Abstract
Background
Novel goose astrovirus (NGAstV) and goose circovirus (GoCV) are two major pathogens responsible for disease outbreaks in goslings, causing substantial economic losses to the goose farming industry. In this study, two duplex multienzyme isothermal rapid amplification (MIRA) assays were developed for the simultaneous detection of NGAstV and GoCV, and the specificity and sensitivity of these detection methods were evaluated.
Results
Both MIRA assays demonstrated high specificity for NGAstV and GoCV, with no cross-reactivity observed with six waterfowl pathogens, including duck enteritis virus, goose parvovirus, fowl adenovirus serotype 4, H9 subtype avian influenza virus, Muscovy duck reovirus and duck Tembusu virus. The basic duplex MIRA assay completed amplification within 25 min under a constant temperature of 25 °C, with minimum detection limits of 1 × 102 copies/µL for NGAstV and 1 × 103 copies/µL for GoCV. In contrast, the duplex MIRA-qPCR assay reduced the reaction time to 20 min at 39 °C, and increased the sensitivity to 1 × 101 copies/µL for NGAstV and 1 × 10² copies/µL for GoCV. Fluorescence imaging technology enables differentiation of infection types based on color variations: mixed infections appear yellow, single NGAstV infections show green fluorescence, and single GoCV infections exhibit red fluorescence. In the clinical sample testing, the detection rates of the two pathogens were relatively high, with a mixed infection rate of up to 18%.
Conclusions
This method significantly improves pathogen detection efficiency and serves as an effective tool for the rapid identification of NGAstV and GoCV.
Supplementary Information
The online version contains supplementary material available at https://doi.org/10.1186/s12917-026-05627-0.
Keywords: Novel goose astrovirus, Goose circovirus, Multienzyme isothermal rapid amplification, Simultaneous detection
Background
Gout in goslings is a nutritional and metabolic disease characterized by impaired urate metabolism, primarily presenting as extensive urate deposition in visceral organs or joint cavities [1, 2]. There are two common clinical forms, visceral gout and joint gout. Novel goose astrovirus (NGAstV) is the primary exogenous pathogen responsible for inducing gout in goslings, posing the greatest threat to goslings under three weeks of age [3]. Geese infected with the virus can show clinical symptoms in about 5 days and start to die around 7 days, the morbidity rate can reach up to 80%, with mortality exceeding 50% in severe cases [4, 5]. After 20 days of age, the infection rate drops sharply, and clinical symptoms become markedly milder [5, 6]. Although healthy adult geese exhibit no apparent symptoms, they can act as asymptomatic carriers of the virus.
Goose circovirus (GoCV) is an immunosuppressive pathogen that primarily targets host lymphocytes, leading to compromised immune function [7]. Although GoCV infection typically does not cause direct mortality, it predisposes affected birds to secondary infections by other pathogens, which may result in death [8, 9]. Geese of various ages, breeds, and sexes are susceptible to GoCV, with goslings being particularly vulnerable due to their underdeveloped immune systems, often exhibiting more severe clinical symptoms upon infection [10, 11]. Both GoCV and NGAstV are prevalent viruses within goose populations and pose a heightened risk of infection during the early growth stages of goslings. Co-infection with these two viruses is commonly observed during goose farming, contributing to significant economic losses within the industry [12, 13].
Multienzyme isothermal rapid amplification (MIRA) is an isothermal nucleic acid amplification technology that has emerged in recent years. Compared with conventional pathogen detection techniques, the MIRA method offers several advantages [14]. By harnessing the synergistic activity of multiple enzymes, this technique enables efficient isothermal amplification of nucleic acids within a short time frame, typically completing the reaction within 30 min, thereby greatly enhancing detection efficiency [15, 16]. In this study, the ORF1b gene of NGAstV and the Rep gene of GoCV were selected as target sequences to develop a basic duplex MIRA assay and a duplex MIRA-qPCR assay for the simultaneous detection of NGAstV and GoCV. The aim is to provide technical support for the rapid identification of these two pathogens and the timely prevention and control of mixed infections in goslings.
Results
Evaluation of primers and probes
Using recombinant plasmids pUC57-NGAstV and pUC57-GoCV as templates, both singleplex MIRA and MIRA-qPCR assays were employed to validate the designed primers and probes. As shown in Fig. 1A, the amplicons generated by the primer pairs targeting NGAstV and GoCV in the basic duplex MIRA were consistent with the expected sizes and exhibited efficient amplification. In the MIRA-qPCR assay, both primer pairs yielded typical “S-shaped” amplification curves for their respective target viruses (Fig. 1C and D). Fluorescence imaging further demonstrated that single GoCV-positive amplification emitted red fluorescence, while single NGAstV-positive amplification showed green fluorescence (Fig. 1B). No nonspecific amplification was observed in the negative controls, which appeared colorless and transparent under fluorescence imaging. Therefore, the selected primer pairs and probes were deemed suitable for subsequent development of the duplex MIRA assays.
Fig. 1.
Primary tests for primers and probes by two MIRA assays. The DNA templates of NGAstV and GoCV were plasmids of 1 × 107 copies/µL. A Agarose gel electrophoresis of basic MIRA assay. M, DL2,000 DNA marker; 1, GoCV; 2, NGAstV; 3 and 4, negative control. B The fluorescence imaging of MIRA-qPCR assay. 1, GoCV; 2, NGAstV; 3 and 4,negative control. C The detection of NGAstV by MIRA-qPCR assay. 1, amplification products; 2, negative control. D The detection of GoCV by MIRA-qPCR assay. 1, amplification products; 2, negative control
Optimization of reaction temperature and time
The temperature and time for the duplex MIRA reaction were explored. The visible target bands for both pathogens appeared after 15 min of amplification; at 20 min, the band intensity increased; and by 25 min, amplification reached a plateau (Fig. 2A). There was no significant difference in band brightness among the 25, 30, and 35-minute reaction times. Taking into consideration both detection efficiency and energy cost-effectiveness, 25 min was selected as the optimal reaction time for the basic duplex MIRA assay for NGAstV and GoCV. As shown in Fig. 2B, amplification bands were first observed at 20 °C, with amplification efficiency at 25, 30, 35, and 40 °C being superior to that at 20 °C. However, no significant differences in amplification efficiency were observed among these four temperatures, and thus 25 °C was chosen as the optimal reaction temperature for the basic duplex MIRA detection.
Fig. 2.
The optimization results of basic duplex MIRA reaction. The DNA templates of NGAstV and GoCV were plasmids of 1 × 107 copies/µL. A MIRA amplification at different time. M, DL2000 DNA marker; 1 to 5, the times were 15, 20, 25, 30 and 35 min, respectively. B MIRA amplification at different temperatures. M, DL2000 DNA marker; 1 to 6, the temperatures were 15, 20, 25, 30, 35 and 40℃, respectively
Specificity analysis
The specificity of the duplex MIRA and the duplex MIRA-qPCR were detected by AIV-H9, FAdV-4, DEV, MDRV, DTMUV and GPV. As shown in Fig. 3A and B, both duplex MIRA methods successfully identified mixed and single infections of NGAstV and GoCV without any cross-reactivity with the other pathogens. No amplification was observed in the negative controls. Using fluorescence imaging, the amplification products of NGAstV and GoCV mixed infections in the duplex MIRA-qPCR assay exhibited a yellow fluorescence signal, while single infections of NGAstV and GoCV appeared as green and red fluorescence signals, respectively (Fig. 3C). These results indicate that both detection methods possess high specificity.
Fig. 3.
Analytical specificity of two duplex MIRA assays. A Specificity result of basic duplex MIRA. M, DL2000 DNA marker; 1 and 2, NGAstV+GoCV; 3, NGAstV; 4,GoCV; 5, GPV; 6, DTMUV; 7, MDRV; 8, FAdV-4; 9,DEV; 10, AIV-H9; 11, negative control. B Specificity result of duplex MIRA-qPCR. 1, GoCV; 2, NGAstV; 3, GoCV+NGAstV; 4, AIV-H9; 5, DEV; 6, FAdV-4; 7, MDRV; 8, GPV; 9, DTMUV; 10, negative control. C Specificity of Fluorescence imaging for duplex MIRA-qPCR. 1, GoCV+NGAstV; 2, NGAstV; 3, GoCV; 4, AIV-H9; 5, DEV; 6, FAdV-4; 7, MDRV; 8, GPV; 9, DTMUV; 10, negative control
Sensitivity analysis
Ten-fold serial dilutions of plasmid DNA were set as templates to detect the sensitivity of the duplex MIRA assays. The minimum detection limits of the duplex MIRA for NGAstV and GoCV were 1 × 102 copies/µL and 1 × 103 copies/µL, respectively (Fig. 4A). In the duplex MIRA-qPCR assay, the detection limit for GoCV was 1 × 102 copies/µL, whereas the assay demonstrated higher sensitivity for NGAstV, with a minimum detection threshold of 1 × 101 copies/µL (Fig. 4B).
Fig. 4.
Analytical sensitivity of two duplex MIRA assays. M, DL2000 DNA marker; 1 to 7, Mixed DNA templates of NGAstV and GoCV were 1 × 107 to 1 × 101 copies/µL; 8, negative control. A Sensitivity of basic duplex MIRA. B Sensitivity result of duplex MIRA-qPCR. C Sensitivity of Fluorescence imaging for duplex MIRA-qPCR
Fluorescence imaging of the duplex MIRA-qPCR products revealed that fluorescence intensity gradually decreased with declining template concentrations. In the dilution range of 1 × 10⁷-1 × 10² copies/µL, a typical yellow fluorescence indicative of mixed infection was consistently observed. When both GoCV and NGAstV plasmid copy numbers dropped to 1 × 10¹ copies/µL, only NGAstV was detected by the duplex MIRA-qPCR system, presenting as a single green fluorescence signal (Fig. 4C).
Detection of clinical samples
To further evaluate the usability of the two duplex MIRA detections, 50 clinical samples suspected of being infected with NGAstV or GoCV were tested. As shown in Table 1, both the basic duplex MIRA and duplex MIRA-qPCR assays yielded identical positive detection rates: 18 samples were positive for GoCV (36.0%), 15 samples were positive for NGAstV (30.0%), and 9 samples (18.0%) were identified as co-infected. In contrast, conventional PCR detected 16 GoCV-positive samples (32.0%), 12 NGAstV-positive samples (24.0%), and 8 mixed infection cases (16.0%). The duplex MIRA methods developed in this study demonstrated higher sensitivity in detecting target pathogens compared to conventional PCR.
Table 1.
Detection of clinical samples by two duplex MIRA assays and conventional PCR
| Pathogens | Number of samples |
Duplex MIRA |
Duplex MIRA-qPCR |
PCR | |||
|---|---|---|---|---|---|---|---|
| Number of Positives |
Positive detection rates (%) |
Number of Positives |
Positive detection rates (%) |
Number of Positives |
Positive detection rates (%) |
||
| GoCV | 50 | 18 | 36% | 18 | 36% | 16 | 32% |
| NGAstV | 50 | 15 | 30% | 15 | 30% | 12 | 24% |
| GoCV+NGAstV | 50 | 9 | 18% | 9 | 18% | 8 | 16% |
Discussion
GoCV is an immunosuppressive pathogen that compromises the immune function of infected poultry, thereby increasing the risk of secondary infection [17, 18]. The co-infection of two or more pathogens will increase the morbidity and mortality rates of the infected poultry flock and complicate the clinical diagnosis [13]. Currently established diagnostic methods primarily focus on the individual detection of either NGAstV or GoCV. For instance, a RT-qPCR assay targeting specific gene regions of NGAstV has been developed, with a detection limit of 33.4 copies/µL [19]. Specific primers and probes were designed for the conserved region of the GoCV Rep gene, and a rapid, sensitive and highly specific TaqMan real-time quantitative PCR detection method was established [20]. A quantitative loop-mediated isothermal amplification (qLAMP) assay targeting the ORF1a gene of NGAstV utilizes four specific primers and achieves detection within 60 min at 65 °C, with a lower limit of 1 × 101 copies/µL [21]. A MIRA-LFD assay targeting the highly conserved RNA-dependent RNA polymerase (RdRp) gene of NGAstV, using a single primer pair, has also been reported, with a detection limit as low as 1 copy/µL and a reaction time of ≤ 20 min. However, these methods are designed solely for the detection of either NGAstV or GoCV and are not capable of simultaneous identification of both pathogens. A multiplex RT-qPCR method capable of detecting both GoCV and GAstV has also been reported, but its application is limited by the relatively complex procedure and a reaction time exceeding 60 min [12].
The nucleic acid amplification of MIRA is carried out efficiently and rapidly at a constant temperature, without the need for thermal cycling [22–25]. Compared to traditional methods, this approach requires far less stringent equipment conditions, greatly enabling decentralized testing of clinical samples. In the study, the ORF1b and Rep genes of NGAstV and GoCV were selected as the target genes respectively, and two duplex MIRA assays for NGAstV and GoCV were successfully developed. The ORF1b region of NGAstV encodes RdRp, while the Rep gene of GoCV produces the replication-associated protein [26, 27]. Both of these genes are relatively conserved and are suitable for virus identification [13, 28]. The basic duplex MIRA assay can simultaneously and stably amplify target genes of both viruses within 25 min under a constant temperature of 25 °C. The fluorescence-based duplex MIRA assay utilizes FAM- and ROX-labeled probes, allowing the reaction time to be further reduced to 20 min under constant conditions at 39 °C. Both duplex MIRA assays demonstrated high specificity. The duplex MIRA-qPCR assay facilitated the rapid and intuitive differentiation of NGAstV and GoCV infections via fluorescence imaging. The minimum detectable concentrations for NGAstV and GoCV in the duplex MIRA-qPCR assay were 1 × 101 copies/µL and 1 × 102 copies/µL, respectively, representing a tenfold increase in sensitivity compared to the basic duplex MIRA assay.
In testing 50 clinical samples, both duplex MIRA assays showed identical positive detection rates, and the co-infection rate of NGAstV and GoCV was 18.0%. This method has better sensitivity than the conventional PCR. In recent years, these two pathogens have caused significant harm [13, 29, 30]. The ability to distinguish between single and mixed infections in a single reaction significantly reduces the time and cost of diagnosis compared to running separate tests. Although the sample size in this study was limited by temporal and environmental constraints, the results highlight the method’s potential as a robust surveillance tool. Future studies will validate the detection method with more clinical samples.
Conclusion
Novel duplex MIRA assays serving as a powerful molecular tool for the concurrent identification of NGAstV and GoCV were successfully established in this study. The assays demonstrated superior performance, characterized by high specificity, sensitivity, and the ability to visually distinguish infection types via specific fluorescence signals. Crucially, the simplicity and speed of this method addressed the urgent need for on-site testing capabilities in the poultry. The duplex MIRA assays provided crucial technical support for the early accurate diagnosis and epidemic monitoring of NGAstV and GoCV, thereby contributing to the healthy development of the goose farming industry.
Materials and methods
Viruses and clinical samples
NGAstV, GoCV, goose parvovirus (GPV), duck Tembusu virus (DTMUV), H9 subtype avian influenza virus (AIV-H9), duck enteritis virus (DEV), fowl adenovirus serotype 4 (FAdV-4), and Muscovy duck reovirus (MDRV) were all stored in our laboratory. From January to June 2025, clinical samples including liver, kidney, spleen, and other tissues were collected from dead geese suspected of NGAstV or GoCV infection. These samples were submitted by various waterfowl farms across Anhui Province.
Primer and probe design and synthesis
To identify optimal diagnostic targets for NGAstV and GoCV, multiple viral sequences were aligned and analyzed using EditSeq in DNAstar and MegAlign software. Based on the analysis, MIRA primer pairs and probes were designed targeting the conserved nucleotide region of the NGAstV ORF1b gene (GenBank accession no. OM273303.1) and the highly conserved Rep gene of GoCV (GenBank accession no. MG649068.1). All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed information is provided in Table 2.
Table 2.
Sequences of the primers and probes
| Primer/probe | Primer sequences (5’-3’) | Products(bp) |
|---|---|---|
| NGAstV-F | TCTGGCGGATACGACAGATGCGTTACTT | 258 |
| NGAstV-R | TCGGCAATGACCCATGCTGTTTCCAATA | |
| GoCV-F | GATAACTGACGTGGCCCGGAAGTAC | 389 |
| GoCV-R | TATACCAATCACGCGGCTCCCTATT | |
| NGAstV-P |
ACACCACAGCTTAAGAAACTCTATGATTGGTA[FAM-dT][THF] [BHQ1-dT]TAAAAACCTAGTTGA-[C3spacer] |
|
| GoCV-P |
GGTTGCGTCAGCTGATCGTGGAGACCGC[ROX-dT]c[THF] [BHQ2-dT]GATTGGAAGACGGA-[C3spacer] |
Nucleic acid extraction
Viral nucleic acids were extracted using a commercial viral DNA/RNA co-extraction kit (Tiangen Bio-Tech, Beijing, China). The obtained RNA were reverse transcribed into cDNA using a commercial first-strand cDNA synthesis kit (Takara Biotechnology, Dalian, China). All nucleic acid extracts were stored at − 80 °C.
Preparation of standard plasmids
The target gene sequences of NGAstV and GoCV were synthesized and cloned into the pUC57 vector by Sangon Biotech Co., Ltd. (Shanghai, China), resulting in the recombinant plasmids pUC57-NGAstV and pUC57-GoCV. These standard plasmids were stored at − 20 °C for future use.
Establishment of the duplex MIRA assays
The duplex MIRA and duplex MIRA-qPCR detection were respectively performed using the basic DNA isothermal rapid amplification Kit and the fluorescent DNA isothermal rapid amplification Kit (Weifang Ampou-Future Biotechnology Co., LTD., Shandong, China). The specific steps of the experiment should be carried out in accordance with the instructions. Duplex MIRA (50 µL) contained 29.4 µL Buffer A, 1 µL each primer (10 µM), 2.5 µL DNA template, 9.1 µL ddH2O, and 2.5 µL Buffer B. Reactions were incubated at 35 °C for 35 min, heated at 56 °C for 5 min, and 4 µL was analyzed by 2% agarose gel electrophoresis. The fluorescence system (50 µL) contained 29.4 µL Buffer A, 1 µL each primer (10 µM), 0.3 µL each probe (10 µM), 2.5 µL DNA template, 8.5 µL ddH2O, and 2.5 µL Buffer B. The reaction mixture of MIRA-qPCR were incubated at 39 °C for 20 min in a real-time fluorescence detection instrument, with fluorescence signals recorded every 30 s. Upon completion of the reaction, fluorescence signals, amplification curves, and fluorescence imaging results were analyzed to assess the feasibility of the selected primer pairs and probes. To minimize the risk of contamination, the detection process should be carried out swiftly, followed by immediate disinfection of the ambient air.
Optimum reaction temperature and time for the basic duplex MIRA assay
To determine the effective reaction conditions, the basic duplex MIRA assay was evaluated at various reaction temperatures (15, 20, 25, 30, 35, and 40 °C) and durations (15, 20, 25, 30, and 35 min). The effects of these parameters on amplification efficiency were analyzed.
Specificity evaluation of the two MIRA assays
The specificity of both the basic duplex MIRA assay and the duplex MIRA-qPCR assay was assessed using nucleic acids from AIV-H9, FAdV-4, DEV, MDRV, DTMUV, and GPV as templates. In the assay, samples of each concentration were repeatedly tested three times, and ddH2O was set as a negative control.
Sensitivity evaluation of the two MIRA assays
Standard plasmids pUC57-NGAstV and pUC57-GoCV were serially 10-fold diluted with ddH2O generating plasmid mixtures with concentrations ranging from 1 × 109 copies/µL to 1 × 101 copies/µL. ddH2O was used as a negative control, and three repeated experiments were carried out. These dilutions were used as the templates to evaluate sensitivity of the basic duplex MIRA and duplex MIRA-qPCR assays, and to determine the minimum detection limits of both methods.
Clinical sample analysis
A total of 50 clinical samples were tested using the basic duplex MIRA assay, the duplex MIRA-qPCR assay, and conventional PCR [9, 31]. The positive detection rates of NGAstV and GoCV nucleic acids were compared across the three methods. Positive amplification products were submitted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and analysis to confirm the results.
Supplementary Information
Acknowledgements
We thank Home for Researchers editorial team (www.home-for-researchers.com) for language editing service.
AuthorS"left" contributions
X.H. and H.Q.Z. wrote the main manuscript text. F.F.C., J.R.W. and D.D.Y. prepared Figs. 1, 2, 3 and 4. L.Y., X.H.S., Y.Y. L., L.Y.C. and X.C.P. performed software, formal Analysis, visualization. L.Z.X., R.H.Z. and Y.D. contributed to resources, fund qcquisition. All authors reviewed the manuscript.
Funding
This study was supported financially by the Major Science and Technology Special Project in Anhui Province (no. 202003a06020012), the Anhui Province Poultry Industry Technology System (no. AHCYJSTX-06), the Chuzhou Field Comprehensive Scientific Observation Station of the Ministry of Agriculture and Rural Affairs (No. MARA-ORS046-AH007 and 2026YL084), the Scientific Research Project of Anhui Academy of Agricultural Sciences (No.2026YL037).
Data availability
Data available on request from the authors.
Declarations
Ethics approval and consent to participate
The study was approved by the Institutional Animal Care and Use Committee of the Institute of Animal Husbandry and Veterinary Science, Anhui Academy of Agricultural Sciences (Permit No: AAAS-IAHVS-Po-2025-0099), in accordance with the requirements of laboratory animal—Guideline for ethical review of animal welfare(National Standards of the People’s Republic of China, GB/T35892-2018). And informed consent was obtained from the farmers who provided the clinical samples.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Xiaomiao Hu and Huiqin Zhou contributed equally to this work.
Contributor Information
Lunzhi Xia, Email: 939904965@qq.com.
Ruihong Zhao, Email: zrhkdy03@126.com.
Yin Dai, Email: daiyin2020@163.com.
References
- 1.Zhu Q, Sun D. Goose Astrovirus in China: A Comprehensive Review. Viruses. 2022;14(8):1759. [DOI] [PMC free article] [PubMed]
- 2.Zhu Q, Miao Y, Wang J, Bai W, Yang X, Yu S, et al. Isolation, identification, and pathogenicity of a goose astrovirus causing fatal gout in goslings. Vet Microbiol. 2022;274:109570. [DOI] [PubMed] [Google Scholar]
- 3.Xu L, Jiang B, Cheng Y, He Y, Wu Z, Wang M, et al. Infection and innate immune mechanism of goose astrovirus. Front Microbiol. 2023;14:1121763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Zhang X, Ren D, Li T, Zhou H, Liu X, Wang X, et al. An emerging novel goose astrovirus associated with gosling gout disease, China. Emerg Microbes Infect. 2018;7(1):152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yin D, Tian J, Yang J, Tang Y, Diao Y. Pathogenicity of novel goose-origin astrovirus causing gout in goslings. BMC Vet Res. 2021;17(1):40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang AP, Zhang S, Xie J, Gu LL, Wu S, Wu Z, et al. Isolation and characterization of a goose astrovirus 1 strain causing fatal gout in goslings, China. Poult Sci. 2021;100(11):101432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Guo J, Tian J, Tan X, Yu H, Ding S, Sun H, Yu X. Pathological observations of an experimental infection of geese with goose circovirus. Avian Pathol. 2011;40(1):55–61. [DOI] [PubMed] [Google Scholar]
- 8.Siedlecka M, Chmielewska-Władyka M, Kublicka A, Wieliczko A, Matczuk AK. Goose parvovirus, goose hemorrhagic polyomavirus and goose circovirus infections are prevalent in commercial geese flocks in Poland and contribute to overall health and production outcomes: a two-year observational study. BMC Vet Res. 2025;21(1):216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Niu X, Wang H, Wei L, Zhang M, Yang J, Chen H, et al. Epidemiological investigation of H9 avian influenza virus, Newcastle disease virus, Tembusu virus, goose parvovirus and goose circovirus infection of geese in China. Transbound Emerg Dis. 2018;65(2):e304–16. [DOI] [PubMed] [Google Scholar]
- 10.Scott AN, Beckett A, Smyth JA, Ball NW, Palya V, Todd D. Serological diagnosis of goose circovirus infections. Avian Pathol. 2006;35(6):495–9. [DOI] [PubMed] [Google Scholar]
- 11.Wang A, Liu F, Chen S, Wang M, Jia R, Zhu D, et al. Transcriptome Analysis and Identification of Differentially Expressed Transcripts of Immune-Related Genes in Spleen of Gosling and Adult Goose. Int J Mol Sci. 2015;16(9):22904–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yu J, Zou J, Liu X, Pan Y, Mu Y, Li S, et al. TaqMan-probe-based multiplex real-time RT-qPCR for simultaneous detection of GoAstV, GPV, and GoCV. Poult Sci. 2023;102(2):102396. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Li M, Wang M, Wang J, Li H, Wang Q, Yan G, Huang Z. Development and validation of a quadruplex qPCR assay for simultaneous detection of GPV, GoCV, TMUV, and GAstV-Ⅱ in geese. Sci Rep. 2025;16(1):3992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Heng P, Liu J, Song Z, Wu C, Yu X, He Y. Rapid detection of Staphylococcus aureus using a novel multienzyme isothermal rapid amplification technique. Front Microbiol. 2022;13:1027785. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hu WW, He JW, Guo SL, Li J. Development and evaluation of a rapid and sensitive multienzyme isothermal rapid amplification with a lateral flow dipstick assay for detection of Acinetobacter baumannii in spiked blood specimens. Front Cell Infect Microbiol. 2022;12:1010201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Dai Y, Zhong Y, Xu F, Gu S, Zhou H, Wang J, et al. Development and evaluation of three multienzyme isothermal rapid amplification assays for fowl adenovirus serotype 4. Poult Sci. 2024;103(12):104452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Xu S, Mu X, Xu X, Ji J, Wang Y, Yao L, et al. First report of goose circovirus identified in ducks from China. Poult Sci. 2024;103(8):103936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yao Z, Xue W, Chen J, Wang C, Lin Y, Wang J, et al. Culture breakthrough enables goose circovirus (GoCV) isolation and pathogenic gosling modeling to uncover the association between viral infection and vaccine failure. Virulence. 2025;16(1):2580148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Wan C, Chen C, Cheng L, Fu G, Shi S, Liu R, et al. Specific detection of the novel goose astrovirus using a TaqMan real-time RT-PCR technology. Microb Pathog. 2019;137:103766. [DOI] [PubMed] [Google Scholar]
- 20.Yang KK, Yin DD, Xu L, Liang YQ, Tu J, Song XJ, et al. A TaqMan-based quantitative real-time PCR assay for identification of the goose circovirus. Mol Cell Probes. 2020;52:101564. [DOI] [PubMed] [Google Scholar]
- 21.He D, Yang J, Jiang X, Lin Y, Chen H, Tang Y, Diao Y. A quantitative loop-mediated isothermal amplification assay for detecting a novel goose astrovirus. Poult Sci. 2020;99(12):6586–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Liu MH, Guo X, Sun ML, Li JL, Liu SH, Chen YZ, et al. Rapid detection of human cytomegalovirus by multienzyme isothermal rapid amplification and lateral flow dipsticks. Front Cell Infect Microbiol. 2024;14:1430302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Cui H, Xu S, Xu X, Ji J, Kan Y, Yao L, et al. Multienzyme isothermal rapid amplification and lateral flow dipstick combination assay for visible detection of chicken chaphamaparvovirus. Poult Sci. 2023;102(12):103144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Bai Z, Zhang Y, Li C, Han J, Wu T, Wang C, et al. A portable microfluidic platform for on-site detection of Aeromonas hydrophila in aquaculture water using multi-enzyme isothermal rapid amplification. J Hazard Mater. 2026;501:140677. [DOI] [PubMed] [Google Scholar]
- 25.Chai J, Zhang Y, Xie Y, Xu Z, Liu A, Yang Y, et al. Molecular authentication of Gekko gecko using multienzyme isothermal rapid amplification technology. Anal Chim Acta. 2026;1384:344933. [DOI] [PubMed] [Google Scholar]
- 26.Tan Z, Zhai H, Sun R, Sun Z, Xie R, Zhang L, et al. Complete genome sequence and phylogenetic analysis of a goose astrovirus isolate in China. Braz J Microbiol. 2023;54(1):427–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Stenzel T, Dziewulska D, Muhire BM, Hartnady P, Kraberger S, Martin DP, Varsani A. Recombinant Goose Circoviruses Circulating in Domesticated and Wild Geese in Poland. Viruses. 2018;10(3):107. [DOI] [PMC free article] [PubMed]
- 28.Li Y, Luo J, Zhang F, Shang J, Deng C, Feng Y, et al. Establishment and application of quadruple fluorescence quantitative RT-PCR method for the identification of waterfowl astrovirus. Front Microbiol. 2024;15:1328243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yang F, Liu Z, Ye J, Xie Q, Wu C, Jiang C, et al. Loop-mediated isothermal amplification combined with a Pyrococcus furiosus argonaute system for the rapid detection of goose astrovirus. Poult Sci. 2026;105(3):106397. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Chen J, Wang H, Pei H, Wang J, Wu H, Zhong J, et al. The Prevalence, Coinfection, and Evolutionary and Molecular Characteristics of Prevalent Goose Circovirus in Guangdong, China. Avian Dis. 2021;65(4):559–71. [DOI] [PubMed] [Google Scholar]
- 31.Xu J, Gao L, Zhu P, Chen S, Chen Z, Yan Z, et al. Isolation, identification, and pathogenicity analysis of newly emerging gosling astrovirus in South China. Front Microbiol. 2023;14:1112245. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data available on request from the authors.