech G., Mohamed K., Zin N.A.M., Borkhanuddin M.H., Ostoros G., Molnár K. Myxozoan infection of the Malaysian mahseer, Tor tambroides, of Tasik Kenyir Reservoir, Malaysia: description of a new species Myxobolus tambroides sp. n. Parasitol. Res. 2012;111(4):1749–1756. doi: 10.1007/s00436-012-3020-9. [DOI] [PubMed] [Google Scholar]
  65. Székely C., Shaharom-Harrison F., Cech G., Mohamed K., Molnár K. Myxozoan pathogens of Malaysian fishes cultured in ponds and net-cages. Dis. Aquat. Org. 2009;83(1):49–57. doi: 10.3354/dao. [DOI] [PubMed] [Google Scholar]
  66. Székely C., Shaharom-Harrison F., Cech G., Ostoros G., Molnár K. Myxozoan infections in fishes of the Tasik Kenyir water reservoir, Terengganu, Malaysia. Dis. Aquat. Org. 2009;83(1):37–48. doi: 10.3354/dao. [DOI] [PubMed] [Google Scholar]
  67. Tajdari J., Matos E., Mendonca I., Azevedo C. Ultrastructural morphology of Myxobolus testicularis sp. n., parasite of the testis of Hemiodopsis microlepis (Teleostei: hemiodontidae) from the NE of Brazil. Acta Protozool. 2005;44(4):377. [Google Scholar]
  68. Thompson J.D., Higgins D.G., Gibson T.J. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Tongnunui S., Beamish F.W.H. Critical thermal maximum, temperature acclimation and climate effects on Thai freshwater fishes. Environ. Asia. 2017;10(1):109–117. [Google Scholar]
  70. Vieira D.H.M.D., Alama-Bermejo G., Bartholomew J.L., Abdallah V.D., de Azevedo R.K. Morphological and molecular description of Myxobolus batalhensis n. sp. (Myxozoa, Myxosporea), a liver and ovary parasite of Salminus hilarii in Brazil. Parasitol. Res. 2017;116(12):3303–3313. doi: 10.1007/s00436-017-5644-2. [DOI] [PubMed] [Google Scholar]
  71. Whipps C.W., Atkinson S.D., Hoeksema B.W. World list of Myxozoa. 2025. https://www.marinespecies.org/myxozoaon2026-07-20 Accessed at.
  72. Xi B.W., Zhao X., Li P., Xie J. Morphological variation in Myxobolus drjagini (Akhmerov, 1954) from silver carp and description of Myxobolus paratypicus n. sp. (Cnidaria: myxozoa) Parasitol. Res. 2019;118:2149–2157. doi: 10.1007/s00436-019-06350-6. [DOI] [PubMed] [Google Scholar]
  73. Xiao C., Desser S.S. Sphaerospora ovophila n. sp. and Myxobolus algonquinensis n. sp. (Myxozoa, Myxosporea), ovarian parasites of fish from Algonquin Park, Ontario, Canada. J. Eukaryot. Microbiol. 1997;44(2):157–161. [Google Scholar]
  74. Xu L., Zhao X., Huang Y., Xin Z., Zhang J. Morphological and molecular characterization of Myxobolus aculeatus n. sp. (Myxozoa: Myxosporea) from the ovary of Macrognathus aculeatus, Bloch, 1786 (Synbranchiformes: mastacembelidae) in China. Parasitol. Int. 2025;106 doi: 10.1016/j.parint.2025.103039. [DOI] [PubMed] [Google Scholar]
  75. Yokoyama H., Itoh N., Tanaka S. Henneguya pagri n. sp. (Myxozoa: Myxosporea) causing cardiac henneguyosis in red sea bream, Pagrus major (Temminck & Schlegel) J. Fish. Dis. 2005;28(8):479–487. doi: 10.1111/j.1365-2761.2005.00655.x. [DOI] [PubMed] [Google Scholar]
  76. Zakaria-Ismail M., Fatimah A., Khaironizam M.Z. LAP Lambert Academic Publishing; 2019. Fishes of the Freshwater Ecosystems of Peninsular Malaysia. [Google Scholar]
  77. Zakeyudin M.S., Isa M.M., Md Rawi C.S., Md Shah A.S. Assessment of suitability of Kerian River tributaries using length-weight relationship and relative condition factor of six freshwater fish species. J. Environ. Earth Sci. 2012;2:52–60. [Google Scholar]
  78. Zhang B., Tu X., Gu Z. Myxobolus shuifuensis sp. n. (Myxozoa: myxobolidae) infecting the exotic mrigal Cirrhinus mrigala feral in China. Parasitol. Int. 2023;94 doi: 10.1016/j.parint.2023.102732. [DOI] [PubMed] [Google Scholar]

Articles from International Journal for Parasitology: Parasites and Wildlife are provided here courtesy of Elsevier

RESOURCES