Abstract
Background
Persistent infection with high-risk human papillomavirus (HR-HPV) is a key driver of cervical carcinogenesis. Human papillomavirus type 39 (HPV-39) infection is relatively prevalent in central China. However, data regarding the genetic variability of HPV-39 in this region remain limited.
Methods
To characterize the genetic variation of the HPV-39 E6 and E7 genes in central China, samples with single type HPV-39 infection were identified by HPV genotyping prior to amplification. The E6 and E7 genes were amplified by polymerase chain reaction (PCR), followed by Sanger sequencing. The obtained sequences were subjected to variation, phylogenetic, selective pressure, and T-cell epitope analyses.
Results
A total of 33 single nucleotide variants were identified in the E6 and E7 sequences, including 13 synonymous mutations and 20 non-synonymous mutations. Among which, six were novel non-synonymous mutations. Phylogenetic analysis based on HPV-39 E6 and E7 sequences demonstrated that most sequences (56/71) showed sequence similarity to lineage A. No positively selected site was detected in HPV-39 E6 or E7 genes. The predicted T-cell epitopes in the E6 sequence were influenced by non-conservative substitutions at positions H5Y, P7S, T19R, Q26H, E46D, A87G, L102S, and L151P; whereas those in the E7 sequence were affected by substitutions at positions L8V, D14H, D14E, H50Q, D57E, R87Q, Q88E, Q88D, L89V, Q91K, and F93C. A predicted candidate T-cell epitope spanning residues 70–78 (KFYAKIREL), restricted by HLA-C*06:02, was identified within the HPV-39 E6 sequence.
Conclusion
This study describes the genetic variations of HPV-39 E6 and E7 genes in central China and provides regional molecular epidemiological data on HPV-39 sequence diversity. The identified sequence variations may be useful for future studies investigating HPV-39 evolution and host immune interactions.
Keywords: Human papillomavirus type 39 (HPV-39), E6 gene, E7 gene, Genetic variation, T-cell epitope prediction
Background
Cervical cancer is one of the most common malignancies in women worldwide and ranks as the fourth leading malignancy among female [1]. According to GLOBOCAN 2022 statistics, there were 661,021 newly diagnosed cases and 348,189 deaths globally [2]. The highest burden of cervical cancer incidence and mortality occurs in Asia. Notably, China and India collectively account for about 42% of new global cases and 39% of global deaths attributable to cervical cancer [3]. With population growth and an increasing aging population in China, the national cancer burden has risen accordingly, and the incidence and mortality of cervical cancer continue to increase [4].
Human papillomaviruses (HPV) are small, non-enveloped, double-stranded DNA viruses, approximately 8k bp in length, belonging to the Papillomaviridae family. The virus genome is divided into three regions: the early transcription region, the late transcription region, and the long control region (LCR) or upstream regulatory region (URR). The early region encodes protein E1, E2, E4, E5, E6, and E7, which play key roles in viral replication, transcriptional regulation, and cellular transformation. The viral oncoproteins E6 and E7 are central to HPV-induced carcinogenesis [5]. E6 mediates p53 ubiquitination and degradation via E6AP (an E3 ubiquitin ligase), thereby inhibiting apoptosis and DNA repair, while also activating telomerase and disrupting cell polarity. E7 binds to the retinoblastoma protein (pRb), leading to the release of E2F transcription factors and promoting S-phase progression. Loss of pRb leads to unchecked cell division and genomic instability. In addition, E7 modulates DNA damage pathways to facilitate viral replication and contributes to epigenetic reprogramming [6, 7]. The synergism between E6 and E7 enables the evasion of cell cycle checkpoints, resistance to apoptosis, and genomic instability—hallmarks of carcinogenesis [8]. Recent study has suggested that E6 and E7 oncoproteins may also contribute to carcinogenesis by modulating the function of the JNK signaling pathway [9].
Cervical cancer is caused by persistent infection with specific high-risk HPV (HR-HPV) genotypes, a relationship that has been well established [10, 11]. The distribution of HPV types most commonly found in cervical cancer is consistent across continents [12]. Globally, cervical cancer caused by HPV-16 and HPV-18 infections accounts for the largest proportion. HPV-39 is also recognized as a common HPV type and belongs to the oncogenic types [13, 14]. More than 200 HPV types have been classified into five phylogenetic genera: alpha, beta, gamma, mu, and nu. The alpha genus is unique in containing HPVs that infect both cutaneous and mucosal epithelia, with some mucosotropic types exhibiting oncogenic potential. HPV-39, which belongs to the alpha-7, is one of the 12 HPV types classified as carcinogenic (Group 1) by the International Agency for Research on Cancer (IARC) [15, 16]. HPV-39 infection is also common among Chinese women [17]. Notably, HPV-39 is not covered by currently available HPV vaccines despite its relatively high prevalence in China. Additionally, data on the genetic variation and immunological characteristics of HPV-39 in central China remain limited.
In this study, we analyzed sequence variations in HPV-39 E6 and E7 genes and further evaluated their potential impact on predicted T-cell epitopes, with the aim of improving current understanding of HPV-39 genetic diversity and providing baseline data for future studies on viral evolution and host immune interactions.
Materials and methods
Specimen collection
In this study, cervical exfoliated cell samples were collected from female patients who underwent cervical screening of possible HR-HPV infection at the Department of Gynecology, Jingzhou Hospital Affiliated to Yangtze University, from September 2019 to September 2023. Informed consent was obtained from all participants, and the study was approved by the Ethics Committee of Jingzhou Hospital, Affiliated to Yangtze University.
HPV DNA extraction and typing
HPV DNA was extracted from cervical exfoliated cell samples using a magnetic bead-based viral nucleic acid extraction kit (Guangzhou Magen Biotechnology Co., Ltd., China) according to the manufacturer’s instructions. DNA extraction was performed on a KingFisher Flex automated nucleic acid extraction system (Thermo Fisher Scientific, USA).
HPV genotyping was performed using a real-time fluorescence PCR-based high-risk human papillomavirus nucleic acid detection kit (Shanghai ZJ Bio-Tech Co., Ltd., China), which detects 15 h-HPV genotypes, including HPV-16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82). Each PCR reaction consisted of 4 µL DNA template and 36 µL reaction mixture containing genotype-specific primers and probes. PCR amplification was conducted under the following conditions: 94 °C for 2 min, followed by 40 cycles of 93 °C for 10 s and 62 °C for 31 s. Samples positive for single type HPV-39 infection were included in subsequent analyses. The remaining DNA samples were stored at − 80 °C until further use.
PCR amplification and sequencing
Specific primers targeting the HPV-39 E6 and E7 genes were designed using Primer Premier 6.0 based on the reference sequence of the HPV-39 prototype (GenBank: M62849). The primers were synthesized by Sangon Biotech (Shanghai). The PCR amplification system included ddH2O (15.875 µL), 10 × Buffer (MgCl2) (Takara) (2.5 µL), dNTP (Takara) (2 µL), Taq polymerase (5 U/L) (Takara) (0.125 µL), forward primer (stock concentration: 20 µM, 1.25 µL), reverse primer (stock concentration: 20 µM, 1.25 µL) and DNA extraction (2.0 µL). PCR amplification conditions were as follows: initial denaturation at 95 °C for 3 min; followed by 35 cycles of denaturation at 94 °C for 45 s, annealing at 57.3 °C (E6) or 63.1 °C (E7) for 60 s, and extension at 72 °C for 60 s; with a final extension at 72 °C for 10 min. For partial samples with relatively low DNA concentrations, the number of PCR amplification cycles for E6 and E7 was increased from 35 cycles to 38 cycles in order to improve PCR product volume. PCR products were subjected to 2.5% agarose gel electrophoresis, and the expected products were sent to Sangon Biotech (Shanghai) for sequencing. The primer sequences are shown in Table 1.
Table 1.
The primers and annealing temperatures of HPV-39 E6 and E7 genes
| Gene | Primer name | Forward primer/ Reverse primer | Product size (bp) | Anneal (℃) |
|---|---|---|---|---|
| HPV-39 E6 | E6-F | GGTTGGGCATACATACCTATACTT | 687 | 57.3 |
| E6-R | CGGCTGTATTTCATTGTAAGGAC | |||
| HPV-39 E7 | E7-F | TAAGGTGCATGTGTTGTCTGAA | 626 | 63.1 |
| E7-R | CATCCTCATCCTCCGACACT |
Variation analysis
Sequencing chromatograms were analyzed using Chromas software. Nucleotide variations in the E6 and E7 genes were identified by comparison with the HPV-39 reference sequence (GenBank: M62849) using MEGA 12 software. The variant nucleotide sequences were translated into amino acid sequences, and their secondary structures were predicted using PSIPRED (PSIPRED 4.0), to analyze whether the non-synonymous mutation cause changes in the protein secondary structure or not.
Phylogenetic analysis
Phylogenetic analysis of HPV-39 E6 and E7 sequences was performed to evaluate the genetic relationships among the identified sequence variants. Neighbor-joining phylogenetic trees were constructed using the Kimura two-parameter model in MEGA 12. The reliability of the tree topologies was evaluated by bootstrap analysis with 1,000 replicates. Reference sequences representing previously established HPV-39 lineages were retrieved from GenBank and included for comparative sequence similarity analysis of E6 and E7 sequence variants.
Selective pressure analysis
Selective pressure analysis was performed using the CodeML program in the PAMLX software package based on the maximum likelihood method. Likelihood ratio tests (LRTs) were conducted to compare nested models and identify putative positively selected sites.
T-cell epitope prediction
Putative T-cell epitopes derived from HPV-39 E6 and E7 proteins were predicted through the Immune Epitope Database (IEDB) analysis resource, using NetMHCpan 4.1 EL (recommended epitope predictor, version 2023.09) for MHC-I and NetMHCIIpan 4.1 EL (recommended epitope predictor, version 2023.09) for MHC-II, respectively. Peptide lengths were set to 9 amino acids for HLA class I-restricted epitopes and 15 amino acids for HLA class II-restricted epitopes. HLA class I and class II alleles with an average frequency greater than 5% in the Han population of Hubei Province, China, were selected from the Allele Frequency Net Database (AFND) for epitope prediction analysis. The HLA class I alleles included HLA-A*02:01, HLA-A*11:01, HLA-A*24:02, HLA-A*33:03, HLA-B*13:01, HLA-B*40:01, HLA-B*46:01, HLA-B*51:01, HLA-B*58:01, HLA-C*01:02, HLA-C*03:02, HLA-C*03:03, HLA-C*03:04, HLA-C*04:01, HLA-C*06:02, HLA-C*07:02, and HLA-C*08:01. The HLA class II alleles included HLA-DRB1*07:01, HLA-DRB1*08:03, HLA-DRB1*09:01, HLA-DRB1*11:01, HLA-DRB1*12:02, and HLA-DRB1*15:01. The antigenicity, allergenicity, and toxicity of the predicted epitopes were evaluated using VaxiJen v2.0, AllerTOP v2.0, and ToxinPred respectively. Predicted epitopes with a Percentile Rank (PR) of < 0.1 for HLA class I or < 5 for HLA class II, together with a VaxiJen antigenicity score > 0.4, were considered high-affinity T-cell epitopes [18, 19]. Predicted epitopes were submitted to the AllerTOP v2.0 server, and allergenicity status was determined according to the server output, which classified peptides as either “Probable Allergen” or “Probable Non-allergen”. Only epitopes predicted to be Probable Non-allergens and non-toxic were retained for subsequent analysis. Epitope conservancy was assessed using the IEDB Epitope Conservancy Tool to evaluate sequence conservation among HPV-39 references at a 100% sequence identity threshold.
Results
Epidemic characteristics of HPV-39 in Jingzhou
HR-HPV genotyping results were collected from women who underwent cervical HPV screening at Jingzhou Central Hospital between September 2019 and September 2023. Among the 26,148 women screened, 3,885 samples tested positive for HR-HPV, corresponding to an overall positivity rate of 14.86%. HPV-39 was detected in 307 h-HPV-positive samples, accounting for 7.90% of all HR-HPV infections. The five most prevalent HR-HPV genotypes in Jingzhou region were HPV-52 (34.16%, 1,327/3,885), HPV-58 (17.89%, 695/3,885), HPV-16 (13.67%, 531/3,885), HPV-51 (9.21%, 358/3,885), and HPV-39 (7.90%, 307/3,885), including single or multiple infection. 109 samples identified as single type HPV-39 infections were included for subsequent E6 and E7 gene amplification and sequencing analyses. Ultimately, complete E6 and E7 sequences were successfully obtained from 94 samples. The failure of amplification and sequencing in the remaining samples may attribute to severe DNA degradation or very low viral load.
Variations in E6 and E7 Genes
Among 94 successfully sequencing samples mentioned above, 71 samples contained nucleotide variations in the E6 and E7 regions, whereas the remaining 23 samples showed sequences identical to the reference strain. Five samples were amplified using 38 PCR cycles because of relatively low-DNA concentration (Ct > 31 in HPV Typing). The variant positions detected in these samples were consistent with those observed in samples amplified under the standard 35-cycle condition, and no apparent differences in variant patterns were identified. Based on sequence variation patterns, the 71 variant sequences were classified into 25 distinct sequence groups (designated 39HB01–39HB25), with identical sequences assigned to the same group. Representative sequences from each variant group had been deposited in GenBank under accession numbers PZ285902–PZ285926. A total of 33 nucleotide variants sites were identified in the E6 and E7 sequences, including 20 non-synonymous and 13 synonymous mutations. The most common nucleotide substitutions were A559G in E6 (17/71, 23.94%), and G792C (19/71, 26.76%), C853G (19/71, 26.76%) in E7. Six previously unreported non-synonymous mutations were identified, including C119T, C125T, and A244C in E6, as well as T613G, G631C, and A855C in E7. The secondary structure of E6 mutation sequence showed that H5Y, P7S and L151P appeared in coil, T19R, Q26H, E46D and A87G appeared in helix, and L102S appeared in strand. Compared with reference sequence M62849, the secondary structure of these mutations was no difference with M62849 secondary structure. But the amino acids substitution also influenced the secondary structure around them (helix shortened and coil increased). For E7, R2H and D57E appeared in coil, L8V, H50Q, R87Q, Q88E/D, L89V, Q91K and F93C appeared in helix and D14H/E appeared in strand. The secondary structure of these mutations was also no difference with M62849 secondary structure, but the amino acids substitution also influenced the secondary structure around them (strand shortened and coil increased). Detailed mutation information was summarized in Tables 2 and 3.
Table 2.
The variations of HPV-39 E6 genes
| Nucleotides positions | E6 | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 119 | 125 | 162 | 167 | 184 | 244 | 289 | 366 | 411 | 487 | 550 | 558 | 559 | N | |
| Reference nucleotides | C | C | C | C | G | A | A | C | T | T | C | T | A | |
| 39HB01 | - | - | - | - | - | - | - | - | - | - | - | - | - | 15 |
| 39HB02 | - | - | - | - | - | - | - | - | - | - | - | C | - | 9 |
| 39HB03 | - | - | - | - | T | - | T | G | - | C | - | - | G | 8 |
| 39HB04 | - | - | - | - | T | - | T | G | - | C | - | - | G | 7 |
| 39HB05 | - | - | - | - | - | - | - | - | - | - | - | - | - | 4 |
| 39HB06 | - | - | - | - | - | - | - | - | - | - | - | - | - | 3 |
| 39HB07 | - | - | - | - | - | - | - | - | - | - | - | - | - | 4 |
| 39HB08 | - | - | - | - | - | - | - | - | - | - | - | - | - | 3 |
| 39HB09 | - | - | - | - | - | - | - | - | - | - | - | - | - | 2 |
| 39HB10 | - | - | - | - | - | - | - | - | C | - | - | C | - | 1 |
| 39HB11 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB12 | - | - | - | - | - | - | - | - | - | - | - | - | G | 1 |
| 39HB13 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB14 | - | - | - | - | - | - | - | - | - | - | - | C | - | 1 |
| 39HB15 | - | - | - | - | - | - | - | - | - | - | T | - | - | 1 |
| 39HB16 | - | - | - | - | - | - | - | - | - | - | - | C | - | 1 |
| 39HB17 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB18 | - | - | - | - | - | - | - | - | - | - | - | C | - | 1 |
| 39HB19 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB20 | - | - | - | - | - | C | - | - | - | - | - | - | G | 1 |
| 39HB21 | - | - | - | T | - | - | - | - | - | - | - | - | - | 1 |
| 39HB22 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB23 | - | - | G | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB24 | - | T | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB25 | T | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| Reference AA | H | P | T | L | Q | E | P | A | L | F | D | L | L | |
| AA Position | 5 | 7 | 19 | 21 | 26 | 46 | 61 | 87 | 102 | 127 | 148 | 151 | 151 | |
| AA Variant | Y | S | R | - | H | D | - | G | S | - | - | P | - | |
| Secondary structure | C | C | H | - | H | H | - | H | E | - | - | C | - |
The nucleotides matching the reference (GenBank: M62849) are marked with a dash (-), AA Amino acid, H Helix, E Extended strand, C Coil. Non-synonymous mutations are highlighted in bold. Only the secondary structures at amino acid substitution sites are shown in the table
Table 3.
The variations of HPV-39 E7 genes
| Nucleotides positions | E7 | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 596 | 597 | 613 | 615 | 631 | 633 | 634 | 642 | 741 | 762 | 792 | 820 | 851 | 853 | 855 | 856 | 861 | 862 | 869 | 909 | N | |
| Reference nucleotides | G | T | T | G | G | T | T | T | T | T | G | C | G | C | A | C | G | C | T | T | |
| 39HB01 | - | - | - | - | - | - | - | - | - | - | C | - | - | - | - | - | - | - | - | - | 15 |
| 39HB02 | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | - | - | 9 |
| 39HB03 | - | - | - | - | - | - | C | - | - | A | - | T | A | - | - | - | - | A | - | - | 8 |
| 39HB04 | - | - | - | - | - | - | C | - | G | A | - | T | A | - | - | - | - | A | - | - | 7 |
| 39HB05 | A | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 4 |
| 39HB06 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | 3 |
| 39HB07 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | 4 |
| 39HB08 | - | - | - | - | - | G | - | - | - | - | - | - | - | G | - | - | - | - | - | - | 3 |
| 39HB09 | - | - | - | - | C | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | 2 |
| 39HB10 | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | - | - | 1 |
| 39HB11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | A | - | - | 1 |
| 39HB12 | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | - | - | 1 |
| 39HB13 | - | G | - | - | - | - | - | - | - | - | C | - | - | - | - | - | - | - | - | - | 1 |
| 39HB14 | - | - | - | A | - | - | - | - | - | - | - | - | - | G | - | - | - | - | - | - | 1 |
| 39HB15 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | 1 |
| 39HB16 | - | - | G | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | - | - | 1 |
| 39HB17 | - | - | - | - | - | G | - | - | - | - | C | - | - | - | - | - | - | - | - | - | 1 |
| 39HB18 | - | - | - | - | - | - | - | - | - | - | - | - | - | G | C | - | - | - | - | - | 1 |
| 39HB19 | - | - | - | - | - | G | - | - | - | - | - | - | - | G | - | - | A | - | - | - | 1 |
| 39HB20 | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | - | - | 1 |
| 39HB21 | - | - | - | - | - | - | - | C | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB22 | - | - | - | - | - | - | - | - | - | - | C | - | - | - | - | - | - | - | - | C | 1 |
| 39HB23 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | G | - | - | - | - | 1 | |
| 39HB24 | A | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1 |
| 39HB25 | - | - | - | - | - | - | - | - | - | C | - | - | - | - | - | - | - | - | - | 1 | |
| Reference AA | R | R | L | L | D | D | L | P | H | D | S | L | R | Q | Q | L | Q | Q | F | T | |
| AA Position | 2 | 2 | 8 | 8 | 14 | 14 | 15 | 17 | 50 | 57 | 67 | 77 | 87 | 88 | 88 | 89 | 90 | 91 | 93 | 106 | |
| AA Variant | H | - | V | - | H | E | - | - | Q | E | - | - | Q | E | D | V | - | K | C | - | |
| Secondary structure | C | - | H | - | E | E | - | - | H | C | - | - | H | H | H | H | - | H | H | - |
The nucleotides matching the reference (GenBank: M62849) are marked with a dash (-), AA Amino acid, H Helix, E Extended strand, C Coil. Non-synonymous mutations are highlighted in bold. Only the secondary structures at amino acid substitution sites are shown in the table
Phylogenetic analysis of HPV-39 E6 and E7 genes
Phylogenetic analysis was performed using 25 representative HPV-39 E6/E7 sequence variants identified in this study together with 20 HPV-39 reference sequences retrieved from GenBank. The phylogenetic trees showed that 56 of the 71 variant sequences (78.87%) exhibited the highest sequence similarity to lineage A reference sequences. These findings suggested that lineage A-like sequence patterns were predominant among the analyzed HPV-39 E6/E7 variants. The phylogenetic trees are presented in Figs. 1 and 2.
Fig. 1.
Neighbor-joining phylogenetic tree of HPV-39 E6. The strains with black dots represented the reference sequences used for alignment, and the others were variant sequences. Only the bootstrap value > 50% was displayed
Fig. 2.
Neighbor-joining phylogenetic tree of HPV-39 E7. The strains with black dots represented the reference sequences used for alignment, and the others were variant sequences. Only the bootstrap value > 50% was displayed
Selective pressure analysis
Selective pressure analysis of the HPV-39 E6 and E7 genes was performed by calculating the ratio of non-synonymous to synonymous substitutions (ω = dN/dS) using the PAMLX program. No codon sites under statistically significant positive selection were identified in either the E6 or E7 gene (Table 4).
Table 4.
Results of PAML estimation for HPV-39 E6 and E7
| Gene | Models | InL | Estimates of parameters | 2ΔI | Positively selected sites | Pr(w > 1) |
|---|---|---|---|---|---|---|
| E6 | M7 | -769.397584 | p = 0.00753 q = 0.00500 | |||
| M8 | -769.338396 |
p0 = 0.85225 p = 0.00500 q = 0.00817 (p1 = 0.14775) ω = 2.04415 |
0.118376 p = 0.942518247 = 9.425e-01 > 0.05 |
102 L | 0.736 | |
| E7 | M7 | -636.930780 | p = 0.00500 q = 0.00746 | |||
| M8 | -636.277624 |
p0 = 0.74977 p = 0.00500 q = 1.74701 (p1 = 0.25023) ω = 1.81616 |
1.306312 p = 0.520403920 = 5.204e-01 > 0.05 |
14 D 57 D 88 Q 91 Q |
0.848 0.624 0.618 0.677 |
The positively selected sites were identified with posterior probability ≥ 0.9 using Bayes empirical Bayes (BEB) approach. InL log-likelihood difference between the two models, 2Δl twice the log‐likelihood difference between the two models
T-cell epitope prediction of HPV-39 E6 and E7 proteins
Predicted T-cell epitopes with strong HLA-binding affinity, high antigenicity scores, and predicted non-toxic and non-allergenic properties were selected for further analysis. The prediction results were presented in Tables 5 and 6, and only epitopes with a Percentile Rank (PR) < 0.1 for HLA class I or < 5 for HLA-II were included.
Table 5.
T cell epitopes of HPV-39 E6 reference and variant sequences
| MHC allele | Start | End | E6 Reference sequence | PR | VaxiJen Score |
Conservancy | MHC allele | Start | End | E6 Variants sequence | PR | VaxiJen Score |
Conservancy |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HLA-A*24:02 | 85 | 93 | VYATTLENI | 0.04 | 0.4545 | (17/20) | HLA-A*24:02 | 85 | 93 | VYGTTLENI | 0.09 | 0.4726 | (3/20) |
| HLA-A*33:03 | 71 | 79 | FYAKIRELR | 0.06 | 0.3789 | (20/20) | - | - | - | - | - | ||
| HLA-B*40:01 | 90 | 98 | LENITNTKL | 0.05 | 0.6894 | (20/20) | - | - | - | - | - | ||
| HLA-B*46:01 | 72 | 80 | YAKIRELRY | 0.09 | 0.4250 | (20/20) | - | - | - | - | - | ||
| HLA-C*01:02 | 13 | 21 | KLPDLCTTL | 0.01 | 1.2176 | (20/20) | HLA-C*01:02 | 13 | 21 | KLPDLCRTL | 0.01 | 0.7777 | |
| HLA-C*03:02 | 72 | 80 | YAKIRELRY | 0.06 | 0.4250 | (20/20) | - | - | - | - | - | ||
| HLA-C*06:02 | 70 | 78 | KFYAKIREL | 0.03 | 0.6285 | (20/20) | - | - | - | - | - | ||
| HLA-C*06:02 | 36 | 44 | RRPLQQTEV | 0.06 | -0.0666 | (19/20) | - | - | - | - | - | ||
| HLA-C*07:02 | 4 | 12 | FHNPAERPY | 0.06 | -0.4156 | (20/20) | HLA-C*07:02 | 4 | 12 | FYNPAERPY | 0.02 | -0.2135 | |
| HLA-C*07:02 | 70 | 78 | KFYAKIREL | 0.06 | 0.6285 | (20/20) | - | - | - | - | - | ||
| HLA-DRB1*07:01 | 123 | 137 | SKRRFHKIAGSYTGQ | 3.9 | 0.1418 | (20/20) | - | - | - | - | - | ||
| HLA-DRB1*09:01 | 44 | 58 | VYEFAFSDLYVVYRD | 3.9 | 0.7427 | (19/20) | HLA-DRB1*09:01 | 44 | 58 | VYDFAFSDLYVVYRD | 3.5 | 1.0140 | |
| HLA-DRB1*12:02 | 115 | 129 | AEKLRHLNSKRRFHK | 4.3 | -0.0294 | (20/20) | - | - | - | - | - | ||
| HLA-DRB1*15:01 | 75 | 89 | IRELRYYSDSVYATT | 0.67 | 0.3667 | (17/20) | HLA-DRB1*15:01 | 75 | 89 | IRELRYYSDSVYGTT | 0.62 | 0.4386 | (3/20) |
A dash (-) indicates the absence of a novel variant sequence. The bold parts indicate that the epitopes may be potential allergen. Conservancy indicates that, in how many of all 20 HPV-39 reference sequences, the predicted epitope sequence is at 100% sequence identity to them
Table 6.
T cell epitopes of HPV-39 E7 reference and variant sequences
| MHC allele | start | end | E7 Reference sequence | PR | VaxiJen Score |
Conservancy | MHC allele | start | end | E7 Variants sequence | PR | VaxiJen Score |
Conservancy |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HLA-A*02:01 | 7 | 15 | TLQEIVLDL | 0.09 | 0.3129 | (20/20) | HLA-A*02:01 | 7 | 15 | TLQEIVLEL | 0.01 | 0.3278 | |
| HLA-A*02:01 | 7 | 15 | TLQEIVLDL | 0.09 | 0.3129 | (20/20) | HLA-A*02:01 | 7 | 15 | TLQEIVLHL | 0.02 | 0.1936 | |
| HLA-B*51:01 | 3 | 11 | GPKPTLQEI | 0.1 | 0.1334 | (20/20) | HLA-B*51:01 | 3 | 11 | GPKPTVQEI | 0.07 | 0.1653 | |
| HLA-B*51:01 | 16 | 24 | CPYNEIQPV | 0.1 | 1.1152 | (18/20) | - | - | - | - | - | ||
| HLA-C*03:02 | 44 | 52 | HAVNHQHQL | 0.03 | 0.6614 | (20/20) | HLA-C*03:02 | 44 | 52 | HAVNHQQQL | 0.04 | 0.5790 | |
| HLA-C*03:03 | 44 | 52 | HAVNHQHQL | 0.01 | 0.6614 | (20/20) | HLA-C*03:03 | 44 | 52 | HAVNHQQQL | 0.01 | 0.5790 | |
| HLA-C*03:04 | 44 | 52 | HAVNHQHQL | 0.01 | 0.6614 | (20/20) | HLA-C*03:04 | 44 | 52 | HAVNHQQQL | 0.01 | 0.5790 | |
| HLA-C*08:01 | 44 | 52 | HAVNHQHQL | 0.04 | 0.6614 | (20/20) | HLA-C*08:01 | 44 | 52 | HAVNHQQQL | 0.05 | 0.5790 | |
| HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQQLFMDS | 0.5 | -0.3247 | (18/20) | HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQKLFMDS | 0.53 | -0.5097 | |
| HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQQLFMDS | 0.5 | -0.3247 | (18/20) | HLA-DRB1*12:02 | 82 | 96 | SRDTLRELQQLFMDS | 0.88 | -0.2049 | (2/20) |
| HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQQLFMDS | 0.5 | -0.3247 | (18/20) | HLA-DRB1*12:02 | 82 | 96 | SRDTLQQLQKLFMDS | 1.1 | -0.4673 | |
| HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQQLFMDS | 0.5 | -0.3247 | (18/20) | HLA-DRB1*12:02 | 82 | 96 | SRDTLRDLQQLFMDS | 1.4 | -0.0002 | |
| HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQQLFMDS | 0.5 | -0.3247 | (18/20) | HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQQLCMDS | 2.5 | 0.2056 | |
| HLA-DRB1*12:02 | 82 | 96 | SRDTLRQLQQLFMDS | 0.5 | -0.3247 | (18/20) | HLA-DRB1*12:02 | 82 | 96 | SRDTLRQVQQLFMDS | 3.6 | -0.2276 |
A dash (-) indicates the absence of a novel variant sequence. The bold parts indicate that the epitopes may be potential allergen. Conservancy indicates that, in how many of all 20 HPV-39 reference sequences, the predicted epitope sequence is at 100% sequence identity to them
All predicted epitopes included in the analysis were predicted to be non-toxic according to ToxinPred analysis. Epitopes with antigenicity scores > 0.4 and predicted non-toxic and non-allergenic properties were retained for conservancy analysis. Among the predicted E6 epitopes, the peptide 70–78 (KFYAKIREL), restricted by HLA-C*06:02, showed the most favorable predicted epitope profile, whereas no comparable epitope was identified in the E7 sequence. Several non-synonymous substitutions were predicted to influence epitope binding affinity or antigenicity. In the E6 sequence, the epitope 85–93 (VYGTTLENI) restricted by HLA-A*24:02, and containing the A87G substitution, showed reduced predicted binding affinity. In addition, the epitope 13–21 (KLPDLCRTL), associated with the T19R mutation, exhibited decreased predicted antigenicity. In the E7 sequence, the epitope 7–15 (TLQEIVLEL), containing the D14E substitution, demonstrated increased predicted binding affinity to HLA-A*02:01.
Discussion
Global differences exist in HPV genotype distribution and infection patterns across populations. In a study of patients with head and neck squamous cell carcinoma in Iran, nine α-HPV types were detected, including HPV-6, HPV-11, HPV-16, HPV-18, HPV-53, HPV-56, HPV-58, HPV-70, and HPV-82 [20]. Furthermore, a study investigating viral infections in semen specimens reported marked differences in HPV genotype prevalence, with HPV-16 being the predominant genotype, whereas HPV-9 and HPV-39 represented a smaller proportion of HPV-positive cases [21]. These findings showed the existence of population-specific characteristics in HPV genotype distribution and importance of regional surveillance studies. Persistent infection with high-risk human papillomavirus is recognized as a necessary cause of cervical cancer development [22]. The viral oncogenes E6 and E7 play a central role in both the initiation of HPV-induced carcinogenesis and the maintenance of malignant phenotypes in HPV-positive cancer cells [23]. Although HPV-16 and HPV-18 are responsible for the majority of cervical cancer cases worldwide, the distribution patterns of other high-risk HPV genotypes vary considerably across geographic regions and populations [13, 24]. Previous epidemiological studies have reported a relatively high prevalence of HPV-39 in eastern China [25]. Consistent with these observations, HPV-39 was identified as the fifth most common high-risk HPV genotype among women undergoing cervical screening in the Jingzhou area of central China in this study. Given the limited sequence data currently available for HPV-39 isolates from central China, characterization of E6 and E7 genetic variations may contribute to a better understanding of the regional molecular epidemiological features of this genotype. Previous studies have demonstrated that intratypic variations in HPV genes may be associated with differences in carcinogenic potential. For example, the T350G variant in the HPV-16 E6 gene has been linked to an increased risk of progression to high-grade lesions and development of cervical cancer [26]. The E7 amino acid substitutions T20I and G63S in HPV-58 are associated with higher risks of CIN3 and invasive cervical cancer [27]. Similarly, the lineage B-specific mutation K93R (A379G) in HPV-52 has been correlated with an increased risk of cervical neoplasia [28]. Although the clinical significance of HPV-39 sequence variations remains unclear, characterization of E6 and E7 genetic diversity may provide useful information for future studies investigating the biological and epidemiological relevance of HPV-39 variants. In this study, the nucleotide variation frequency of E7 (71/94, 75.53%) was higher than that of E6 (35/94, 37.23%). Among the three non-synonymous variants identified in the E6 gene, Q26H, A87G, and L151P, as well as the six non-synonymous variants identified in the E7 gene, R2H, D14E, D57E, R87Q, Q88E, and Q91K, were identical to those previously reported in Southwest China [29]. Consistent with a study conducted in Iran [30], the non-synonymous variant L102S was also identified in the E6 gene in our study. In addition, the non-synonymous variant T19R in the E6 gene and three non-synonymous variants in the E7 gene, H50Q, L89V, and F93C, were the same as those reported in Yunnan Province [19]. Furthermore, C119T, C125T, and A244C in the E6 gene, together with T613G, G631C, and A855C in the E7 gene, were detected only in Central China, suggesting the presence of regional differences in HPV-39 genetic variation. To obtain adequate PCR products for following sequencing, the PCR cycle number was increased from 35 to 38 cycles for five samples with relatively low DNA concentrations. Although no obvious differences in variant spectra were observed between these samples and those amplified using the standard protocol, the increased PCR cycle number may theoretically increase the risk of amplification artifacts and therefore represents a potential source of bias, which should be considered a limitation of the present study. In Southwest China, the E6 variants Q26H, A87G, and L151P were identified as positively selected sites in selective pressure analyses, indicating that these mutations may facilitate viral adaptation to specific environmental conditions. However, no positively selected sites were identified in either the E6 or E7 genes in this study. Secondary structure prediction indicated that none of the identified amino acid substitutions altered the predicted secondary structure type at the mutation sites in HPV-39 E6 and E7 proteins. However, several substitutions were associated with localized alterations in adjacent regions, characterized by shortening of α-helical or β-strand elements and a corresponding increase in coil regions. Given that HPV E6 and E7 mediate their biological activities through interactions with host cellular proteins, subtle conformational alterations could potentially affect the functional properties of these oncoproteins. Since previous study has suggested that epitopes are more readily formed in random coil regions [31], the observed local structural changes may influence local antigenic properties.
HPV-39 has been classified into lineages A and B, with lineage A further divided into sublineages A1 and A2 [32]. Globally, HPV-39 variants are primarily distributed within lineage A [33]. In the present study, phylogenetic analysis based on E6 and E7 sequences demonstrated that most identified variants 56/71(78.87%) showed the highest sequence similarity to lineage A reference sequences. However, the present analysis was based solely on the E6 and E7 genomic regions rather than complete viral genome sequences, these findings should not be interpreted as definitive lineage assignments. Instead, the E6/E7-based phylogenetic analysis should be regarded as a supplementary approach for evaluating sequence diversity and sequence similarity among circulating HPV-39 variants. Nevertheless, since E6 and E7 encode the principal HPV oncogenic proteins, characterization of sequence variation within these regions may provide valuable insights into the molecular epidemiological characteristics of HPV-39 isolates circulating in central China.
Frazer et al. conducted a clinical trial of immunotherapy in patients with HPV-16 CIN and demonstrated that a therapeutic HPV vaccine base on E6 and E7 fusion proteins plus an adjuvant induced vaccine antigen-specific cell-mediated immunity [34]. Currently, clinical trials investigating HPV therapeutic vaccines have demonstrated a promising vaccine-induced T-cell mediated immune response, resulting in cervical lesion regression and viral eradication [35]. Epitopes, as the smallest structural and functional units of an antigen, specifically bind to antibodies or antigen receptors and serve as key sites for activating adaptive immunity. Epitope research plays an important role in disease diagnosis, vaccine design, and immunotherapy [36]. In this study, a predicted candidate T-cell epitope spanning residues 70–78 (KFYAKIREL), restricted by HLA-C*06:02, was identified within the HPV-39 E6 sequence, whereas no candidate epitope was detected in the E7 sequence under the selected prediction criteria. In addition, several amino acid substitutions identified in E6 and E7 were predicted to influence epitope-binding profiles, suggesting possible effects on peptide-HLA interactions. These findings may provide preliminary immunoinformatic information for future studies investigating HPV-39 E6/E7-associated cellular immune responses. However, all epitope-related results were derived from computational prediction analyses and should be considered exploratory rather than definitive evidence of biological immunogenicity or immune responses, having inherent limitations in epitope prediction accuracy. Therefore, further experimental validation, including HLA-binding assays, T-cell activation studies and cellular immune response studies in vitro and in vivo, is required to confirm the biological relevance of these predicted epitopes before any therapeutic implications can be drawn from these predictions.
Although the present study was primarily descriptive, the findings may have potential implications for both vaccine research and public health. The identification of sequence variation within the HPV-39 E6 and E7 genes, together with mutation-associated changes in predicted T-cell epitopes, provides preliminary information that may be useful for future studies investigating potential therapeutic vaccine targets against HPV-39-associated disease. In addition, continued surveillance of HPV-39 genetic diversity may improve understanding of viral evolution and regional transmission patterns. Such information may contribute to molecular epidemiological monitoring and support HPV prevention and control strategies in central China. Nevertheless, the epitope predictions reported in this study were based on bioinformatic analyses and should be interpreted with caution until validated by further immunological and functional studies.
Conclusion
This study characterized sequence variation in HPV-39 E6 and E7 genes among isolates collected in Jingzhou, central China. A total of 33 variants were identified, including six novel non-synonymous mutations. Sequence analysis based on the E6 and E7 regions suggested that most isolates exhibited the highest sequence similarity to lineage A reference sequences. In addition, several amino acid substitutions were predicted to influence epitope-binding profiles. Overall, these findings expand the currently available data on HPV-39 E6/E7 genetic diversity in central China and provide supplementary information for future studies investigating the molecular epidemiology and sequence variation of HPV-39.
Acknowledgements
Not application.
Abbreviations
- HR-HPV
High-risk human papillomavirus
- HPV-39
Human papillomavirus type 39
- LCR
Long control region
- PCR
polymerase chain reaction
- URR
Upstream regulatory region
- MHC
Major histocompatibility complex
- HLA
Human leukocyte antigen
- SNP
Single nucleotide polymorphism
- CTL
Cytotoxic T lymphocyte
- CIN
Cervical intraepithelial neoplasia
Author contributions
K.Q. performed the experiments, analyzed the data, and drafted the manuscript. Z.L., Y.W., and X.G. collected the data and samples. Y.Y. and P.L. contributed to data analysis. B.M. conceived and supervised the study and critically revised the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported financially by Key research and development plan project supporting local special funds in the field of comprehensive health of Hubei Province (Grant Number: 2022BCE029).
Data availability
The datasets generated and analyzed during the current study are available in the GenBank repository (accession numbers: PZ285902–PZ285926).
Declarations
Ethics approval and consent to participate
This study was approved by the Ethics Committee of Jingzhou Hospital Affiliated to Yangtze University, and all the work followed the ethics guidelines of the hospital. The ethical approval number is 2022-048-01. Informed consent of patients had been obtained, and the privacy of the study subjects was protected before sample collection.
Consent for publication
Not application.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Mahantshetty U, Lavanya G, Grover S, et al. Incidence, Treatment and Outcomes of Cervical Cancer in Low- and Middle-income Countries. Clin Oncol. 2021;33:e363–71. [DOI] [PubMed] [Google Scholar]
- 2.Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74:229–63. [DOI] [PubMed] [Google Scholar]
- 3.Li Z, Liu P, Yin A, et al. Global landscape of cervical cancer incidence and mortality in 2022 and predictions to 2030: The urgent need to address inequalities in cervical cancer. Intl J Cancer. 2025;157:288–97. [DOI] [PubMed] [Google Scholar]
- 4.Wu Y, He S, Cao M, et al. Comparative analysis of cancer statistics in China and the United States in 2024. Chin Med J. 2024;137:3093–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Pavelescu LA, Mititelu-Zafiu NL, Mindru DE, et al. Molecular Insights into HPV-Driven Cervical Cancer: Oncoproteins, Immune Evasion, and Epigenetic Modifications. Microorganisms. 2025;13:1000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Li J, Li S. From Viral Infection to Genome Reshaping: The Triggering Role of HPV Integration in Cervical Cancer. IJMS. 2025;26:9214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Boldeanu L, Assani M-Z, Boldeanu MV, et al. Cervical Cancer in the Era of HPV: Translating Molecular Mechanisms into Preventive. Public Health Action IJMS. 2025;26:8463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hanahan D, Weinberg RA. Hallmarks of Cancer: The Next Generation. Cell. 2011;144:646–74. [DOI] [PubMed] [Google Scholar]
- 9.Behboudi E, Charostad J, Nakhaie M, et al. JNK Signaling Pathways and Oncoviruses. Iran J Med Microbiol. 2024;18:148–62. [Google Scholar]
- 10.Castellsagué X. Natural history and epidemiology of HPV infection and cervical cancer. Gynecol Oncol. 2008;110:S4–7. [DOI] [PubMed] [Google Scholar]
- 11.Razavi-Nikoo H, Behboudi E, Aghcheli B, et al. Bac to Bac System Efficiency for Preparing HPV Type 16 Virus-Like Particle Vaccine. Arch Razi Inst. 2023;78:997–1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Malagón T, Franco EL, Tejada R, et al. Epidemiology of HPV-associated cancers past, present and future: towards prevention and elimination. Nat Rev Clin Oncol. 2024;21:522–38. [DOI] [PubMed] [Google Scholar]
- 13.Bruni L, Diaz M, Castellsagué X, et al. Cervical Human Papillomavirus Prevalence in 5 Continents: Meta-Analysis of 1 Million Women with Normal Cytological Findings. J INFECT DIS. 2010;202:1789–99. [DOI] [PubMed] [Google Scholar]
- 14.De Sanjose S, Quint WG, Alemany L, et al. Human papillomavirus genotype attribution in invasive cervical cancer: a retrospective cross-sectional worldwide study. Lancet Oncol. 2010;11:1048–56. [DOI] [PubMed] [Google Scholar]
- 15.De Villiers E-M. Cross-roads in the classification of papillomaviruses. Virology. 2013;445:2–10. [DOI] [PubMed] [Google Scholar]
- 16.McBride AA. Oncogenic human papillomaviruses. Phil Trans R Soc B. 2017;372:20160273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zeng Z, Yang H, Li Z, et al. Prevalence and Genotype Distribution of HPV Infection in China: Analysis of 51,345 HPV Genotyping Results from China’s Largest CAP Certified Laboratory. J Cancer. 2016;7:1037–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Li T, Yang Z, Luo P, et al. Genetic variability of human papillomavirus type 18 based on E6, E7 and L1 genes in central China. Virol J. 2024;21:152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zhang Yuxiao Y, Yijuan W, Li et al. Genetic variation analyses of human papillomavirus 39 and prediction of T and B Cell epitopes. Chin J Experimental Clin Virol. 2025;39:9–17.
- 20.Karimi A, Mohebbi E, Mckay-Chopin S, et al. Human Papillomavirus and Risk of Head and Neck Squamous Cell Carcinoma in Iran. Microbiol Spectr. 2022;10:e00117–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Behboudi E, Mokhtari-Azad T, Yavarian J, et al. Molecular detection of HHV1-5, AAV and HPV in semen specimens and their impact on male fertility. Hum Fertility. 2019;22:133–8. [DOI] [PubMed] [Google Scholar]
- 22.Schiffman M, Castle PE, Jeronimo J et al. Human papillomavirus and cervical cancer n.d. [DOI] [PubMed]
- 23.Hoppe-Seyler K, Bossler F, Braun JA, et al. The HPV E6/E7 Oncogenes: Key Factors for Viral Carcinogenesis and Therapeutic Targets. Trends Microbiol. 2018;26:158–68. [DOI] [PubMed] [Google Scholar]
- 24.De Martel C, Plummer M, Vignat J, et al. Worldwide burden of cancer attributable to HPV by site, country and HPV type. Intl J Cancer. 2017;141:664–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Shen Y, Huang Y, Wang W, et al. Prevalence and genotype distribution of HPV infection among women in Xiamen, China. Front Microbiol. 2023;14:1130226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Totaro ME, Gili JA, Liotta DJ, et al. Genetic variation in the E6 and E7 genes of human papillomavirus type 16 in northeastern Argentina. J Med Virol. 2022;94:745–51. [DOI] [PubMed] [Google Scholar]
- 27.Chan PKS, Zhang C, Park J, et al. Geographical distribution and oncogenic risk association of human papillomavirus type 58 E6 and E7 sequence variations. Intl J Cancer. 2013;132:2528–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Choi YJ, Ki EY, Zhang C, et al. Analysis of Sequence Variation and Risk Association of Human Papillomavirus 52 Variants Circulating in Korea. PLoS ONE. 2016;11:e0168178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.He J, Li T, Wang Y, et al. Genetic variability of human papillomavirus type 39 based on E6, E7 and L1 genes in Southwest China. Virol J. 2021;18:72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Hosseini N, Shoja Z, Arashkia A, et al. Lineage analysis of human papillomavirus type 39 in cervical samples of Iranian women. Virol J. 2021;18:152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Jørgensen KW, Buus S, Nielsen M. Structural Properties of MHC Class II Ligands, Implications for the Prediction of MHC Class II Epitopes. PLoS ONE. 2010;5:e15877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Burk RD, Harari A, Chen Z. Human papillomavirus genome variants. Virology. 2013;445:232–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Chen Z, Schiffman M, Herrero R, et al. Evolution and Taxonomic Classification of Alphapapillomavirus 7 Complete Genomes: HPV18, HPV39, HPV45, HPV59, HPV68 and HPV70. PLoS ONE. 2013;8:e72565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Frazer I, Quinn M, Nicklin J, et al. Phase 1 study of HPV16-specific immunotherapy with E6E7 fusion protein and ISCOMATRIX? adjuvant in women with cervical intraepithelial neoplasia. Vaccine. 2004;23:172–81. [DOI] [PubMed] [Google Scholar]
- 35.Akhatova A, Chan CK, Azizan A, et al. The Efficacy of Therapeutic DNA Vaccines Expressing the Human Papillomavirus E6 and E7 Oncoproteins for Treatment of Cervical Cancer. Syst Rev Vaccines. 2021;10:53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Hu D, Irving AT. Massively-multiplexed epitope mapping techniques for viral antigen discovery. Front Immunol. 2023;14:1192385. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets generated and analyzed during the current study are available in the GenBank repository (accession numbers: PZ285902–PZ285926).