There was a mistake in Table 1 as published.
Table 1.
Primer details of ZAR1, MFN2, BAX, BCL2, and GAPDH genes.
| Name of the gene | Primer sequence | Size of amplicon | |
|---|---|---|---|
| ZAR1 | Forward primer | CTCCTCCTTTTCTGCTGCTC | 117 bp |
| Reverse primer | ACAGGCTCTCCTACGCATTT | ||
| MFN2 | Forward primer | GACCGCATCTTCTTCGTGT | 150 bp |
| Reverse primer | GCACTCCTCAAATCTCCTCTC | ||
| BAX | Forward primer | TGGATGACCGAGTACCTGAA | 121 bp |
| Reverse primer | CAGCCAGGAGAAATCAAACA | ||
| BCL2 | Forward primer | AGTGGCGGCTGAAATGTT | 120 bp |
| Reverse primer | AGTAGAAAAGGGCGACAACC | ||
| GAPDH | Forward primer | GCACAGTCAAGGCAGAGAAC | 101 bp |
| Reverse primer | ACCAGCATCACCCCACTT | ||
The primer sequences for ZAR1 reverse and MFN2 forward were inadvertently duplicated. The error was confined to the reporting of the primer sequences in Table 1; the corrected sequences correspond to the primers actually used in the experiments, and therefore the underlying qPCR data and analyses remain unchanged.
The corrected Table 1 appears below.
There was a mistake in Table 4 as published.
Table 4.
Comparison of in vitro development between the groups.
| Source of oocytes | Treatment | Oocytes treated (n) | Cleavage % (n) (mean ±SEM) | Morula % (n) (mean ±SEM) | Blastocyst % (n) (mean ±SEM) |
|---|---|---|---|---|---|
| Live animal (LOPU) | IVF | 222 | (122) 54.9 ± 3.0a | (56) 45.9 ± 1.9a | (36) 29.5 ± 3.0a |
| Abattoir | IVF | 425 | (192) 45.2 ± 4.2b | (67) 34.9 ± 1.7a | (37) 19.0 ± 2.0b |
The superscript letters “a” and “b” indicate statistically significant differences between values bearing different superscripts. Values sharing the same superscript are not significantly different.
The reported counts for morulae and blastocysts were incorrect, although the corresponding percentages were correct. The error was purely typographical and did not affect the underlying data, statistical analysis, results, or conclusions of the study.
The corrected Table 4 appears below.
There was a mistake in Figure 5 as published.
Figure 5.
Heatmap of fold-change (Live ÷ Abattoir) across genes (ZAR1, MFN2, BAX, BCL2) and developmental stages (GV, MII, Blastocyst). ZAR1 and MFN2 were upregulated in LOPU, while BAX was downregulated and BCL2 was moderately elevated.
The heatmap was incorrectly generated during figure preparation, resulting in an inaccurate representation of the gene-wise fold-change patterns. The underlying gene-expression data and statistical analyses were correct and remain unchanged.
The corrected Figure 5 appears below.
There was an error in Figure 6 as published.
Figure 6.
Forest plot of fold-change (Live ÷ Abattoir) for gene expression with 95% confidence intervals. Dashed vertical line at 1.0 indicates no difference. ZAR1 and MFN2 were significantly upregulated in LOPU oocytes, BAX was significantly downregulated, and BCL2 moderately increased across stages.
The forest plot was incorrectly generated during the preparation of the figure, resulting in an inaccurate visual representation of the corresponding effect estimates and confidence intervals. The underlying data, statistical analyses, and reported results were correct and remain unchanged. The error was limited to the generation and presentation of the forest plot.
The corrected Figure 6 appears below.
There was an error in the caption of Figure 5 as published.
The developmental stage was incorrectly described as “morula” instead of “blastocyst.”
The corrected caption of Figure 5 appears below:
“Heatmap of fold-change (Live ÷ Abattoir) across genes (ZAR1, MFN2, BAX, BCL2) and developmental stages (GV, MII, Blastocyst). ZAR1 and MFN2 were upregulated in LOPU, while BAX was downregulated and BCL2 was moderately elevated.”
The original version of this article has been updated.
Footnotes
Edited and reviewed by: Alessandra Rota, University of Pisa, Italy
Generative AI statement
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher's note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.