Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2026 Sep 22;105(12):107826. doi: 10.1016/j.psj.2026.107826

Long-term pop music exposure impairs production and reproductive performance in laying hens via neural and oxidative stress pathways

Zhen Liu 1, Ruiyu Ma 1, Renrong Qi 1, Wei Liu 1, Junying Li 1, Yi Wan 1, Yan Li 1, ZhenXing Wang 1, Sanjun Li 1, Kai Zhan 1,⁎
PMCID: PMC13636346  PMID: 42800454

Abstract

Relax music has been recognized as an effective form of environmental enrichment to improve poultry welfare; however, the effects of pop music on laying hens remain unclear. This study systematically the impact of long-term pop music exposure on production performance, egg quality, physiological status, and central nervous system responses in laying hens. Pop music exposure significantly decreased daily feed intake, laying rate, and egg weight, with increased egg breakage and reduced eggshell strength and yolk color. (P < 0.05). Blood biochemical analysis revealed elevated creatine kinase activity and impaired antioxidant capacity and decreased reproductive hormone concentrations (GnRH, LH and E2) (P < 0.05). Histological examination revealed increased neuronal density in the brain and a reduction in ovarian follicle number in music-exposed hens. Transcriptomic profiling identified 760 differentially expressed genes, predominantly involved in neurodevelopment and neuroendocrine regulation, including GABAergic synapse, serotonergic synapse, and GnRH secretion pathways. These findings suggest that long-term pop music exposure may act as a chronic stressor in laying hens, impairing production and reproductive performance through inducing oxidative stress, disrupting neural homeostasis, altering inhibitory neurotransmission, and impairing hypothalamic-pituitary-gonadal axis function.

Keywords: Pop music exposure, Laying hen, Production performance, Neuroendocrine, GABAergic synapse

Introduction

As a major source of affordable and high-quality animal protein, eggs play an essential role in supporting food supply and meeting human nutritional needs (Walker and Baum, 2021). In modern intensive production systems, environmental factors have become critical determinants affecting poultry health and productivity. Prolonged or chronic environmental stress can impair laying performance and egg quality, thereby severely constraining production efficiency and economic benefits in the laying hen industry. The laying hen industry has undergone rapid intensification and modernization to meet the increasing demand for egg products (Gautron et al., 2022). However, intensive production systems expose laying hens to various environmental challenges, including heat stress, stocking density, noise, and other management-related stressors, which can compromise physiological homeostasis and animal welfare (Janczak and Riber, 2015; Idowu et al., 2026). Increasing evidence indicates that chronic environmental stress negatively affects laying performance, egg quality, immune function, and metabolic status, thereby limiting production efficiency and economic sustainability in commercial egg production systems (Bilal et al., 2021).

Sound is an important environmental stimulus for poultry that can modulate physiological stress responses, behavioral patterns, and production performance (Cao et al., 2024). Acoustic stimuli are converted into electrical signals by peripheral auditory receptors and subsequently transmitted to the central nervous system, where they modulate neural plasticity and neurotransmitter networks (Pak et al., 2022; Meng et al., 2026). Accumulating evidence indicates that acoustic stimulation can affect the secretion and metabolism of key neurotransmitters, including serotonin (5-HT), γ-aminobutyric acid (GABA), and dopamine (Hurley and Hall, 2011; Feng and Rutledge, 2024; Zhou et al., 2025). These neurotransmitters are integrated at the hypothalamic level and participate in neuroendocrine regulation, thereby shaping endocrine output patterns in the organism. In addition, sound stimuli may regulate follicular development and reproductive performance through modulation of the hypothalamic–pituitary–adrenal (HPA) axis and the hypothalamic–pituitary–gonadal (HPG) axis (Jafari et al., 2020; Xiong et al., 2022; He et al., 2025). Furthermore, chronic exposure to specific acoustic environments may alter redox homeostasis, thereby influencing neural plasticity and signaling pathways associated with brain development, ultimately leading to systemic remodeling at both neural and metabolic levels (Bureš et al., 2024; Chen et al., 2024).

The acoustic environment represents an important environmental factor affecting poultry welfare and productivity. In commercial poultry production systems, laying hens are continuously exposed to complex acoustic environments generated by ventilation systems, feeding equipment, egg collection machinery, farm vehicles, and routine human activities (Yang et al., 2021). Such continuous acoustic stimulation may act as an environmental stressor, influencing behavioral responses, physiological stress status, and production performance in laying hens (Ncho et al., 2025). However, acoustic stimulation does not always exert negative effects. Appropriate acoustic enrichment, characterized by suitable sound intensity, frequency composition, and temporal patterns, may regulate behavioral responses, alleviate stress, and improve welfare indicators in poultry (Ciborowska et al., 2021; Schober et al., 2025). Previous studies have demonstrated that music characterized by stable rhythmic structures and relatively consistent acoustic patterns such as classical music, violin, and piano compositions—can reduce stress responses, improve physiological parameters, and enhance production performance in poultry (Gao et al., 2023; Cao et al., 2024; Wang et al., 2024). However, the biological effects of long-term exposure to acoustically complex music with greater temporal and spectral variability remain unclear in poultry. Therefore, in the present study, pop music was selected as a representative form of complex music stimulation to investigate whether long-term exposure to this distinct acoustic pattern affects production performance and physiological responses in laying hens.

Therefore, this study systematically evaluated the effects of long-term exposure to pop music on the physiological status, egg production performance, egg quality, and central nervous system of Hy-Line Gray laying hens. It further aimed to elucidate the mechanisms by which acoustic stimulation modulates central neural regulatory networks and neuroendocrine axes, providing a scientific basis for the management of acoustic environments and the improvement of animal welfare in poultry farms.

Materials and methods

Experimental design and sample collection

Two commercial laying houses, each housing 50,000 60-day-old Hy-Line Gray laying hens, were selected. One house served as the control group and was maintained under the natural acoustic environment of the poultry house, whereas the other house served as the music group and was exposed to pop music daily. The two houses were independently operated under the same commercial management conditions. Birds in both houses received the same basal diet and had ad libitum access to water. Diet formulation, lighting, environmental control, and routine management were conducted according to the Hy-Line Gray management guide. In the music house, pop music was played through a commercial broadcasting system, with synchronized loudspeakers installed on the ceiling at approximately 10-m intervals. Music was played daily from 06:00 to 18:00, beginning after the first feeding and ending after the final feeding of the day. The acoustic environment of each house was recorded during the experimental period. The average background sound intensity and dominant frequency of the control house were 79 dB and 43 Hz, respectively, whereas those of the music-treated house were 84 dB and 845 Hz, respectively.

Within each house, six independent cage units (replicates) were established, with each replicate consisting of 10 hens housed under identical conditions. These cage units served as the experimental units for performance evaluation and statistical analysis. Laying performance was recorded from 560 to 600 days of age (60 hens per group, divided into six replicates). Feed intake, total egg number, cracked egg number, and egg weight were recorded daily for each replicate. Egg production rate, mortality and culling rate, and feed-to-egg ratio were subsequently calculated. At 600 days of age, 18 hens per group (3 hens per replicate) were randomly selected after a 12 h fasting period. Blood was collected for serum and plasma separation. Birds were then euthanized, and brain and ovarian tissues were collected. Tissue samples were either fixed in 4% paraformaldehyde for histological analysis or snap-frozen in liquid nitrogen and stored at −80°C for biochemical assays.

Determination of production performance

At 600 days, egg quality was evaluated using 30 qualified eggs per group (10 eggs per replicate). Parameters assessed included eggshell strength, eggshell color, egg shape index, eggshell thickness, yolk weight, egg weight, albumen height, and Haugh unit.

Determination of serum biochemical parameters

Serum concentrations of corticosterone (CORT; H205-1-2), 5-hydroxytryptamine (5-HT; H104-1-1), gonadotropin-releasing hormone (GnRH; H297), luteinizing hormone (LH; H206-1-2), and estradiol (E2; H102-1-2) were determined using enzyme-linked immunosorbent assay (ELISA) kits. Creatine kinase (CK) activity was determined using a colorimetric assay kit (A032-1-1). Malondialdehyde (MDA) concentration was measured using the thiobarbituric acid (TBA) method (A003-1-2), whereas total superoxide dismutase (T-SOD) activity was determined using the hydroxylamine method (A001-1-2). Glutathione peroxidase (GSH-Px) activity was measured using a colorimetric assay (A005-1-1), and total antioxidant capacity (T-AOC) was determined using the ABTS method (A015-2-1). All assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China), and all measurements were performed according to the manufacturer’s instructions.

Antibody titers against avian influenza virus (AIV; H5 and H7 subtypes) and Newcastle disease virus (NDV) were determined by hemagglutination (HA) and hemagglutination inhibition (HI) assays. The antigens were purchased from Harbin Weike Biotechnology Co., Ltd.

histomorphology observation of brain and ovarian tissues

Hematoxylin and eosin (H&E) staining

Tissues fixed in 4% paraformaldehyde were trimmed, dehydrated through a graded ethanol series, cleared in xylene, and embedded in paraffin. The paraffin-embedded tissues were sectioned at 4–6 μm using a microtome. Sections were stained with a hematoxylin and eosin (H&E) staining kit (G1076, Servicebio Biotechnology Co., Ltd., Wuhan, China) according to the manufacturer’s instructions. Tissue morphology was examined, and images were captured using a BX50 light microscope.

Golgi staining

Tissues fixed in Golgi fixative solution were gently rinsed several times with distilled water. Sections were prepared using a vibratome and subsequently immersed in concentrated ammonia solution for 10 min to enhance the staining reaction. After rinsing with distilled water, sections were mounted with glycerol gelatin. Finally, tissue morphology was observed and images were acquired under a light microscope.

Transcriptome sequencing and bioinformatics analysis

Total RNA was extracted from brain tissues using TRIzol. After quality assessment, ribosomal RNA (rRNA) was removed using a Ribo-Zero™ Magnetic Kit (Epicentre, Madison, WI, USA). The remaining RNA was reverse-transcribed to generate cDNA, followed by second-strand synthesis. The resulting double-stranded cDNA was purified, end-repaired, A-tailed, and ligated to sequencing adapters. Libraries were size-selected, PCR-amplified, and sequenced on an Illumina NovaSeq 6000 platform. Raw reads were processed using fastp to obtain clean reads, which were then aligned to the reference genome using HISAT2. Transcript assembly and quantification were performed with StringTie, and gene expression levels were normalized as fragments per kilobase of transcript per million mapped reads (FPKM). Differentially expressed genes (DEGs) were identified using DESeq2 with thresholds of |fold change| ≥ 1.5 and P < 0.05. Functional enrichment analyses, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), were conducted using GOseq and KOBAS, respectively, with P < 0.05 considered statistically significant.

Quantitative real-time PCR (RT-qPCR)

cDNA was synthesized using the HiScript III RT SuperMix reverse transcription kit (Vazyme Biotech Co., Ltd., Nanjing, China). Gene-specific primers were designed using Primer3 software, and the primer sequences are listed in Table 1. RT-qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix kit (Vazyme Biotech Co., Ltd., Nanjing, China) on an ABI QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The reaction procedures and thermal cycling conditions were conducted in accordance with the manufacturer’s protocol. Relative gene expression levels were calculated using the 2−ΔΔCt method, with β-actin serving as the internal reference gene for normalization.

Table 1.

Primer sequences for real-time-quantitative-PCR analysis.

Gene GenBank number Primer sequence (5′→3′) Tm (°C) Product size (bp)
GATA3 NM_001008444.2 TACTTGTGTAACGCCTGTGGACTC 62.58 132
GGTGGTGGTGGTCTGACAGTTAG 62.67
APOD NM_001011692.2 TCGCTGAAGGAGAACGGCAAG 62.94 150
GGCAGAAGGCATAAACCAGTTGAAG 62.67
WNT3 NM_001081696.2 AACAGACACAACAACGAGGC 58.99 218
AGAGTTTCTACCCAACCCCG 59.02
AVP NM_205185.3 GCTGTGCTGAGGAGGACTAC 59.83 99
CACTGCAGCAGACACCATTG 59.76
TAC1 XM_040664671.2 ACGAGCGAAGGCGTAAATGA 60.11 71
GCATCGGCCATTGGAACAAA 59.75
SLC6A11 XM_040646635.2 GGTTTTCCGAAGGGGCTACA 59.69 187
AACCCAGCCTATGCAGACAC 60.04
CCACTGAGCAGCACCAATGAGTAG 63.46
β-actin NM_205518.2 ACGTCGCACTGGATTTCGAG 60.73 282
TGTCAGCAATGCCAGGGTAC 60.32
Open in a new tab

Statistical analysis

All data are presented as mean ± standard deviation (SD). The experimental unit was defined as the replicate cage (n = 6 per group). For all performance and biochemical parameters, the average of per replicate cage as the experimental units. Statistical analysis was performed using SPSS 20.0 software (SPSS Inc., USA). Differences between groups were analyzed using an independent samples t-test at the replicate level. A value of P < 0.05 was considered statistically significant.

Results

Effects of long-term pop music exposure on production performance of laying hens

The music-exposed group showed a markedly greater sound intensity than the control group (P < 0.05). Pop music exposure had no significant effect on body weight (P > 0.05), but hens in the music group exhibited greater inter-individual variation. In terms of production performance, the average daily feed intake, egg weight, and laying rate in the pop music group were significantly lower than those in the control group (P < 0.05), whereas the broken egg rate was significantly higher (P < 0.05). No significant difference in feed-to-egg ratio was detected between the two groups (P > 0.05) (Table 2).

Table 2.

Effects of long-term exposure to pop music on production performance in laying hens.

Control group Music group
Sound intensity dB 79.53 ± 3.85b 84.40 ± 1.20a
Sound frequency Hz 43.71 ± 1.11b 845.22 ± 103.29a
Light intensity lux 16.38 ± 8.00 16.12 ± 0.97
Body weight g 2093.38 ± 198.26 1968.36 ± 270.68
Average daily feed intake g 136.56 ± 8.02a 123.2 ± 8.83b
Average daily egg weight g 56.74 ± 2.59a 52.15 ± 2.54b
Broken egg rate % 0.45 ± 0.81 b 1.59 ± 1.78 a
Feed conversion ratio 2.42 ± 0.19 2.42 ± 0.20
Laying rate 86.77 ± 4.19a 83.40 ± 4.11b
Open in a new tab

Note: Data are presented as mean ± standard deviation (SD) (n = 6). Different letters (a, b) indicate significant differences between groups (P < 0.05).

Effects of long-term pop music exposure on egg quality

Compared with the control group, long-term exposure to pop music did not significantly affect egg shape index, eggshell color, albumen height, Haugh unit, and eggshell thickness (P > 0.05). Nevertheless, eggshell strength and egg weight were significantly decreased in the music group (P < 0.05). Moreover, yolk color score and yolk weight were both significantly decreased following music exposure (P < 0.05) (Table 3).

Table 3.

Effects of long-term exposure to pop music on egg quality in laying hens.

Control group Music group
Egg shape index 1.31 ± 0.05 1.33 ± 0.04
Eggshell color 52.55 ± 4.52 53.24 ± 3.83
Eggshell strength (kg/cm²) 3.74 ± 0.63a 3.48 ± 0.65b
Egg weight (g) 65.67 ± 4.90a 62.36 ± 4.17b
Albumen height (mm) 6.84 ± 1.50 6.36 ± 1.77
Yolk color 12.62 ± 0.70a 8.69 ± 0.47b
Haugh unit 79.35 ± 11.90 78.82 ± 13.47
Yolk weight (g) 19.73 ± 1.76a 19.04 ± 1.71b
Eggshell thickness (μm) 343.65 ± 22.67 337.79 ± 24.78
Open in a new tab

Note: Data are presented as mean ± standard deviation (SD) (n = 6). Different letters (a, b) indicate significant differences between groups (P < 0.05).

Effects of long-term pop music exposure blood biochemical parameters

music exposure markedly elevated serum CK activity (P < 0.05), whereas CORT concentrations remained unaffected (P > 0.05). In contrast, serum 5-HT was reduced after pop music exposure (P < 0.05). For antioxidant indices, T-SOD activity was comparable between groups, whereas both GSH-Px activity and T-AOC declined in the music-exposed hens (P < 0.05). In parallel, MDA content increased significantly (P < 0.05), indicating enhanced lipid peroxidation and impaired antioxidant defense. In terms of reproductive hormones, hens subjected to long-term pop music stimulation showed lower serum GnRH, LH, and E₂ concentrations than controls (P < 0.05), suggesting that long-term pop music stimulation may inhibit the HPG axis. In contrast, H5, H7, and ND antibody titers were not affected by music exposure (P > 0.05) (Table 4).

Table 4.

Effects of long-term pop music exposure on egg quality in laying hens.

Control group Music group
CK U/mL 0.72 ± 0.15 b 0.88 ± 0.17 a
CORT U/mL 292.78 ± 49.39 301.17 ± 44.16
5-HT ng/ U/mL 205.19 ± 27.39 a 152.18 ± 45.66b
H5 log2 4.17 ± 2.26 4.71 ± 1.89
H7 log2 3.77 ± 1.72 4.14 ± 1.43
ND log2 5.77 ± 1.27 5.95 ± 1.18
T-SOD U/mL 6.16 ± 1.35 6.89 ± 1.71
GSH-PX U/ mL 707.48 ± 106.28a 611.10 ± 83.10b
T-AOC Mm/L 0.49 ± 0.04a 0.44 ± 0.05b
MDA 1.51 ± 1.18b 4.10 ± 1.77a
GnRH 1632.18 ± 271.41 a 1321.84 ± 247.20 b
LH 4035.79 ± 937.07 a 1887.52 ± 598.38 b
E2 853.29 ± 196.18 a 529.91 ± 124.756 b
Open in a new tab

Note: Values are expressed as mean ± standard deviation (SD) (n = 6). CK, creatine kinase; CORT, corticosterone; 5-HT, 5-hydroxytryptamine; H5, avian influenza virus H5 subtype antibody; H7, avian influenza virus H7 subtype antibody; ND, Newcastle disease antibody; T-SOD, total superoxide dismutase activity; GSH-Px, glutathione peroxidase activity; T-AOC, total antioxidant capacity; MDA, malondialdehyde; GnRH, gonadotropin-releasing hormone; LH, luteinizing hormone; E₂, estradiol. Means with different letters (a, b) indicate significant differences (P < 0.05).

Effects of long-term pop music exposure on ovarian and brain histomorphology

H&E staining of ovarian tissue revealed that the control group (Fig. 1A). exhibited an intact ovarian architecture without obvious inflammatory changes. In contrast, the music group (Fig. 1B) displayed a marked reduction in follicles at different developmental stages, accompanied by loosened stromal structure and the presence of numerous deeply stained cells, including macrophages and lymphocytes, indicating marked inflammatory cell infiltration.

Fig. 1.

Fig. 1

Open in a new tab

Morphological observation of ovarian and brain tissues.

Note: (A) Control group; (B) Pop music exposure group. bar = 200 μm. (C) Control group, H&E staining; (D) Pop music-exposed group, H&E staining (bar = 200 μm); (E) Control group, Golgi staining; (F) Pop music-exposed group, Golgi staining (bar = 50 μm).

Histological examination of the cerebral cortex revealed that long-term pop music exposure altered the morphology of neurons and glial cells. H&E staining revealed that, relative to the control group (Fig. 1C), the music group (Fig. 1D) exhibited increased neuronal density and a slight increase in glial cell number. Golgi staining further demonstrated that neurons in the music group (Fig. 1E) had more complex dendritic and higher dendritic spine density compared with the control group (Fig. 1F).

Effects of long-term pop music exposure on the brain transcriptome

To further investigate the effects of pop music on brain transcriptional profiles, transcriptomic analysis was performed in the control (C) and music-exposed (M) groups. Principal component analysis (PCA) revealed a clear separation between the two groups (Fig. 2A), with PC1 and PC2 explaining 89.4% and 7.1% of the total variance, respectively. Principal component analysis (PCA) showed distinct clustering between the control and music groups (Fig. 2A), with the first two principal components explaining 89.4% and 7.1% of the total variance, respectively.

Fig. 2.

Fig. 2

Open in a new tab

Transcriptomic analysis of brain tissue in laying hens.

Note: (A) Principal component analysis (PCA); (B) scatter plot of differentially expressed genes (DEGs); (C) GO enrichment analysis of upregulated genes; (D) KEGG pathway enrichment analysis of upregulated genes; (E) GO enrichment analysis of downregulated genes; (F) KEGG pathway enrichment analysis of downregulated genes (n = 6).

A total of 760 differentially expressed genes (DEGs) were identified between the two groups, including 672 upregulated and 88 downregulated genes (Fig. 2B). Gene Ontology (GO) enrichment analysis showed that the upregulated genes were primarily enriched in biological processes related to developmental regulation, neurogenesis, transcription factor activity, and ion channel function (Fig. 2C). In contrast, the downregulated genes were mainly associated with neurodevelopment, transcriptional regulation, cellular metabolism, and cytoskeletal organization (Fig. 2E). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis further demonstrated that the upregulated genes were significantly enriched in multiple signaling pathways, including GnRH secretion, Wnt signaling pathway, axon guidance, mTOR signaling pathway, estrogen signaling pathway, TGF-β signaling pathway, neuroactive ligand–receptor interaction, GABAergic synapse, serotonergic synapse, and calcium signaling pathway (Fig. 2D). Conversely, downregulated genes were mainly enriched in pathways related to pyrimidine metabolism, VEGF signaling pathway, amino acid metabolism, and Notch signaling pathway (Fig. 2F).

QRT-PCR validation of differentially expressed genes

To further validate the sequencing data, six randomly selected genes were subjected to qRT-PCR analysis. The qRT-PCR results showed a strong concordance with the sequencing data (Fig. 3), confirming the accuracy and robustness of the sequencing analysis performed in this study.

Fig. 3.

Fig. 3

Open in a new tab

qRT-PCR validation of the differentially expressed (DE) genes.

Note: The data that are shown as the mean ± standard deviation (SD) values. C, Control group; M, the Pop music-exposed group; PF, the pair-fed group. * Represent significant differences (P < 0.05) (n = 6).

Discussion

Previous studies have shown that gentle musical stimuli, such as classical music, instrumental performances, violin, and piano music, can improve poultry welfare (Ciborowska et al., 2025). However, the systematic effects of pop music, which is characterized by greater fluctuations in sound intensity and more complex rhythmic and frequency patterns, on the physiological function and laying performance of hens remain largely unclear. In the present study, we systematically evaluated the effects of long-term exposure to pop music on the health status, immune function, and reproductive performance of laying hens. Under environmental stress conditions, the HPA axis is rapidly activated, leading to the secretion of glucocorticoids, such as corticosterone, from the adrenal cortex (Jafari et al., 2017; Nunez et al., 2025). CK is widely regarded as an important serum biochemical indicator reflecting physiological stress and tissue injury (Liu et al., 2023). Our results demonstrated that long-term exposure to pop music significantly increased serum CK activity and MDA levels in laying hens, accompanied by an upward trend in CORT levels, indicating a state of chronic mild stress associated with oxidative damage. Notably, these physiological alterations were highly consistent with the adverse production outcomes observed in this study, including reduced laying rate, decreased egg weight, and increased egg breakage rate. We speculate that prolonged exposure to pop music may be perceived by laying hens as a persistent environmental stressor, thereby disrupting its physiological balance, alters feeding motivation, and affects egg production performance and egg quality. In addition, the increased dispersion in body weight within the music-exposed group suggests that chronic acoustic stimulation may exacerbate inter-individual variability, possibly due to differences in adaptability or sensitivity to the auditory environment among individuals.

To further elucidate the potential central mechanisms by which pop music affects production and reproductive performance in laying hens, we performed transcriptomic analysis of brain tissues. The results revealed significant enrichment of multiple neurodevelopment-related pathways, including axon guidance, the Wnt signaling pathway, the Hedgehog signaling pathway, the mTOR pathway, serotonergic synapse, neuroactive ligand–receptor interaction, and the GABAergic synapse pathway. These pathways are critically involved in neuronal proliferation, axonal growth, synapse formation, and network plasticity, which may partly explain the increased neuronal number and higher cellular density observed in the music-exposed group at the morphological level. Of particular interest is the significant enrichment of the GABAergic synapse pathway. In vertebrates, γ-aminobutyric acid (GABA) functions as a major inhibitory neurotransmitter in the central nervous system (Krueger-Burg, 2025). Previous studies have demonstrated that GABAergic neurongs play a critical regulatory role in the stress response by directly inhibiting neuronal activity in the hypothalamic paraventricular nucleus (PVN), thereby reducing the release of corticotropin-releasing hormone (CRH) and arginine vasopressin (AVP), ultimately decreasing adrenocorticotropic hormone (ACTH) secretion and suppressing activation of the HPA axis (Tette et al., 2022; Douglass et al., 2023). This mechanism may partly explain our observation that pop music exposure markedly increased CK and MDA levels in laying hens, while corticosterone levels did not change significantly, suggesting that GABAergic networks may exert a negative feedback regulation on the HPA axis. The hypothalamus serves as a central hub for the regulation of feeding behavior and satiety, with its neural circuits playing a pivotal role in maintaining energy homeostasis (Li et al., 2019; Chen et al., 2025). GABAergic neurons modulate feeding drive by inhibiting anorexigenic proopiomelanocortin (POMC) neurons and enhancing the activity of orexigenic neuropeptide Y/agouti-related peptide (NPY/AgRP) neurons (Suyama and Yada, 2018; Yamagata et al., 2025). In addition, GABA signaling can influence central sensitivity to metabolic hormones such as insulin and leptin, thereby regulating satiety feedback (Ding et al., 2021; Han et al., 2023). These multi-level regulatory mechanisms collectively shape feeding behavior and energy intake patterns. Therefore, the alteration of GABAergic synapse signaling induced by pop music may represent a key neural mechanism underlying the reduced feed intake observed in laying hens in this study.

Furthermore, GABAergic inputs can markedly suppress the spontaneous firing of serotonergic (5-HT) neurons in regions such as the dorsal raphe nucleus (DRN), thereby reducing 5-HT release (Kawashima et al., 2025). The serotonergic system plays a crucial role in the regulation of emotional state, feeding behavior, and the reproductive axis. Thus, alterations in GABA–5-HT interactions may simultaneously influence affective status, energy intake, and reproductive hormone secretion (Hernández-Vázquez et al., 2019). Importantly, GABAergic synapses not only regulate stress responses and feeding behavior but also directly modulate the reproductive axis (Di Giorgio et al., 2019). GABAergic neurons exert inhibitory control over gonadotropin-releasing hormone (GnRH) neurons via GABAA_AA and GABAB_BB receptors, thereby regulating their excitability and pulsatile firing patterns, which in turn affects the pulsatile release of GnRH. This modulation subsequently influences the secretion rhythms of luteinizing hormone (LH), follicle-stimulating hormone (FSH), and estradiol (E2), ultimately determining follicular development and ovulation efficiency (Ciechanowska et al., 2019). This mechanism is highly consistent with our observations of decreased LH and E2 levels, as well as reduced laying rate in the music-exposed group, suggesting that alterations in central inhibitory synaptic signaling may represent a key pathway through which pop music impairs reproductive performance.

Conclusion

Long-term exposure to the specific complex pop music acoustic environment used in this study was associated with reduced feed intake, egg weight, and laying rate, together with an increased broken egg rate. These production-related changes were accompanied by increased serum CK activity and oxidative stress levels, as well as decreased serum 5-HT and reproductive hormone levels, suggesting that the hens experienced a state of chronic physiological stress. In addition, long-term acoustic exposure was associated with neuronal remodeling and changes in brain transcriptional profiles. The affected genes were mainly enriched in pathways related to neurodevelopment, neurotransmitter regulation, and reproductive function, including GABAergic and serotonergic synapses. These neural alterations may interfere with hypothalamic regulation of feeding behavior and HPG axis function, thereby affecting reproductive hormone secretion and ovarian homeostasis and contributing to the decline in feed intake and laying performance. Overall, this study provides insights into the potential mechanisms by which long-term exposure to complex pop music affects laying-hen production performance through neuroendocrine regulation. The findings also underscore the need to consider the characteristics, intensity, and duration of acoustic exposure when evaluating and managing the acoustic environment in commercial poultry production systems.

Abbreviations

CK: creatine kinase; 5-HT: 5-hydroxytryptamine; GSH-Px: glutathione peroxidase: T-AOC: total antioxidant capacity; CORT: corticosterone; T-SOD: total superoxide dismutase; GSH-Px: glutathione peroxidase; T-AOC: total antioxidant capacity; HPG: hypothalamic–pituitary–gonadal; MDA: malondialdehyde (MDA)

Ethics approval

Animal experimental procedures were approved by the Animal Care and Use Committee of Anhui Academy of Agricultural Sciences, Hefei, China (approval number: AAAS2025-9).

Funding

This study was supported by the Earmarked Fund for China Agriculture Research System (CARS-39-K21, CARS-39-S10), the Task of Independent Innovation Project of Anhui Academy of Agricultural Sciences(2026YL039), Development Project of Anhui Province (2023n06020002), Agricultural Science and Technology Transformation Project of the Anhui Academy of Agricultural Sciences (2026ZH010), and the Youth Elite Project of Anhui Academy of Agricultural Sciences (QNYC-202510).

CRediT authorship contribution statement

Zhen Liu contributed to the conception and design of the study, project implementation, experimental design, data acquisition, analysis and interpretation, and manuscript preparation. Kai Zhan contributed to the conception and design of the study, data analysis and interpretation, and critical revision of the manuscript.

Ruiyu Ma, Renrong Qi, Wei Liu, Junying Li, Yi Wan, Yan Li, Zhenxing Wang, and Sanjun Li contributed to experimental implementation, data acquisition and analysis, interpretation of results, and critical revision of the manuscript.

All authors reviewed and approved the final version of the manuscript and agree to be personally and publicly accountable for all aspects of the work, ensuring that questions related to the accuracy or integrity of the research are appropriately investigated and resolved.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

None.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2026.107826.

Appendix. Supplementary materials

mmc1.zip (65.4MB, zip)
mmc2.zip (55.3MB, zip)

References

  1. Bilal R.M., Hassan F.U., Farag M.R., Nasir T.A., Ragni M., Mahgoub H.A.M., Alagawany M. Thermal stress and high stocking densities in poultry farms: potential effects and mitigation strategies. J. Therm. Biol. 2021;99 doi: 10.1016/j.jtherbio.2021.102944. [DOI] [PubMed] [Google Scholar]
  2. Bureš Z., Svobodová Burianová J., Pysanenko K., Syka J. The effect of acoustically enriched environment on structure and function of the developing auditory system. Hear. Res. 2024;453 doi: 10.1016/j.heares.2024.109110. [DOI] [PubMed] [Google Scholar]
  3. Cao S., Ye M., Wei W., Yang F. Different sound exposures causes alterations in stress-related serum indicators, behaviors, and cecal microbiota of green-shell egg-laying chickens under different stocking densities. PeerJ. 2024;12 doi: 10.7717/peerj.18544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen J., Cai M., Zhan C. Neuronal regulation of feeding and energy metabolism: a focus on the hypothalamus and brainstem. Neurosci. Bull. 2025;41(4):665–675. doi: 10.1007/s12264-024-01335-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen Y., Huang J., Zhou Z., Zhang J., Jin C., Zeng X., Jia J., Li L. Noise exposure-induced the cerebral alterations: from emerging evidence to antioxidant-mediated prevention and treatment. Ecotoxicol. Environ. Saf. 2024;288 doi: 10.1016/j.ecoenv.2024.117411. [DOI] [PubMed] [Google Scholar]
  6. Ciborowska P., Bień D., Żbikowski A., Pawłowski K., Urban J., Zalewska A., Matuszewski A., Kareem K.Y., Piotrowska K., Michalczuk M. The impact of relaxation music (weightless by marconi union) on production performance, welfare, and hematological and biochemical blood parameters in broiler chickens. Poult. Sci. 2025;104(1) doi: 10.1016/j.psj.2024.104555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ciborowska P., Michalczuk M., Bień D. The effect of music on livestock: cattle, poultry and pigs. Animals. 2021;11(12):3572. doi: 10.3390/ani11123572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ciechanowska M.O., Lapot M., Kowalczyk M., Malewski T., Brytan M., Antkowiak B., Przekop F. Does kisspeptin participate in GABA-mediated modulation of GnRH and GnRH receptor biosynthesis in the hypothalamic-pituitary unit of follicular-phase ewes? Pharmacol. Rep. 2019;71(4):636–643. doi: 10.1016/j.pharep.2019.02.019. [DOI] [PubMed] [Google Scholar]
  9. Di Giorgio N.P., Bizzozzero-Hiriart M., Libertun C., Lux-Lantos V. Unraveling the connection between GABA and kisspeptin in the control of reproduction. Reprod. (Camb. Engl.) 2019;157(6):R225–R233. doi: 10.1530/REP-18-0527. [DOI] [PubMed] [Google Scholar]
  10. Ding G., Li X., Hou X., Zhou W., Gong Y., Liu F., He Y., Song J., Wang J., Basil P., Li W., Qian S., Saha P., Wang J., Cui C., Yang T., Zou K., Han Y., Amos C.I., Xu Y., Chen L., Sun Z. Author correction: REV-ERB in GABAergic neurons controls diurnal hepatic insulin sensitivity. Nature. 2021;595(7865):E2. doi: 10.1038/s41586-021-03654-5. [DOI] [PubMed] [Google Scholar]
  11. Douglass A.M., Resch J.M., Madara J.C., Kucukdereli H., Yizhar O., Grama A., Yamagata M., Yang Z., Lowell B.B. Neural basis for fasting activation of the hypothalamic-pituitary-adrenal axis. Nature. 2023;620(7972):154–162. doi: 10.1038/s41586-023-06358-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Feng G.W., Rutledge R.B. Surprising sounds influence risky decision making. Nat. Commun. 2024;15(1):8027. doi: 10.1038/s41467-024-51729-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gao X., Gong J., Yang B., Liu Y., Xu H., Hao Y., Jing J., Feng Z., Li L. Effect of classical music on growth performance, stress level, antioxidant index, immune function and meat quality in broilers at different stocking densities. Front. Vet. Sci. 2023;10 doi: 10.3389/fvets.2023.1227654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gautron J., Dombre C., Nau F., Feidt C., Guillier L. Review: production factors affecting the quality of chicken table eggs and egg products in Europe. Animal. 2022;16 doi: 10.1016/j.animal.2021.100425. [DOI] [PubMed] [Google Scholar]
  15. Han Y., He Y., Harris L., Xu Y., Wu Q. Identification of a GABAergic neural circuit governing leptin signaling deficiency-induced obesity. Elife. 2023;12 doi: 10.7554/eLife.82649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. He R., Yang W., Duan Y., Zhou T., Li Y., Li Y., Liu Z., Shen Y., Chen Q. Underwater noise impairs reproduction in zebrafish by disrupting the hypothalamic-pituitary-gonadal axis. Aquac. Rep. 2025;42 doi: 10.1016/j.aqrep.2025.102786. [DOI] [Google Scholar]
  17. Hernández-Vázquez F., Garduño J., Hernández-López S. GABAergic modulation of serotonergic neurons in the dorsal raphe nucleus. Rev. Neurosci. 2019;30(3):289–303. doi: 10.1515/revneuro-2018-0014. [DOI] [PubMed] [Google Scholar]
  18. Hurley L.M., Hall I.C. Context-dependent modulation of auditory processing by serotonin. Hear. Res. 2011;279(1–2):74–84. doi: 10.1016/j.heares.2010.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Idowu P.A., Chauke C., Mpofu T.J. Integrated stress physiology and mitigation strategies for heat stress in layer chickens—review. Anim. (Basel) 2026;16(7):1001. doi: 10.3390/ani16071001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jafari Z., Kolb B.E., Mohajerani M.H. Noise exposure accelerates the risk of cognitive impairment and alzheimer's disease: adulthood, gestational, and prenatal mechanistic evidence from animal studies. Neurosci. Biobehav. Rev. 2020;117:110–128. doi: 10.1016/j.neubiorev.2019.04.001. [DOI] [PubMed] [Google Scholar]
  21. Jafari Z., Mehla J., Kolb B.E., Mohajerani M.H. Prenatal noise stress impairs HPA axis and cognitive performance in mice. Sci. Rep. 2017;7(1) doi: 10.1038/s41598-017-09799-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Janczak A.M., Riber A.B. Review of rearing-related factors affecting the welfare of laying hens. Poult. Sci. 2015;94(7):1454–1469. doi: 10.3382/ps/pev123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kawashima T., Wei Z., Haruvi R., Shainer I., Narayan S., Baier H., Ahrens M.B. Voltage imaging reveals circuit computations in the raphe underlying serotonin-mediated motor vigor learning. Neuron. 2025;113(16):2692–2707.e8. doi: 10.1016/j.neuron.2025.05.017. [DOI] [PubMed] [Google Scholar]
  24. Krueger-Burg D. Understanding GABAergic synapse diversity and its implications for GABAergic pharmacotherapy. Trends Neurosci. 2025;48(1):47–61. doi: 10.1016/j.tins.2024.11.007. [DOI] [PubMed] [Google Scholar]
  25. Li M.M., Madara J.C., Steger J.S., Krashes M.J., Balthasar N., Campbell J.N., Resch J.M., Conley N.J., Garfield A.S., Lowell B.B. The paraventricular hypothalamus regulates satiety and prevents obesity via two genetically distinct circuits. Neuron. 2019;102(3):653–667.e6. doi: 10.1016/j.neuron.2019.02.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu Y., Liu Z., Xing T., Li J., Zhang L., Zhao L., Gao F. Effect of chronic heat stress on the carbonylation of glycolytic enzymes in breast muscle and its correlation with the growth performance of broilers. Poult. Sci. 2023;102(12) doi: 10.1016/j.psj.2023.103103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Meng N., Yajun Z., Xun L. Morphological correlates of music-induced plasticity in the central auditory system. Int. J. Dev. Neurosci.: Off. J. Int. Soc. Dev. Neurosci. 2026;86(1) doi: 10.1002/jdn.70091. [DOI] [PubMed] [Google Scholar]
  28. Ncho C.M., Berdos J.I., Gupta V., Rahman A., Mekonnen K.T., Bakhsh A. Abiotic stressors in poultry production: a comprehensive review. J. Anim. Physiol. Anim. Nutr. 2025;109(1):30–50. doi: 10.1111/jpn.14032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nunez S.G., Rabelo S.P., Subotic N., Caruso J.W., Knezevic N.N. Chronic stress and autoimmunity: the role of HPA axis and cortisol dysregulation. Int. J. Mol. Sci. 2025;26(20):9994. doi: 10.3390/ijms26209994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pak S., Choi G., Roy J., Poon C.H., Lee J., Cho D., Lee M., Lim L.W., Bao S., Yang S., Yang S. Altered synaptic plasticity of the longitudinal dentate gyrus network in noise-induced anxiety. Iscience. 2022;25(6) doi: 10.1016/j.isci.2022.104364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Schober J.M., Ayres G., Chambers G., Stuart E., Peterson B., Curry J., Fraley G.S. Effects of auditory enrichment on pekin duck production and welfare. Poult. Sci. 2025;104(11) doi: 10.1016/j.psj.2025.105877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Suyama S., Yada T. New insight into GABAergic neurons in the hypothalamic feeding regulation. J. Physiol. Sci. 2018;68(6):717–722. doi: 10.1007/s12576-018-0622-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tette F., Kwofie S.K., Wilson M.D. Therapeutic anti-depressant potential of microbial GABA produced by lactobacillus rhamnosus strains for GABAergic signaling restoration and inhibition of addiction-induced HPA axis hyperactivity. Curr. Issues Mol. Biol. 2022;44(4):1434–1451. doi: 10.3390/cimb44040096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Walker S., Baum J.I. Eggs as an affordable source of nutrients for adults and children living in food-insecure environments. Nutr. Rev. 2022;80(2):178–186. doi: 10.1093/nutrit/nuab019. [DOI] [PubMed] [Google Scholar]
  35. Wang H., Wang Y., Chai Y., Zhang H., Chang Q., Li J., Zhang R., Bao J. Prolonged exposure to a music-enriched environment mitigates acute noise-induced inflammation and apoptosis in the chicken spleen by modulating the Keap-1/Nrf2 and NF-κb pathways. Poult. Sci. 2024;103(10) doi: 10.1016/j.psj.2024.104100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Xiong B., Zhong Z., Chen C., Huang H., Lin J., Xu Y., Yang J., Yu C. The anxiolytic effect of koumine on a predatory sound stress-induced anxiety model and its associated molecular mechanisms. Phytomed.: Int. J. Phytother. Phytopharm. 2022;103 doi: 10.1016/j.phymed.2022.154225. [DOI] [PubMed] [Google Scholar]
  37. Yamagata S., Copperi F., White G.T., Kim J.D., Diano S. Dorsal raphe nucleus MC4r-GABAergic neurons regulate feeding and anxiety. Mol. Metab. 2025;99 doi: 10.1016/j.molmet.2025.102199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yang X., Zhao Y., Qi H., Tabler G.T. Characterizing sounds of different sources in a. Commer. Broiler House, Anim. 2021;11(3):916. doi: 10.3390/ani11030916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhou S., Zhu Y., Du A., Niu S., Du Y., Yang Y., Chen W., Du S., Sun L., Liu Y., Wu H., Lou H., Li X., Duan S., Yang H. A midbrain circuit mechanism for noise-induced negative valence coding. Nat. Commun. 2025;16(1):4610. doi: 10.1038/s41467-025-59956-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.zip (65.4MB, zip)
mmc2.zip (55.3MB, zip)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES