Weissella cibaria-derived dextran alleviates cisplatin-induced kidney injury by remodeling the gut microbiota

Abstract

Background

Cisplatin, a first-line chemotherapeutic agent, is severely limited by its dose-limiting nephrotoxicity. The gut-kidney axis has emerged as a critical pathway, where cisplatin-induced intestinal injury aggravates renal damage. While exopolysaccharides (EPS) from probiotics are known for health benefits, their role against cisplatin toxicity is unclear. This study aimed to investigate the protective effects and mechanisms of EPS-2, a dextran from Weissella cibaria MW030, against cisplatin-induced acute kidney injury.

Results

Pretreatment with EPS‑2 significantly alleviated renal histopathological damage, apoptosis, oxidative stress, and inflammation, while also restoring intestinal barrier integrity by enhancing mucin and tight junction protein expression. Gut microbiota analysis indicated that EPS‑2 enriched short-chain fatty acids (SCFAs)‑producing bacteria such as unclassified_f_Muribaculaceae and suppressed LPS‑producing potential pathogens including Escherichia‑Shigella. These compositional changes were accompanied by elevated fecal SCFA levels and reduced circulating LPS, which may collectively contribute to the mitigation of renal injury. Notably, these protective effects were abolished in pseudo‑germ‑free mice, underscoring the critical role of the gut microbiota in the action of EPS‑2.

Conclusions

EPS-2 has the potential to be a promising postbiotic for preventing cisplatin-induced AKI, intestinal barrier dysfunction, and gut microbiota dysbiosis.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12866-026-05374-0.

Introduction

Cisplatin is a cornerstone chemotherapeutic agent with broad clinical utility, demonstrating efficacy against a range of malignancies. However, its clinical application is significantly constrained by substantial toxicities, particularly dose-limiting nephrotoxicity [1, 2]. Cisplatin-induced acute kidney injury (AKI) is characterized by a rapid decline in renal function, often triggering a cascade of systemic complications that can become life-threatening in severe cases [3]. The pathogenesis of cisplatin-induced renal injury is multifactorial, with oxidative stress serving as a central player. Cisplatin accumulates within mitochondria, causing mitochondrial dysfunction and reactive oxygen species (ROS) generation. The accumulated ROS not only induces direct macromolecular damage but also acts as a signaling molecule that stimulates inflammatory and apoptotic processes, thereby amplifying renal injury [4–6]. Therefore, exploration for therapeutic approaches that can effectively attenuate renal damage is needed.

Emerging evidence underscores the importance of the gut microenvironment in modulating the organ toxicity of chemotherapeutic agents [7, 8]. Beyond its direct renal effects, cisplatin also disrupts gut homeostasis, creating a bidirectional pathological interplay that exacerbates both intestinal and renal injury [9–11]. This disruption compromises intestinal barrier integrity, facilitating the translocation of gut‑derived endotoxins (e.g., LPS) into systemic circulation and inducing endotoxemia. Systemic endotoxemia, in turn, promotes inflammation and oxidative stress in distant organs, including the kidneys [7]. Cisplatin also can alter gut microbiota metabolism, reducing the production of anti‑inflammatory metabolites such as short‑chain fatty acids (SCFAs), which further aggravates inflammatory and oxidative stress responses [12–14]. Consequently, targeting the gut microenvironment has emerged as a promising therapeutic strategy for alleviating cisplatin‑associated AKI.

Exopolysaccharides (EPS), polysaccharides secreted by microorganisms, exhibit diverse biological functions, including modulation of gut microbiota, enhancement of intestinal barrier function, and anti-inflammatory and antioxidant effects [7, 15, 16]. These properties have attracted increasing interest for their potential therapeutic applications in various diseases. However, the role of EPS in mitigating cisplatin-induced kidney injury remains limited. An acidic heteropolysaccharide (EPS22) from Klebsiella sp. has been reported to attenuate cisplatin-induced nephrotoxicity, but whether its protective effect involves gut microbiota modulation was not investigated [17]. Weissella cibaria, a lactic acid bacterium known for high EPS production, has shown promise as a source of bioactive EPS [18]. Although the probiotic activities of its EPS are not yet fully characterized, recent reports suggest its potential as a postbiotic to modulate host health [7, 19–21]. Notably, the application of EPS derived from W. cibaria in counteracting cisplatin-induced intestinal and renal damage has not been previously reported. In our earlier work, we isolated W. cibaria MW030 from the feces of healthy infants and demonstrated that it produces a novel high-purity dextran (EPS-2, 989% ± 0.08 purity) composed of α-(1→6) and α-(1→3,6) glycosidic linkages with a molecular weight of 845 kDa [19]. Furthermore, EPS-2 has been shown to reduce the abundance of LPS-producing bacteria (primarily Escherichia-Shigella), strengthened intestinal barrier integrity, prevented LPS translocation, lowered endotoxemia in doxorubicin‑treated mice, and ameliorated doxorubicin‑induced cardiac injury [7].

In this study, we aimed to investigate whether EPS-2 could protect against cisplatin-induced acute kidney injury by modulating the gut microenvironment. Our findings confirm that EPS-2 alleviates cisplatin-induced disturbances in the gut bacteria and barrier function, elevates SCFA levels, and reduces systemic LPS. These changes collectively attenuate renal inflammation and oxidative stress following cisplatin exposure.

Materials and methods

Bacterial cultivation, EPS-2 fermentation, and extraction

Weissella cibaria ZMC030 was cultivated, and EPS-2 was fermented, extracted, and purified following our previously established protocols [20, 21].

Animal studies

Male C57BL/6 mice (6–8 weeks old) were purchased from Beijing Sibeifu Experimental Animal Co., Ltd. These mice were housed under standard specific pathogen-free (SPF) conditions with a 12-hour light/dark cycle at 23 ± 1 °C and provided free access to food and water. Animal experimental procedures were reviewed and approved by the Animal Care and Use Committee of Zhengzhou University(ZZU-LAC20231222[14]).

To establish the cisplatin-induced AKI model, mice were randomly divided into three groups: negative control (NC), cisplatin (Cis), and EPS/Cis. Mice in the NC and Cis groups received saline via oral gavage, while the EPS/Cis group received EPS-2 (100 mg/kg) orally once daily for seven consecutive days as pretreatment. On day 7, the Cis and EPS/Cis groups received a single intraperitoneal injection of cisplatin (10 mg/kg, dissolved in saline), whereas the NC group received saline. Body weights were monitored daily. At 72 h post-cisplatin injection, mice were anesthetized by inhaling an overdose of isoflurane, and then they were euthanized by cervical dislocation. Kidneys were harvested and weighed. The entire small intestine and colon was measured for length.

For antibiotic treatment, Mice were treated with antibiotics (1 g/L ampicillin trihydrate, 5 g/L streptomycin sulfate, 1 g/L colistin sulfate, and 0.25 g/L vancomycin) in drinking water until the end of the experiment. After 2 weeks of antibiotic treatment, cisplatin and EPS-2 was administered according to the method described above.

Assessment of renal function

Serum urea nitrogen (BUN) and creatinine levels were quantified using enzymatic assays (UV-glutamate dehydrogenase and creatine oxidase methods, respectively) with commercial kits according to the manufacturer’s protocols.

Histopathological analysis of renal and intestinal tissues

For intestinal examination, segments (approximately 0.5–1 cm) from the distal ileum and colon were fixed in 4% paraformaldehyde, processed through dehydration, and embedded in paraffin. Tissue sections were stained with hematoxylin and eosin (H&E) for general morphology and with Alcian Blue (AB) for detection of mucins and goblet cells.

Renal tissues were fixed in 4% formaldehyde and similarly embedded in paraffin. Consecutive Sect. (4 μm thickness) were stained with hematoxylin and eosin (H&E), Masson trichrome, and periodic acid–Schiff (PAS). Renal histopathological injury was evaluated in H&E-stained sections by a pathologist blinded to the experimental groups. Tubular injury (including tubular dilation, cast formation, loss of brush border, epithelial cell necrosis, and vacuolization) was assessed in the corticomedullary region and scored using a semi-quantitative 0–4 scale based on the percentage of affected tubules, as described in previous report [22].

Analysis of oxidative stress and antioxidant markers

Malondialdehyde (MDA) levels in renal tissues were measured using the thiobarbituric acid (TBA) method. The activity of superoxide dismutase (SOD) was determined by the hydroxylamine method, and glutathione peroxidase 4 (GPX4) activity was assessed with a commercial GPX4 assay kit. The reduced-to-oxidized glutathione (GSH/GSSG) ratio was quantified using a dedicated assay kit, following the respective manufacturer’s protocols.

Enzyme-Linked Immunosorbent Assay (ELISA)

Kidney tissues were homogenized in pre-chilled phosphate-buffered saline using a cryogenic grinder. The homogenates were centrifuged at 12,000 × g for 15 min at 4 °C, and the supernatants were collected as tissue lysates. The protein concentration of each lysate was determined using a bicinchoninic acid (BCA) protein assay kit. Levels of TNF-α, IFN-γ, IL-10, IL-1β, LPS, and ROS in both serum samples and kidney tissue lysates were quantified using specific ELISA kits according to the manufacturer’s instructions. Absorbance was measured at 450 nm on a microplate reader (Bio-Rad).

Immunohistochemistry

Paraffin-embedded renal tissue Sect.  (4 μm) were deparaffinized, rehydrated, and subjected to antigen retrieval. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide. Sections were blocked with normal serum and then incubated overnight at 4 °C with primary antibodies against Kim-1, GPX4, or SOD. After washing, the sections were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Immunoreactivity was visualized using a 3,3′-diaminobenzidine (DAB) substrate, and sections were counterstained with hematoxylin. Specificity controls included omission of the primary antibody and preabsorption with excess antigen. Stained sections were examined under a light microscope, and the average and integrated optical densities of positive signals were quantified using ImageJ software.

Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted from colon and ileum tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed into cDNA using HiScript III RT SuperMix (Vazyme, Nanjing, China). Quantitative PCR was performed using SYBR Green qPCR master mix on a real-time PCR system. The housekeeping gene Gapdh was used as an internal control to normalize the expression of target genes. The sequences of primers are followed: IL-6-F GAGGATACCACTCCCAACAGACC, IL-6-R AAGTGCATCATCGTTGTTCATACA; IL-1β-F GCCACCTTTTGACAGTGATGAG, IL-1β-R ATGTGCTGCTGCGAGATTTG, GAPDH-F: AGGTCGGTGTGAACGGATTTG, GAPDH-R: TGTAGACCATGTAGTTGAGGTCA. Mean relative gene expression was calculated using the 2^−ΔΔCt formula.

Fecal 16 S rDNA sequencing and SCFA-targeted metabolome

To profile the gut microbiota, total genomic DNA was extracted from feces. The V3–V4 hypervariable regions of the bacterial 16 S rRNA gene were amplified and sequenced on the NovaSeq 6000 platform (Illumina) by OE Biotech Co., Ltd. (Shanghai, China). Raw reads were processed to generate amplicon sequence variants (ASVs), which were taxonomically annotated using a reference database. Fecal SCFA concentrations were further analyzed via UPLC-MS (Shanghai Lu-Ming Biotech Co., Ltd.).

Statistical analysis

Data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 8.0. Differences between two groups were assessed using two-tailed unpaired Student’s *t*-tests. For comparisons among three or more groups, one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was applied. A p-value < 0.05 was considered statistically significant.

Results

EPS-2 ameliorates cisplatin-induced acute kidney injury in mice

To investigate the effect of EPS-2 on cisplatin-induced acute kidney injury (AKI), mice were administered EPS-2 followed by cisplatin. Cisplatin significantly reduced body weight, while these changes were reversed by EPS-2 (Fig. 1A). Furthermore, cisplatin induced significant elevated BUN and creatinine levels in serum of mice. While, EPS-2 administration substantially reduced serum BUN and creatinine content in cisplatin-challenged mice, indicating EPS-2 significantly improved cisplatin-induced renal dysfunction of mice (Fig. 1B-C). H&E and PAS staining revealed extensive injury in the proximal tubules of cisplatin-treated mice compared with that in NC group. In contrast, the kidneys of AKI mice treated with EPS-2 exhibited relatively normal morphology with reduced tubular injury (Fig. 1D-G). Additionally, Masson staining revealed that EPS-2 notably alleviated collagen deposition in renal tissue of mice treated with cisplatin (Fig. 1H-I). The protein expression of specific biomarkers of AKI, such as Kidney injury molecule-1 (Kim-1), were markedly decreased in AKI mice treated with EPS-2 (Fig. 1J-K). TUNEL staining results revealed that cisplatin induced increased renal cell apoptosis in mice, which was alleviated by EPS-2 treatment (Fig. 1L-M). Collectively, these findings indicate that EPS-2 protects against cisplatin-induced AKI.

Fig. 1.

EPS-2 ameliorates cisplatin-induced AKI in mice. A The change of body weight. B BUN levels in serum of mice. C Creatinine levels in serum of mice. D-E H&E staining of kidney; scale bar: 100 μm (magnification, ×20). F-G PAS staining of kidney; scale bar: 100 μm (magnification, ×20). H-I Masson staining of kidney; scale bar: 100 μm (magnification, ×20). J-K Immunohistochemistry results of KIM-1 in kidney; scale bar: 100 μm (magnification, ×20). L-M TUNEL staining of kidney; scale bar: 50 μm (magnification, ×40). Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. For body weight, BUN, and creatinine, n = 6 per group. For H&E, PAS, Masson, KlM-1, and TUNEL, n = 3 per group. * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

EPS-2 alleviates cisplatin-induced renal oxidative stress

Oxidative stress is critical pathological processes involved in AKI. Therefore, we investigated whether EPS-2 protects against AKI by mitigating oxidative stress. As shown in Fig. 2A-B, cisplatin treatment led to a marked increase in the levels of reactive oxygen species (ROS) in serum and renal tissues compared with normal mice. In contrast, administration of EPS-2 significantly lowered ROS in AKI mice. Additionally, EPS-2 treatment decreased malondialdehyde (MDA) levels in renal tissues of cisplatin induced mice (Fig. 2C). The GSH/GSSG ratio serves as a key indicator of intracellular redox homeostasis. We observed that cisplatin caused a notable reduction in the renal GSH/GSSG ratio, whereas EPS-2 treatment effectively reversed this decline in AKI mice (Fig. 2D). Collectively, these findings demonstrate that cisplatin induces oxidative stress in renal tissues, and that EPS-2 alleviates cisplatin ‑induced oxidative imbalance.

Fig. 2.

EPS-2 alleviates cisplatin-induced oxidative stress. A ROS levels in serum of mice. B ROS levels in kidney of mice. C MDA levels in kidney of mice. D GSH/GSSG ratio in kidney of mice. E SOD activity in kidney of mice. F GPX4 activity in kidney of mice. G, I Immunohistochemistry results of SOD in kidney; scale bar: 100 μm (magnification, ×20). H, J Immunohistochemistry results of GPX4 in kidney; scale bar: 100 μm (magnification, ×20). Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. For ROS, MDA, GSH/GSSH Ratio, SOD activity and GPX4 activity, n = 6 per group. For Immunohistochemistry of SOD and GPX4, n = 3 per group. * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

We further assessed the activities of key antioxidant enzymes (SOD and GPX-4). The results showed that cisplatin treatment markedly decreased the enzymatic activities of both SOD and GPX-4 in renal tissues. This decline was significantly restored by EPS-2 administration (Fig. 2E-F). Immunohistochemical analysis confirmed that EPS-2 upregulated the protein expression levels of SOD and GPX-4 in the kidneys of cisplatin treated mice, indicating an enhancement of the antioxidant capacity (Fig. 2G-J).

The Keap1/Nrf2/HO-1 signaling pathway plays a pivotal role in maintaining oxidative stress homeostasis in tissues. Immunofluorescence staining revealed that cisplatin induced an increase in Keap1 expression and a concurrent decrease in Nrf2 expression. HO-1, a critical antioxidant protein downstream of Nrf2, also exhibited reduced expression following cisplatin treatment. In contrast, EPS-2 treatment effectively lowered Keap1 levels while elevating the expression of both Nrf2 and HO-1(Fig. 3A-F). Consistently, Western blot analysis confirmed that EPS-2 reduced Keap1 expression, elevated Nrf2 protein levels in both cytoplasmic and nuclear fractions, and upregulated HO-1 in the kidneys of cisplatin-challenged mice (Fig. 3G–J). Taken together, these findings demonstrate that EPS-2 enhances the renal antioxidant defense system and mitigates CP-induced oxidative stress.

Fig. 3.

EPS-2 modulates the Keap1/Nrf2/HO-1 pathway. A-B Immunofluorescence results of Keap1; scale bar: 50 μm (magnification, ×40). C-D Immunofluorescence results of Nrf2; scale bar: 50 μm (magnification, ×40). E-F Immunofluorescence results of HO-1; scale bar: 50 μm (magnification, ×40). G The expression level of Keap1. H The expression level of HO-1. I The expression level of cytoplasmic Nrf2. J The expression level of nuclear Nrf2. Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. N = 3 per group. * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

EPS-2 alleviates cisplatin-induced renal and systemic inflammatory responses

Oxidative stressors, such as ROS, can activate key inflammatory signaling pathways in cells, prompting the upregulation of various proinflammatory cytokines in renal tissues. To investigate the anti-inflammatory effect of EPS-2, we assessed the expression levels of representative inflammatory cytokines, including IFN-γ, TNF-α, IL-1β, and IL-10. The results demonstrated that EPS-2 treatment significantly attenuated the expression of proinflammatory cytokines (IFN-γ, TNF-α, and IL-1β) while upregulating the anti-inflammatory cytokine IL-10 in the kidneys (Fig. 4A-D). Notably, the serum levels of these inflammatory mediators exhibited consistent trends with their expression profiles in renal tissue (Fig. 4E-F). Immunofluorescence analysis revealed a significant increase in CD68⁺CD86⁺ M1 macrophages and a concomitant decrease in CD68⁺CD206⁺ M2 macrophages in the kidneys of cisplatin-treated mice. Notably, EPS-2 intervention effectively reversed this polarization imbalance (Fig. 4I), which likely serves as a key mechanism underlying its ability to attenuate renal inflammation and confer renal protection. Collectively, these results indicate that EPS-2 attenuates cisplatin-induced renal and systemic inflammatory responses.

Fig. 4.

EPS-2 alleviates cisplatin-induced inflammation. A-D IL-1β (A), IFN-γ (B), TNF-α (C) and IL-10 (D) levels in kidney of mice. E-H IL-1β (E), IFN-γ (F), TNF-α (G) and IL-10 (H) levels in serum of mice. I Immunofluorescence results of CD68⁺CD86⁺ M1 and CD68⁺CD206⁺ M2; scale bar: 50 μm (magnification, ×40). Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. For inflammatory cytokines, n = 6 per group. For immunofluorescence of M1 and M2, n = 3 per group. * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

EPS-2 improves intestinal barrier homeostasis in cisplatin-induced AKI mice

Cisplatin is also known to induce dysbiosis of gut ecosystem, including disruption of intestinal barrier integrity and disturbance of the gut microbiota, which critically contributes to its nephrotoxic effects [13]. EPS-2 have been shown to modulate the gut microbiota and preserve intestinal barrier function across various disease models [7, 19]. We therefore identified whether EPS-2 exerts its protective effect against cisplatin induced AKI by restoring the homeostasis of the gut ecosystem.

Elevated systemic lipopolysaccharide (LPS), a gut-derived endotoxin, typically reflects an increase in LPS-producing bacteria and a disruption of intestinal integrity. To assess this, we firstly measured LPS levels in the blood and kidney tissues. The results showed that cisplatin challenge induced a marked increase in LPS concentrations in both the serum and kidneys of mice, indicating concomitant disruption of the gut microbiota and intestinal barrier function. Treatment with EPS-2 significantly lowering LPS levels in the serum and kidneys of mice with AKI (Fig. 5A-B).

Fig. 5.

EPS-2 improves ileum barrier homeostasis. A LPS level in Serum. B LPS level in kidney. C-D Small intestinal length. E Transcriptional levels of IL-6 in ileum. F Transcriptional levels of IL-1β in ileum. G-H H&E staining of ileum; scale bar: 100 μm (magnification, ×20). I-J Alcian Blue staining of ileum; scale bar: 100 μm (magnification, ×20). K-L Immunofluorescence results of Occludin; scale bar: 50 μm (magnification, ×40). M-N Immunofluorescence results of ZO-1; scale bar: 50 μm (magnification, ×40). Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. For transcriptional analyses (IL-6, IL-1β), histological staining (H&E and Alcian Blue), and immunofluorescence (Occludin, ZO-1), n = 3 per group. * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

Next, we assessed the protective effects of EPS-2 on the small intestine barrier. Compared to healthy controls, cisplatin-treated mice showed a significant reduction in small intestinal length. EPS-2 intervention markedly attenuated these changes, effectively restoring intestinal length (Fig. 5C-D). Analysis of the transcriptional levels of IL-6 and IL-1β revealed that EPS-2 treatment reduced their mRNA expression in the ileum of AKI mice, indicating that EPS-2 alleviated the inflammatory response in the ileum (Fig. 5E-F).

Histopathological examination via H&E staining revealed severe structural disruption in the ileum of CP-treated mice, characterized by disorganized villi and crypts. EPS-2 treatment substantially mitigated these injuries (Fig. 5G-H). Alcian blue staining detects the number of goblet cells and the level of mucin secretion. As shown in Fig. 5I-J, cisplatin challenge reduced the number of goblet cells and impaired mucin secretion in the ileum. EPS-2 treatment mitigated these alterations, demonstrating its protective effect on intestinal mucus barrier function. Tight junction proteins are essential for maintaining the integrity and barrier function of the intestinal epithelium. We observed that cisplatin decreased the expression of the tight junction proteins ZO-1 and Occludin in the ileum. EPS-2 intervention increased the expression of ZO-1 and Occludin, thereby protecting the ileal epithelial barrier. (Fig. 5K-N).

We also evaluated the protective effect of EPS-2 on the colonic barrier in cisplatin-treated mice. We found that EPS-2 increased colon length and reduced the transcriptional levels of IL-6 and IL-1β. Furthermore, EPS-2 ameliorated cisplatin-induced structural damage in the colon, increased the number of goblet cells, and elevated the expression levels of the ZO-1 and Occludin (Fig. 6). Collectively, these results demonstrated that EPS-2 alleviates cisplatin induced intestinal barrier dysfunction, promotes the restoration of barrier integrity, and consequently reduces the translocation of LPS to the kidney. This mechanism may contribute significantly to the attenuation of renal injury by EPS-2.

Fig. 6.

EPS-2 improves colon barrier homeostasis. A-B Colon length. C Transcriptional levels of IL-6 in ileum. D Transcriptional levels of IL-1β in ileum. E-F H&E staining of ileum; scale bar: 100 μm (magnification, ×20). G-H Alcian Blue staining of ileum; scale bar: 100 μm (magnification, ×20). I-J Immunofluorescence results of Occludin; scale bar: 50 μm (magnification, ×40). K-L Immunofluorescence results of ZO-1; scale bar: 50 μm (magnification, ×40). Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. For colon length, n = 6 per group. For transcriptional analyses (IL-6, IL-1β), histological staining (H&E, Alcian Blue), and immunofluorescence (Occludin, ZO-1), n = 3 per group. * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

EPS-2 modulates the gut microbiota in AKI mice

We further analyzed the impact of EPS-2 on the gut microbiota in cisplatin-treated mice. To evaluate the effect of EPS-2 on microbial diversity in AKI mice, we analyzed the α-diversity indices of gut microbiota, including Chao, Shannon, and Simpson indices. However, no significant differences were observed between groups for α-diversity (Fig. 7A-C). β-diversity reflects intergroup differences in microbial community composition. Non-metric multidimensional scaling (NMDS) revealed a clear separation among the three groups (PERMANOVA, P = 0.001). The microbiota profile of cisplatin-challenged mice was distinctly separated from that of healthy controls, whereas EPS-2-treated mice clustered closer to the healthy group (Fig. 7D). This demonstrates that EPS-2 significantly altered the gut microbial composition in AKI mice, shifting it towards that of normal controls.

Fig. 7.

EPS-2 modulated the gut microbial diversity and gut microbial abundance at the phylum level in AKI mice. A-C α-diversity analysis of gut microbiota (D) β-diversity analysis of gut microbiota; (E) The relative abundance of bacteria at the phylum level; (F-H) Relative abundance of Bacteroidota (F), Proteobacteria (G), and Firmicutes (H). Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. N = 6 per group. * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

To further characterize these changes, we examined microbiota profiles at both the phylum and genus levels. At the phylum level, the microbial communities in all groups were dominated by Bacteroidota, Firmicutes, and Proteobacteria, although their relative abundances differed. Cisplatin treatment significantly reduced the abundance of Bacteroidota while markedly increasing that of Proteobacteria. EPS-2 intervention effectively reversed these changes by increasing the abundance of Bacteroidota and reducing the level of Proteobacteria in cisplatin-treated mice. No significant differences were observed in the relative abundances of Firmicutes among the groups (Fig. 7E-H).

At the genus level, cisplatin treatment led to a significant reduction in the abundance of unclassified_f_Muribaculaceae, Parasutterella, and Muribaculum. EPS-2 intervention elevated the levels of unclassified_f_Muribaculaceae and Parasutterella in AKI mice. However, it did not significantly restore the abundance of Muribaculum. (Fig. 8A-D). Furthermore, cisplatin treatment led to an increase in potentially pathogenic genera, including Escherichia-Shigella, Turicibacter, Prevotella, Helicobacter and Fusobacterium. Notably, EPS-2 treatment significantly reduced the levels of Escherichia-Shigella and Turicibacter in AKI mice. Although trends of reduction were observed for Prevotella, Helicobacter, and Fusobacterium, these changes did not reach statistical significance (Fig. 8E-I).

Fig. 8.

EPS-2 alters gut microbial abundance at the genus level. A The relative abundance of bacteria at the genus level; B-I Relative abundance of unclassified_f_Muribaculaceae (B), Parasutterella (C), Muribaculum (D), Escherichia-Shigella (E), Turicibacter (F), Prevotella (G), Helicobacter (H) Fusobacterium (I). J Analysis of the differences in gut microbiota by LEfSe (LDA score ≥ 3, p-value < 0.05); (K) Correlation analysis; (L) Analysis of the bacteria importance in gut microbiota using the random forest method. Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. N = 6 per group. ns: not significant; * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

Further analysis using linear discriminant analysis effect size identified harmful taxa, including Enterobacterales, Enterobacteriaceae, Proteobacteria, and Escherichia–Shigella, were enriched in AKI mice. In contrast, EpS-2 treatment enriched beneficial bacteria such as unclassified_f_Muribaculaceae, Bacteroidales, Allobaculum and Parasutterella (Fig. 8J).

Furthermore, pearson’s rank correlation analysis was performed to assess the relationships between genus-level abundance and renal injury indicators. The results revealed that the abundances of unclassified_f_Muribaculaceae exhibited a positive correlation with anti-inflammatory/antioxidant indicators (IL‑10 and the GSH/GSSG ratio), while showing a negatively correlated with levels of renal injury markers, oxidative stress, pro-inflammatory cytokines, and endotoxin LPS. Conversely, the abundances of Escherichia-Shigella showed a positive correlation with renal injury markers, oxidative stress, pro-inflammatory cytokines, and endotoxin LPS (Fig. 8K). In addition, to identify the key bacterial genera, the prominent discriminative features at the genus level were analyzed using the random forest method. The results revealed that Escherichia-Shigella and unclassified_f_Muribaculaceae ranked among the top four most influential genera (Fig. 8L). Taken together, these results indicate that EPS-2 ameliorates cisplatin-induced gut microbiota dysbiosis, likely through reducing the abundance of the LPS-producing bacterium Escherichia-Shigella while increasing that of the beneficial bacterium unclassified_f_Muribaculaceae, thereby contributing to its protective effects.

EPS-2 Modulates short-chain fatty acids levels in AKI mice

Unclassified_f_Muribaculaceae are key polysaccharide-fermenting bacteria that convert dietary polysaccharides into short-chain fatty acids (SCFAs), which exert beneficial effects in various disease. Thus, we further quantified the levels of SCFAs in mouse feces using targeted metabolomics. Cisplatin treatment significantly reduced fecal levels of acetic acid, propionic acid, butyric acid, pentanoic acid, isobutyric acid, and isovaleric acid. EPS-2 significantly elevated the levels of acetic acid, propionic acid, butyric acid, isobutyric acid, and isovaleric acid. The level of pentanoic acid was not significantly altered by EPS-2 treatment (Fig. 9A-F).

Fig. 9.

EPS-2 modulates SCFAs level in cisplatin-challenged mice. A-E The levels of acetic acid (A), propionic acid (B), butyric acid (C), pentanoic acid (D), isovaleric acid (E), and isobutyric acid (F). G Correlation analysis between the SCFAs and gut microbiota. H Correlation analysis between the SCFAs and renal injury markers. Statistical significance was analyzed using the one-way ANOVA followed by Tukey’s multiple comparison. Data are presented as mean + SEM. N = 5 per group. ns: not significant; * P-value < 0.05, ** P-value < 0.01, *** P-value < 0.001, **** P-value < 0.0001

Correlation analysis between SCFAs and gut microbiota revealed that the abundances of unclassified_f_Muribaculaceae and Muribaculum were positively correlated with the levels of SCFAs (Fig. 9G). We next examined the relationship between SCFAs and systemic injury markers. Acetic acid, propionic acid, butyric acid, isovaleric acid and isobutyric acid levels correlated positively with anti-inflammatory/antioxidant indicators (IL-10 and the GSH/GSSG ratio), while negatively correlated with renal injury markers, oxidative stress, pro-inflammatory cytokines, and endotoxin LPS (Fig. 9H). In summary, EPS-2 appears to mitigate cisplatin-induced damage by enhancing the production of beneficial SCFAs, which in turn is associated with improved anti-inflammatory and antioxidant capacity.

The kidney protective Effect of EPS-2 against cisplatin is dependent on the gut microbiota

To definitively confirm that the protective effects of EPS-2 depend on the gut microbiota, we employed a pseudo-germ-free mouse model. In these microbiota-depleted mice, EPS-2 administration failed to reduce the elevated levels of blood urea nitrogen (BUN), serum creatinine and pro-inflammatory cytokines induced by cisplatin challenge (Fig. 10A-F). Consistent with this functional assessment, EPS-2 did not attenuate the cisplatin-induced upregulation of KIM-1 or the increase in TUNEL-positive cells (Fig. 10G-J).

Fig. 10.

The protection of EPS-2 against cisplatin-induced AKI was dependent on gut bacteria. A BUN levels in serum of mice. B Creatinine levels in serum of mice. C ROS levels in kidney of mice. D-F IFN-γ (D), TNF-α (E) and IL-1β (F) levels in kidney of mice. G-H Immunohistochemistry results of KIM-1 in kidney; scale bar: 100 μm (magnification, ×20). I-J TUNEL staining of kidney; scale bar: 50 μm (magnification, ×40). Data are presented as mean ± SEM. For BUN, creatinine, ROS, IFN-γ, TNF-α, and IL-1β, n = 5 per group. For KIM-1 and TUNEL, n = 3 per group. Statistical significance was analyzed using two-tailed unpaired Student’s *t*-tests

Taken together, these results establish that the protective efficacy of EPS-2 against cisplatin-induced renal injury is abolished upon ablation of the gut microbiota. This provides direct evidence that the renal protective function of EPS-2 is dependent on the presence of an intact gut microbiota.

Discussion

Cisplatin initiates a detrimental crosstalk between the intestine and kidney. The present study identifies EPS-2, derived from Weissella cibaria MW030, targets the gut-kidney axis to disrupt this vicious cycle. We provide a comprehensive chain of evidence showing that EPS-2 restores gut microbiota composition and intestinal mucosal barrier integrity, increases the production of the microbial metabolite SCFAs, decreases serum LPS levels, and consequently mitigates renal oxidative stress, inflammation, and apoptosis. Most decisively, the abolition of EPS-2’s efficacy in microbiota-depleted mice confirms the fundamental dependence of its protective function on an intact gut microenvironment. It should be noted that this study exclusively employed a pretreatment protocol and therefore does not address whether EPS-2 can treat established kidney injury. Future work is needed to evaluate the effect of EPS-2 administration after cisplatin exposure.

It has been reported that various postbiotics exert renoprotection through gut microbiota modulation. These interventions commonly function by restoring microbial homeostasis, promoting beneficial metabolites, and suppressing detrimental pathways. Several postbiotic preparations have been reported to attenuate cisplatin-induced nephrotoxicity. Heat-killed Lactobacillus GKA4 and its derived postbiotic were shown to mitigate cisplatin-induced renal injury by reducing oxidative stress and modulating apoptosis, autophagy, endoplasmic reticulum stress, and transporter function [23]. The cell-free supernatant of fermented Citrobacter sp. alleviated cisplatin nephrotoxicity through antioxidant effects, and notably, this postbiotic exhibited greater efficacy than the live probiotic [24]. Butyrate, a gut microbiota-derived short-chain fatty acid, has been demonstrated to protect against cisplatin-induced kidney damage, potentially by restoring microbial homeostasis and exerting anti-inflammatory actions [9, 25]. Furthermore, the acidic heteropolysaccharide EPS22 from Klebsiella sp. was reported to attenuate renal injury by suppressing oxidative stress, inflammation, and apoptosis; however, the role of the gut microbiota was not examined in that study [17]. In the present study, the nephroprotective effect of EPS-2 was abolished in pseudo-germ-free mice, demonstrating that gut microbiota remodeling is a required step in its mechanism. This dependence on the gut microbiota distinguishes EPS-2 from the aforementioned postbiotics, many of which act through direct systemic effects or lack confirmed microbiota involvement. Thus, EPS-2 represents a postbiotic that functions primarily through the gut–kidney axis. Whether EPS from other beneficial bacteria can similarly attenuate cisplatin nephrotoxicity is not yet known. Given the substantial structural diversity among microbial EPS, including differences in monosaccharide composition, charge, molecular weight, and linkage types, their biological activities and mechanisms are likely to vary [26, 27]. Direct comparative studies with structurally defined EPS from different strains would be needed to determine whether the nephroprotective effect observed for EPS-2 is shared by other microbial polysaccharides.

Cisplatin-induced gut microbiota alterations observed in our study share a general pattern with previous reports—a reduction in SCFA-producing bacteria and an expansion of potentially pathogenic or LPS-producing bacteria. Prior studies have reported decreased Lactobacillus, Lachnospiraceae_NK4A136_group, and Roseburia, and increased Escherichia-Shigella, Citrobacter, Clostridium, and Desulfovibrio, with elevated fecal LPS [9, 11, 28, 29]. In our model, cisplatin reduced unclassified_f_Muribaculaceae, Muribaculum, and Parasutterella, while increasing Escherichia-Shigella, Turicibacter, Prevotella, Helicobacter and Fusobacterium. Although the affected genera differ among studies, the increase in Escherichia-Shigella is highly consistent, suggesting its potential role in cisplatin-induced intestinal inflammation and endotoxemia. The aberrant proliferation of Escherichia-Shigella (phylum Proteobacteria), as a primary producer of endotoxin lipopolysaccharide (LPS), serves as a sensitive marker of gut ecological imbalance, frequently associated with intestinal hypoxia, barrier disruption, and inflammatory states [30, 31]. Our prior studies in both ulcerative colitis and doxorubicin-induced intestinal damage models consistently demonstrated that EPS-2 reduces the abundance of Escherichia-Shigella and directly inhibits the growth of E. coli [7, 19]. Consistent with these findings, the current study also observed a decrease in intestinal Escherichia-Shigella levels following EPS-2 intervention in cisplatin-challenged mice. EPS-2 likely reduces its abundance through both direct inhibition of this pathobiont and indirect mechanisms involving barrier repair and improvement of the gut milieu. The reduction in Escherichia-Shigella directly translates to a decreased intestinal load of LPS, aligning with our observed decline in circulatory and renal LPS levels and the attenuation of systemic inflammation.

In a murine model of ulcerative colitis, we previously observed that EPS-2 intervention increased the abundance of unclassified_f_Muribaculaceae and elevated fecal propionic acid levels, contributing to the alleviation of colitis [19]. In the present study, EPS-2 pretreatment similarly enriched unclassified_f_Muribaculaceae and was accompanied by elevated SCFA levels, with which unclassified_f_Muribaculaceae abundance was positively correlated. Interestingly, in a separate model of doxorubicin-induced cardiotoxicity, EPS-2 failed to raise unclassified_f_Muribaculaceae levels [7], suggesting that the effect of EPS-2 on this bacterial group may be context-dependent. Muribaculaceae is a dominant SCFA-producing family in the murine gut, harboring a rich repertoire of polysaccharide-degrading enzymes that enable the utilization of both dietary and host-derived glycans for fermentation. This bacterial family harbors a rich repertoire of polysaccharide-degrading enzymes, enabling it to utilize host-derived mucin polysaccharides and exogenous dietary fibers as carbon sources. Through the fermentation of polysaccharides, Muribaculaceae produces SCFAs, which mediate its beneficial functions [32, 33]. Its abundance commonly declines in dysbiosis associated with intestinal and systemic disorders [19, 34]. Among the SCFAs elevated by EPS-2, butyric acid has been demonstrated to protect against cisplatin-induced kidney injury. Other SCFAs, including acetic acid, propionic acid and isobutyrric acid, have been shown to preserve intestinal barrier integrity and exert systemic anti-inflammatory effects, which may provide a plausible link for the remote renoprotection observed in this study. However, whether these other SCFAs directly attenuate cisplatin nephrotoxicity and the underlying mechanisms remain to be further investigated. It should be noted that the functional roles of specific bacterial taxa, particularly unclassified_f_Muribaculaceae, are inferred from published literature and 16 S rRNA gene profiling data. Direct functional annotation through metagenomic or PICRUSt-based functional prediction analyses would provide further mechanistic insights and warrants future investigation.

Conclusions

This study demonstrated that EPS-2 appears to operate through a dual-pronged mechanism: it promotes beneficial bacteria of Muribaculaceae, fostering the production of barrier-strengthening and systemically active SCFAs, while it suppresses pathogenic bacteria like Escherichia-Shigella, curbing the production and translocation of endotoxin LPS at its source. These two pathways act in concert to re-establish intestinal microenvironmental homeostasis, sever the gut-derived inflammatory signaling to the kidney, and ultimately alleviate cisplatin-induced renal injury.

Authors’ contributions

CK, SX, PW and ZH conceived and designed the study; CK, SY and RJ collected the data and carried out the statistical analyses; CK, Abbas Sakandar and HHB wrote the original draft; YP, ZH and PW reviewed and edited the article. All authors reviewed and approved the final manuscript.

Funding

This work was supported by National Natural Science Foundation of China (No. 82305344), Henan Province Key Science and Technology Project (262102311045), Medical Science and Technology Innovation Development Fund of Henan Central Plains (ZYYC2503201-10) and Scientific Research Foundation of Southwest Medical University (No.2023QN036).

Data availability

The 16 S rRNA sequence data reported in this paper have been deposited in the Genome Sequence Archive in National Genomics Data Center, China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA: CRA040572) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa .

Declarations

Ethics approval and consent to participate

All animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Research Council and were approved by the Animal Care and Use Committee of Zhengzhou University (ZZU-LAC20231222[14]).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.