Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Oct 6.
Published in final edited form as: J Neurophysiol. 2026 Jul 31;136(2):772–781. doi: 10.1152/jn.00265.2026

Chronic Intermittent Hypoxia increases EPSC Frequency in median preoptic nucleus neurons through BDNF-TrkB signaling in a sex-dependent manner

Shuping Jia 1, Nataliya Rybalchenko 1, Obed T Paundralingga 2,3, Cephas B Appiah 2, George E Farmer 1, J Thomas Cunningham 2
PMCID: PMC13637811  NIHMSID: NIHMS2202188  PMID: 42537402

Abstract

Chronic intermittent hypoxia (CIH), a hallmark of obstructive sleep apnea, produces a sustained sympathetically-mediated increase in blood pressure. The median preoptic nucleus (MnPO) contributes to CIH-induced sympathoexcitation via projections to the paraventricular nucleus of the hypothalamus (PVN). However, the synaptic mechanisms underlying CIH-induced increased activity in this pathway remain to be determined. Additionally, the impact of sex on MnPO synaptic changes in CIH exposure is unknown. We hypothesized that CIH affects MnPO synaptic activity differently between sexes and that brain-derived neurotrophic factor-tropomyosin receptor kinase B (BDNF-TrkB) signaling plays a role in CIH-mediated changes in the MnPO-PVN pathway. We performed whole-cell voltage-clamp recordings from MnPO neurons in brain slices from male and female rats exposed to either normoxia or seven days of CIH. In PVN-projecting MnPO neurons, CIH increased mEPSC frequency only in males, while females showed a reduction in mEPSC amplitude to CIH. CIH also increased BDNF expression in the MnPO of males exposed to CIH but not in females. Pharmacological studies in male rats using K252a, K252b, and ANA-12 attenuated the CIH-induced increase in mEPSC frequency, indicating that BDNF–TrkB signaling is essential for CIH. These findings highlight a sex-specific, TrkB-dependent mechanism that enhances excitatory signaling between the MnPO and PVN. In conclusion, our study shows that PVN-projecting MnPO neurons demonstrate sex-based changes in mEPSCs and that BDNF-TrkB signaling contributes to the CIH-induced increase in mEPSC frequency in neurons from males.

NEW AND NOTEWORTHY.

Chronic Intermittent Hypoxia (CIH) mimics arterial hypoxemia associated with sleep apnea. These studies demonstrate that CIH produces sex-dependent changes in mEPSC properties in paraventricular nucleus (PVN) projecting median preoptic nucleus (MnPO) neurons. In neurons from male rats, BDNF contributes to CIH-induced changes in mEPSC frequency. As the PVN directly innervates the sympathetic system, this could be a possible mechanism contributing to sustained sympathoexcitation in CIH.

Graphical Abstract

graphic file with name nihms-2202188-f0001.webp

INTRODUCTION

The median preoptic nucleus (MnPO) is a midline structure that spans the anterior wall of the third ventricle between the organum vasculosum of the lamina terminalis (OVLT) and the subfornical organ (SFO) (1). It is interconnected with both the OVLT and SFO and sends projections to regions that participate in neuroendocrine and autonomic regulation, such as the paraventricular nucleus of the hypothalamus (PVN) (1-3). It has been proposed that neural adaptations or sensitization in some of these regions can contribute to chronic changes in blood pressure regulation that lead to hypertension (4). Specifically, Johnson et al. (4) suggested that several factors, including angiotensin and neurotrophic factors such as brain-derived neurotrophic factor (BDNF) can produce changes in brain regions that drive long-term changes in sympathetic outflow that support chronic increases in arterial pressure.

Electrolytic lesions of anteroventral region of the third ventricle (AV3V), which included the ventral MnPO along with the OVLT and the afferents of the SFO and other parts of the optic recess, reverse or prevent hypertension in several preclinical models of human essential hypertension (4, 5). In some of these models, electrolytic (6-8) or excitotoxic lesions (9, 10) of the MnPO produced similar antihypertensive effects. Virally mediated overexpression of zinc/copper dismutase in the MnPO mitigates angiotensin-induced hypertension (11). Increases in blood pressure that are associated with chronic intermittent hypoxia (CIH), a model of the hypoxia associated with sleep apnea (12, 13), are prevented by AV3V lesions and virally mediated overexpression of a dominant negative construct against the transcription factor FosB (14). Lesions of PVN-projecting MnPO neurons mediated by Cre-dependent Caspase 3 also prevent the increase in blood pressure associated with CIH (15) while optogenetic stimulation of these neurons increases EPSC amplitude in PVN neurons (16). These observations are consistent with studies in anesthetized rat preparations, which show that influencing neuronal activity in the MnPO can alter sympathetic nerve activity (17, 18). However, these studies do not indicate the nature of the cellular mechanisms at the level of the MnPO that contribute to increased blood pressure.

We have previously reported that both CIH and angiotensin produce changes in GABA-mediated inhibition in uncharacterized MnPO neurons (19, 20). In the current study, we sought to extend these observations by conducting in vitro electrophysiology studies to determine the effects of CIH on PVN-projecting MnPO neurons. Importantly, both male and female rats were included to determine the sex-specific effects. While the effects of CIH on blood pressure in female rats appear to be protocol-dependent (21-23), our group recently reported that the mechanisms responsible for any changes in blood pressure produced by CIH in ovariectomized females did not correspond to the CNS activation in male rats (24). BDNF plays a role in the excitatory responses, and its expression is affected by sex in multiple brain areas, which may contribute to variations in pressor responses and synaptic activity in the MnPO following CIH (25-29). Based on the observed effects of CIH on excitatory postsynaptic currents recorded from PVN-projecting MnPO neurons, we tested the role of BDNF in these responses because it has both pre- and postsynaptic effects (30-33).

Materials and Methods:

Animals

Adult male and female Sprague-Dawley rats (250–300g body weight; Charles River, Wilmington, MA) were individually housed in a temperature-controlled (25°C) and humidity-controlled room on 12:12 light/dark cycle with light onset at 7:00 am. Based on vendor growth curves and published developmental timelines, male Sprague Dawley rats weighing 250–300 g (approximately 7–9 weeks) and females of the same weight (approximately 10–14 weeks) are both postpubertal and within the same early-life stage (young adults) (34). Food (Teklad LM-485 Rat Sterilizable Diet with 0.3% Sodium, Envigo, Somerset, NJ) and water were available ad libitum unless indicated otherwise. All experimental protocols were performed according to the National Institute of Health guide for the care and use of laboratory animals and approved by the Institutional Animal Care and Use Committee of the University of North Texas Health Science Center.

Stereotaxic Surgery

Rats were anesthetized with 2% isoflurane and received stereotaxic microinjections of 200 nL of a retrograde adeno-associated virus pAAV-CAG-tdTomato (59462-AAVrg, titer 7 × 1012 vg/mL, Addgene, Watertown, MA) bilaterally into the PVN (−1.8 mm anterior, ±0.3-0.4 mm lateral, and 7.5 mm ventral from bregma; Figure 1A)(15). Injections were made with 5μl Calibrated Microcapillary micropipettes (Drummond Scientific Company, Cat: 2-000-001, Broomall, PA) which were clamped to a standard electrode holder and connected to a 5 ml syringe with tubing and mounted on a Digital Lab Standard™ Stereotaxic instrument (Stoelting Co., Wood Dale, IL). The amount and rate of the injection was monitored using a dissecting microscope. At each injection site, the volume was delivered over 30 s to 1 min and the injector was left in place for 4 min to allow for virus absorption before slowly withdrawing the injection micropipette. Each rat was given a 1 mg carprofen tablet (po, Bio-Serv) to minimize pain following surgery. Two weeks following the injections, rats were either exposed to a 7-day intermittent hypoxia protocol or room air.

Figure 1:

Figure 1:

Open in a new tab

Digital images of brain slice preparations. A) Image from a horizontal brain slice demonstrating an injection site in the region of the PVN at the bottom of the image and retrograde labeling in the MnPO near the anterior third ventricle. Scale bar is 250 μM. B) Image from a sagittal brain slice along the anterior wall of the third ventricle illustrating retrograde labeling in the MnPO along the ventricular wall and around the anterior commissure. Scale bar is 250 μM. C) A higher power magnification image of MnPO neurons retrogradely labeled from the PVN. Scale bar is 25 μM.

Chronic Intermittent Hypoxia (CIH)

After 2 weeks of recovery following the PVN microinjection, rats were transferred in their home cages to hypoxia chambers (Oxycycler, Biospherix, Parish, NY). The CIH protocol consisted of 6-minute cycles: 3 minutes of 21% oxygen room air pumped in (normoxia), followed by 90 seconds of nitrogen pumped in to lower the chamber O2 to 10% oxygen, and maintained for another 90 seconds at 10% oxygen as previously described (20, 35) . These cycles were repeated 80 times per day (8:00 AM to 4:00 PM) for 7 days. During the remaining 16 h of the day, the chambers were maintained with room air (21% oxygen).

Acute MnPO Brain Slices Preparation

On the day following the last day of CIH treatment (Day 8), the rats (300-500g) were anesthetized with isoflurane (2-3%) and their brains were collected for either punch samples for quantitative reverse transcription polymerase chain reaction (qRT-PCR) or patch clamp recording as previously described (20, 35, 36). For PVN injection visualization and patch clamp recording, horizontal or sagittal brain slices (300 μM) containing the MnPO (Fig. 1 A-C) were prepared using ice-cold slicing aCSF (mM: 103 sucrose, 63 NaCl, 26 NaHCO3, 1.25 NaH2PO4, 3 KCl, 0.5 CaCl2, 6 MgCl2, 2 MgSO4 10 D-glucose) oxygenated with carbogen and a MicroSlicer™ Zero 1 (Ted Pella Inc., Redding, CA) equipped with double edge razor blades. The slices were transferred to a pre-warmed (34 °C) oxygenated aCSF (mM: 126 NaCl, 3 KCl,1.25 NaH2PO4, 26 NaHCO3, 2 CaCl2, 2 MgSO4, 10 D-glucose, pH 7.0, 310 mOsm/l) for about 30 minutes, then kept in aCSF at room temperature for 1 hour before the recording. All mEPSCs were recorded from only the sagittal slices. The horizontal slices were used to identify the PVN injection sites, but were not used for recording mEPSCs.

Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)

Rats were anesthetized with isoflurane, and their brains were removed as described above. Punch samples containing the MnPO (2-3 per rat) were collected from 1 mm thick coronal brain slices using 1 ml syringes equipped with blunt 23-gauge needles (37). The punches were ejected into microcentrifuge tubes and frozen in liquid nitrogen. Total RNA was extracted from frozen tissue using TRIzol™ reagent (Thermo Fisher Scientific (Ambion), Waltham, MA, USA) according to manufacturer’s instructions. Residual DNA was removed by treatment with DNase I (Turbo DNase Kit ,Invitrogen, ref# AM2238 ) The concentration and quality of each RNA sample was evaluated using a Nanodrop Spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) and reverse transcribed to cDNA with High Capacity cDNA Reverse transcriptase Kit (Thermo Fisher Scientific (Applied Biosystems) Ref # 4368814). Real-time PCR was performed on the CFX96 C1000 Cycler (Bio-Rad, Hercules, CA, USA) with SYBR green fluorescence labelling. Samples (final volume of 20 μL) contained: SYBR green master mix (Bio-Rad), 250 nmol of each primer and an equal concentration of cDNA. Amplification conditions were as follows: Hot start enzyme activation at 95°C for 5 min; PCR reaction at 95°C for 10 s, 60°C for 60 s, repeated for 40 cycles. A melting temperature-determining dissociation step was performed from 65°C to 95°C at increments of 0.5°C every 5 seconds at the end of the amplification phase. Forward and reverse primers for target genes were obtained from Integrated DNA Technologies (Coralville, IA, USA), BDNF Forward 5’ATGACCATCCTTTTCCTTACTATGGT – 3, BDNF Reverse 5’ – TCTTCCCCTTTTAATGGTCAGTGTAC −3’ (38). The housekeeping gene beta-Actin was used to normalize RNA expression (Bio-Rad PCR Assay, 10025636). Generated melting curves were analyzed to identify nonspecific products and primer-dimers. qPCR results were analyzed by the 2−ΔΔCt method (38, 39).

Miniature Excitatory Postsynaptic Currents (mEPSCs) Recording

Each MnPO slice was transferred from the holding chamber to a recording chamber and was continuously perfused with oxygenated aCSF at room temperature. MnPO was visually identified using an upright microscope (Nikon, Eclipse FN1). Whole-cell voltage clamp recordings (Vhold: −60 mV) were obtained using a MultiClamp 700B amplifier (Molecular Devices, San Jose, CA). All data were collected on MnPO neurons that were retrogradely labeled from the PVN (Figure 1). In horizontal slices, PVN injection sites were readily identifiable, as were MnPO neurons retrogradely labeled from those sites (Figure 1A). In sagittal slices, MnPO neurons retrogradely labeled from the PVN were also readily identifiable (Figure 1B-C).

Each recording was performed in the presence of the selective voltage-gated Na+ channel blocker tetrodotoxin (TTX, 1μM), the GABAA receptor antagonist -gabazine (SR 95531 hydrobromide, 25 μM), and the glycine receptor antagonist- strychnine (3 μM) to block Na+ channel-mediated action potentials and eliminate inhibitory GABAergic and glycinergic inputs. All agonists and antagonists were purchased from Tocris (Bristol, UK). The pipette solution contained the voltage-activated Na+ channels blocker - QX-314 (10 mM) and was composed of the following (in mM): 145 K-Gluconate, 1 MgCl2.6H2O, 10 HEPES, 1.1 EGTA, 2 Mg-ATP, 0.3 Na2-GTP (pH 7.3, 290–300 mOsm/l). For some experiments, the brain slices were pre-incubated with either a vehicle solution containing DMSO (100 μM) alone, K252a (200 nM), K252b (200 nM), or ANA-12 (10 μM) for 30 min before recording to assess the role of BDNF-mediated activation of tropomyosin receptor kinase B (TrkB) in neuronal excitability.

Data Analysis:

The mEPSCs were collected and analyzed offline using Mini-analysis (Synaptosoft). The following parameters of the mEPSCs were analyzed by two-way ANOVA using GraphPad software (v. 10 GraphPad Software, Boston, MA): amplitude, frequency, 10-90% rise time, decay time, area, and slope. The two factors were sex (male vs female) and treatment (Normoxia vs. CIH). Data from the qRT-PCR analysis were analyzed using the same two-way ANOVA design. In pharmacological experiments that used brain slices prepared from only males, the two factors were drug (DMSO, K252a, K252b, or ANA-12) and treatment (Normoxia vs. CIH). Significant main effects and interactions were further analyzed using Holm-Sidak’s multiple comparison tests. A level of p < 0.05 was required for significance.

Results

Effects of CIH on PVN-Projecting MnPO Neurons

Experiments were conducted to determine if CIH effects would be observed in MnPO neurons that project to the PVN. Whole-cell voltage-clamp recordings from labeled cells were obtained from 34 neurons from 12 male rats exposed to normoxia, 20 neurons from 4 female rats exposed to normoxia, 34 neurons from 18 male rats exposed to CIH, and 20 neurons from 3 female rats exposed to CIH. All MnPO neurons were retrogradely labeled from the PVN, and individual examples of mEPSC recorded from each group can be seen in Figure 2A.

Figure 2:

Figure 2:

Open in a new tab

Effects of CIH and sex on EPSCs recorded from PVN-projecting MnPO neurons. A) Individual examples of EPSCs recorded from a normoxic male and female (left, red) and CIH-exposed male and female (right, black). B) EPSC Frequency: CIH was associated with a significant increase in EPSC frequency in cells from male rats (Holm-Sidak CIH vs Norm t(104) = 2.74, P = 0.0286) but not in cells from females (CIH vs Norm t(104) = 0.4575, P = 0.648). However, EPSC frequency was higher in cells from female rats, independently of the effects of CIH as compared to EPSC frequency from normoxic control males (Norm Male vs Female t(104) = 4.473, P < 0.0001; Male Norm vs Female CIH t(104) = 3.96, P = 0.0007). C) EPSC Amplitude: The average amplitudes recorded from the normoxic control females were significantly increased as compared to either of the male treatment groups, indicating a sex-based difference (Holm-Sidak Norm Female vs Norm Male t(104) = 3.577, P = 0.0032; Norm Female vs CIH Male t(104) = 2.793, P = 0.0245). CIH significantly reduces EPSC amplitude in cells from female rats (Female CIH vs Norm t(104) = 2.985, P = 0.0176), but there was no effect of CIH in cells from males (Male CIH vs Norm t(104) = 0.91, P = 0.745).

In the PVN projecting MnPO neurons, there was a significant interaction of CIH and sex for mEPSC frequency (F(1, 104) = 4.122, P = 0.0449). CIH significantly increased mEPSC frequency in PVN-projecting MnPO neurons from male rats but not from female rats (Figure 2B). In cells from both normoxic controls and CIH female rats, mEPSC frequency was significantly higher in PVN-projecting MnPO neurons as compared to cells from normoxic male rats (Figure 2B).

mEPSC amplitude also had a significant interaction of CIH and sex (F(1, 104) = 8.532, P = 0.0043). CIH significantly decreased mEPSC amplitude in PVN-projecting MnPO neurons from female rats (t(104) = 2.985, P = 0.0035; Figure 2C) but not in PVN-projecting MnPO neurons from male rats. PVN-projecting MnPO neurons from normoxic females had a significantly greater mEPSC amplitude than neurons from both normoxic and CIH males (t(104) = 3.566, P = 0.0005; Figure 2C).

There were no significant effects of CIH or sex on mEPSC area or EPSC slope (Figures 3A & 3B). For mEPSC rise time, there was a significant main effect of sex with mEPSCs in cells from normoxic males having significantly greater rise times than mEPSCs recorded from females (F(1, 104) = 6.854; P = 0.0102; Figure 3C). There was a significant effect of CIH on mEPSC decay time with males and females both showing increases associated with CIH (F(1, 104) = 18.12, P < 0.0001; Figure 3D).

Figure 3:

Figure 3:

Open in a new tab

Effects of CIH and sex on EPSCs recorded from PVN-projecting MnPO neurons. A) EPSC Area: There were no effects of CIH or sex on EPSC area. B) EPSC Slope: There were no effects of CIH or sex on EPSC slope. C) EPSC Rise Time: The EPSC rise times recorded from cells from male rats were significantly longer than the rise times recorded from females, independent of CIH (main effect Sex F(1, 104) = 6.854, P = 0.0102). D) EPSC Decay Time: There was no influence of sex on decay time, but there was a main effect of CIH (F(1, 104) = 18.12, P <0.0001). CIH was associated with longer decay times in cells from both males and females.

Effects of CIH on MnPO BDNF

BDNF mRNA levels were measured in punch samples containing the MnPO that were collected from normoxic control male and female rats and rats of both sexes exposed to CIH. The overall analysis indicated that there was a significant interaction of CIH and sex on MnPO BDNF (F(1, 19) = 8.754, P = 0.0081). This interaction was due to a significant increase in BDNF in the MnPO of male rats exposed to CIH as compared to normoxic male rats and both groups of female rats (Figure 4).

Figure 4:

Figure 4:

Open in a new tab

Effects of CIH and sex on BDNF gene expression in the MnPO. CIH was associated with a significant increase in BDNF mRNA in the MnPO of male rats as compared to all of the other treatment groups (Holm-Sidak tests, Male Normoxic vs CIH, t(19) = 5.47, P < 0.0001; Male CIH vs Female CIH t(19) = 4.88, p<0.0001; Male CIH vs Female Normoxic t(19) = 5.776, P < 0.0001).

Contribution of TrkB/BDNF Signaling to the Effects of CIH on PVN-projecting MnPO Neurons

Since CIH significantly increased MnPO BDNF in male rats, we conducted a series of pharmacological studies to determine the role of TrkB/BDNF signaling in the effects of CIH on PVN-projecting MnPO neurons in slices prepared from male rats. This was accomplished by incubating the slices in TrkB antagonists before and during Whole-cell voltage-clamp recordings using different tyrosine kinase inhibitors. Vehicle control recordings were obtained from slices prepared from 3 male rats exposed to normoxia (19 cells) and from 2 male rats exposed to CIH (19 cells) using the bath solution described above with DMSO (100 μM) alone. In separate experiments, the following inhibitors were added to bath solution containing DMSO: K252a (200 nM, 17 cells from 3 normoxic male rats and 16 cells from 5 male rats exposed to CIH), K252b (200 nM, 17 cells from 3 normoxic control rats and 16 cells from 5 male rats exposed to CIH), and ANA-12 (10 μM, 28 cells from 6 normoxic male rats and 29 cells from 4 male rats exposed to CIH). Representative examples of recordings from each group are shown in Figure 5 and individual mEPSCs are shown in Figure 6A.

Figure 5:

Figure 5:

Open in a new tab

Examples of individual representative EPSC recordings and (B) normoxia (left, red) and CIH (right, black) after incubation in bath solutions containing DMSO vehicle (100 μM), K252a (200 nM), K252b (200 nM), and ANA-12 (10 μM).

Figure 6:

Figure 6:

Open in a new tab

A) Example of individual EPSCs recorded from slices prepared from male rats exposed to either normoxia (left, red) or CIH (right, black) after incubation in bath solutions containing DMSO vehicle (100 μM), K252a (200 nM), K252b (200 nM), and ANA-12 (10 μM). B) EPSC Frequency: CIH was associated with a significant increase in EPSC frequency as compared to normoxic controls (DMSO Norm vs CIH t(153) = 3.204, P = 0.0389). This increase was significantly reduced by all of the different drug treatments (CIH DMSO vs K252a t(153) = 6.74, P <0.0001; DMSO vs K252b t(153) = 3.07, P = 0.0102; DMSO vs. ANA-12 t(153) = 3.175, P =0.009). C) EPSC Amplitude: Pretreatment with ANA-12 significantly decreased EPSC amplitude only in cells from CIH-treated male rats as compared to cells from normoxic male rats exposed to ANA-12 (ANA-12 Norm vs. CIH t(153) = 2.291, P = 0.0233). The EPSC amplitudes of the ANA-12 treated cells from normoxic control male rats were also significantly increased as compared to 252b treated cells from normoxic controls (ANA-12 Normoxic vs K252b Normoxic t(153) = 3.648, P = 0.0022).

CIH was associated with a significant increase in mEPSC frequency that was CIH and drug dependent (CIH x Drug interaction F(3, 153) = 5.724, P = 0.0010, Figure 6B). In DMSO alone, CIH was associated with a significant increase in mEPSC frequency (Figure 6B), as observed previously (Figures 2A-B). This CIH effect was significantly blunted by all three drug treatments (Figure 6B). None of the drug treatments affected mEPSC frequency in recordings obtained from cells from normoxic control rats (Figure 6B).

For mEPSC amplitude, there were significant main effects of CIH (F(1, 153) 3.97, P = 0.048) and drug treatment (F(3, 153) = 5.55, P = 0.0012) but no interaction (F(3, 153) = 2.32, P = 0.078). There was no effect of CIH on mEPSC amplitude in the DMSO treatment cells (Figure 6C) as observed previously. No significant changes in amplitude were observed among the cells from normoxic males treated with DMSO alone, K252a, or ANA-12; however, K252a and ANA-12 treatments significantly decreased mEPSC amplitude in cells from CIH-treated male rats as compared to cells from normoxic male rats. The results indicated that the CIH-associated increases were blunted by K252a and ANA-12 treatments (Figure 6C).

Neither CIH nor any of the pharmacological interventions significantly influenced mEPSC area (Figure 7A). In contrast, there was a significant CIH by treatment interaction on mEPSC slope (CIH x Treatment, F(3, 153) = 5.33, P = 0.0016, Figure 7B). mEPSC slope was significantly decreased by CIH in the DMSO experiments (Figure 7B). However, all of the drugs tested significantly reduced mEPSC slope in cells from normoxic control rats as compared to DMSO-treated controls (Figure 7B). CIH did not decrease mEPSC slope in the presence of K252a (Figure 7B), but CIH did have effects in the cells treated with K252b and ANA-12. mEPSC slope was significantly increased by CIH with K252b treatment (Figure 7B)

Figure 7:

Figure 7:

Open in a new tab

Effects of TrKB inhibitors on EPSCs recorded from male rats exposed to normoxia or CIH. A) EPSC Area: There were no significant effects of CIH or drug treatment on EPSC area. B) EPSC Slope: CIH significantly decreased EPSC slope in the DMSO pretreated group (t(153) = 2.454, P = 0.0153). Pretreatment with K252a, K252b, and ANA-12 significantly reduced EPSC slope in normoxic controls as compared to the DMSO alone normoxic control group (Norm DMSO vs K252a t(153) = 12.65, P < 0.0001; DMSO vs K252b t(153) = 13.3, P < 0.0001; DMSO vs ANA-12 t(153) = 3.5, P = 0.0012). In cells pretreated with K252b, CIH significantly increased slope (t(153) = 2.442, P =0.0157). CIH significantly decreased slope in cells pretreated with ANA-12 (t(153) = 2.325, P = 0.0214). C) EPSC Rise Time: Because there was a significant main effect of drug treatment (F(3, 153) = 33.55, P < 0.0001), the follow-up analysis collapsed the normoxic and CIH groups for all drug treatments. Pretreatment with K252a was associated with a significant increase in rise time as compared to DMSO alone and ANA-12 pretreatments (K252a vs DMSO t(153) = 7.646, P < 0.0001; K252a vs ANA-12 t(153) = 7.11, P < 0.0001). Pretreatment with K252b had similar effects on rise time (K252b vs DMSO t(153) = 7.069, P < 0.0001; K252b vs ANA-12 t(153) = 6.483, P < 0.0001). D) EPSC Decay Time: CIH significantly increased decay time in DMSO pretreated cells (t(153) = 3.675, P = 0.0003). In normoxic controls, pretreatments with K252a and K252b significantly increased decay time as compared to the DMSO pretreated normoxic controls (DMSO vs K252a t(153) = 2.934, P = 0.0039; DMSO vs K252b t(153) = 2.547, P = 0.0119).

For mEPSC rise time, there was only a significant effect of drug treatment (F(3, 153) = 33.55, P 0< 0.001) due to increases in rise time associated with K252a and K252b treatment independent of CIH (Figure 7C). For mEPSC decay, there was a significant CIH by treatment interaction (F(3, 153) = 4.119, P = 0.0077; Figure 7D). This appears to be due to significant increases in mEPSC decay time in the presence of K252a and K252b as compared to the normoxic control groups (Norm DMSO vs. K252a t(153) = 2.934, P = 0.0003; Norm DMSO vs. K252b t(153) = 2.547, P = 0.0249; Figure 7D).

Discussion

This study tested the effects of CIH on mEPSCs recorded from PVN-projecting MnPO neurons. The CIH protocol that was used has previously been shown to increase blood pressure in male rats, and this increase in blood pressure is dependent on the PVN (40) and MnPO neurons that project to PVN (15). Female rats were included in these experiments because CIH has protocol-dependent effects on blood pressure in females (22, 23).

In PVN-projecting MnPO neurons, basal mEPSC frequency was higher in cells from females as compared to cells from males. Despite these sex-based differences in basal mEPSC frequency, CIH significantly increased mEPSC frequency in PVN-projecting MnPO neurons from male rats but not female rats, suggesting presynaptic facilitation by CIH within MnPO of male rats. In contrast, the effects of CIH and sex on mEPSC amplitude were different in PVN-projecting MnPO neurons. In preparations from female normoxic controls, mEPSC amplitude was significantly increased as compared to those recorded from normoxic and CIH males. CIH reduced mEPSC amplitude in PVN-projecting MnPO neurons from females. In this population of MnPO neurons, CIH increased decay time in cells from both males and females. For the mEPSC area and slope, there were no effects of either CIH or sex in PVN-projecting MnPO neurons. These results suggest that there are sex-based differences in the presynaptic and postsynaptic properties of mEPSCs in PVN-projecting MnPO neurons.

Previous studies have reported sex- and brain region-dependent differences in BDNF expression at baseline and under various conditions (25-27). We tested for changes in BDNF due to reports demonstrating that sensitization of the lamina terminalis, which includes the MnPO, by angiotensin or aldosterone infusions in male rats is associated with increased BDNF (41). The results in this study indicate that while BDNF message in the MnPO did not differ between sexes under normoxic conditions, CIH significantly increased the message for BDNF in the MnPO in male but not female rats, supporting a sex-dependent regulation of BDNF expression in the MnPO under hypoxic conditions. BDNF has regionally specific pre- and post-synaptic effects that can alter neuronal excitability (42-45). Therefore, its role in the CIH-induced increase in mEPSC frequency in male rats was tested using a series of kinase inhibitors.

When slices from male rats containing the MnPO were incubated in aCSF containing either K252a, K252b, or ANA-12, the increase in mEPSC frequency associated with CIH in PVN-projecting MnPO neurons was blocked. In preparations from normoxic control rats, mEPSC frequency was not affected by any of the kinase inhibitors, demonstrating that kinase signaling is not necessary for maintaining basal presynaptic release activity. These observations suggest that CIH produces a local increase in BDNF, which contributes to the increase in mEPSC frequency in PVN-projecting MnPO neurons. Thus, BDNF appears to contribute to presynaptic facilitation associated with CIH in the MnPO but not to postsynaptic mechanisms in male rats.

K252a and K252b had CIH-independent effects on mEPSC kinetics. Application of K252a and K252b resulted in a slower mEPSC. These effects do not appear to be related to local changes in BDNF and may involve alternative signaling mechanisms. Because K252a and K252b are relatively non-selective tyrosine kinase inhibitors that block multiple Trk family receptors and other kinases (46-48), baseline synaptic timing in MnPO neurons may be regulated by a broader tyrosine kinase network, not exclusively by TrkB. The changes in basal mEPSC kinetics upon application of K252a and K252b reflect tonic kinase-dependent regulation of synaptic dynamics.

In contrast to the broad effects of K252a and K252b, ANA-12 (a selective non-competitive TrkB antagonist) produced a more targeted synaptic phenotype (49). ANA-12 effectively blunted the CIH-induced increase in mEPSC frequency, confirming the necessity of Trkb activation for presynaptic facilitation. In addition, ANA-12 altered the mEPSC slope but did not affect the rise time, indicating that selective Trkb antagonism impacts postsynaptic properties, or reduces release probability or quantal content, although not to the extent produced by non-selective kinase inhibitors k252a and k252b, which affect both mEPSC slope and rise time.

Studies have shown that BDNF facilitates presynaptic plasticity and modifies postsynaptic receptors in many brain regions (42-45, 50, 51). The MnPO integrates inputs from chemosensory SFO neurons and sends projections to the PVN to influence sympathetic activity (52). Earlier studies have demonstrated the effects of BDNF on neuronal excitation in these regions adjacent to the MnPO in males. In the PVN, BDNF increases neuronal excitability by enhancing NMDA receptor signaling and reducing GABAA receptor signaling, leading to increased sympathetic activity and blood pressure (29, 53, 54). Mixed effects have been observed in the SFO, where both depolarizing and hyperpolarizing responses to BDNF occur (28). Our findings regarding altered mEPSC properties in MnPO neurons with inhibition of BDNF-TrkB signaling highlight the significant role of BDNF in synaptic modification within the MnPO, which aligns with reports from forebrain autonomic regions (28, 29, 53, 54). Taken together, these pharmacological data support a model in which CIH induces BDNF expression in the MnPO of male rats, which then activates TrkB-dependent presynaptic plasticity to increase excitatory drive in PVN-projecting neurons. While TrkB signaling is essential for the frequency component of this plasticity, additional kinase pathways modulate mEPSC kinetics and waveform properties, shaping how excitatory input is integrated and transmitted to downstream autonomic circuits, thereby influencing sympathetic activation and hypertension during CIH. This study presents some limitations. The males and females included in this study had comparable weights. Both groups were postpubertal young adults in a similar early stage of life, making significant maturational differences or the potential contribution of age to the results unlikely. However, we recognize that the modest age difference between them is a possible limitation of our study. It should be noted that although the use of distinct TrkB antagonists strengthens the conclusion that BDNF–TrkB signaling contributes to CIH-induced synaptic plasticity, K252a and K252b are relatively non-selective kinase inhibitors (46-48) and may affect additional signaling pathways beyond TrkB. As a result, some of the observed changes in mEPSC kinetics, particularly under normoxic conditions, may reflect disruption of broader kinase-dependent synaptic regulation beyond TrkB-specific effects. Moreover, while changes in mEPSC frequency are consistent with presynaptic mechanisms, direct measures of synaptic function from MnPO cells with targeted but not global BDNF-Trkb inhibition were not obtained. Future studies using chemogenetic, optogenetic, or gene-silencing approaches will be necessary to definitively localize the role of BDNF-TrkB signaling in the MnPO. While our study reveals interactions between sex and CIH on BDNF mRNA expression and synaptic activity in the MnPO, we did not directly examine the mechanisms driving the sex-specific effects in BDNF mRNA expression and synaptic activity in the PVN-projecting MnPO neurons. Given accumulating evidence for gonadal hormone contributions to differences in electrophysiological and synaptic properties in brain regions, including nearby preoptic regions and hippocampus (28, 55), we speculate that hormones may play a role in the sex differences we observed in the MnPO. Others have also found sex differences in enzymatic and neuronal activity in several brain regions, which can potentially contribute to our observations (56). Future studies should more comprehensively investigate the effects of sex hormones, sex chromosomes, and epigenetic factors on BDNF and synaptic plasticity along the MnPO–PVN axis. Our study did not determine the impact of hormonal changes across the estrous cycle on BDNF expression and neuronal activity within the MnPO in female rats. Future investigations will explore how estrous cycling interact with BDNF signaling in the MnPO and downstream autonomic centers in females under normoxic and CIH conditions. Currently, pharmacological blockade of TrkB signaling within the CNS is not a clinically viable strategy due to the role of BDNF in cognition, mood regulation, and neurodevelopment. Future work will need to explore targeted inhibition of BDNF-TrkB within autonomic circuits to limit off-target effects of global TrkB inhibition within the CNS.

ACKNOWLEDGMENTS

The graphical abstract was created with BioRender and published with permission.

GRANTS

This study was funded by the National Heart, Lung, and Blood Institute Grant R01 HL155977 (to GEF & JTC)

Footnotes

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

References

  • 1.McKinley MJ, Yao ST, Uschakov A, McAllen RM, Rundgren M, and Martelli D. The median preoptic nucleus: front and centre for the regulation of body fluid, sodium, temperature, sleep and cardiovascular homeostasis. Acta Physiol (Oxf) 214: 8–32. doi: 10.1111/apha.12487. Epub 12015 Apr 12481., 2015. [DOI] [PubMed] [Google Scholar]
  • 2.McKinley MJ, Bicknell RJ, Hards D, McAllen RM, Vivas L, Weisinger RS, and Oldfield BJ. Efferent neural pathways of the lamina terminalis subserving osmoregulation. Prog Brain Res 91: 395–402, 1992. [DOI] [PubMed] [Google Scholar]
  • 3.Zardetto-Smith AM, Thunhorst RL, Cicha MZ, and Johnson AK. Afferent signaling and forebrain mechanisms in the behavioral control of extracellular fluid volume. Ann N Y Acad Sci 689: 161–176, 1993. [DOI] [PubMed] [Google Scholar]
  • 4.Johnson AK, Zhang Z, Clayton SC, Beltz TG, Hurley SW, Thunhorst RL, and Xue B. The roles of sensitization and neuroplasticity in the long-term regulation of blood pressure and hypertension. Am J Physiol Regul Integr Comp Physiol 309: R1309–1325, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Brody MJ. Central nervous system and mechanisms of hypertension. Clin Physiol Biochem 6: 230–239, 1988. [PubMed] [Google Scholar]
  • 6.Ployngam T, and Collister JP. An intact median preoptic nucleus is necessary for chronic angiotensin II-induced hypertension. Brain Res 1162: 69–75, 2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ployngam T, Katz SS, and Collister JP. Role of the median preoptic nucleus in the chronic hypotensive effect of losartan in sodium-replete normal rats. Clin Exp Pharmacol Physiol 37: e7–13, 2010. [DOI] [PubMed] [Google Scholar]
  • 8.Collister JP, Fritcher N, and Nahey D. Role of the median preoptic nucleus in the development of chronic deoxycorticosterone acetate (DOCA)-salt hypertension. Physiol Rep 12: e16046, 2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ployngam T, and Collister JP. Role of the median preoptic nucleus in chronic angiotensin II-induced hypertension. Brain Res 1238: 75–84, 2008. [DOI] [PubMed] [Google Scholar]
  • 10.Collister JP, Ployngam T, Ariza-Guzman PA, and Osborn JW. Neurons of the median preoptic nucleus contribute to chronic angiotensin II-salt induced hypertension in the rat. Physiol Rep 10: e15551, 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Collister JP, Bellrichard M, Drebes D, Nahey D, Tian J, and Zimmerman MC. Over-expression of copper/zinc superoxide dismutase in the median preoptic nucleus attenuates chronic angiotensin II-induced hypertension in the rat. International journal of molecular sciences 15: 22203–22213, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fletcher EC, Lesske J, Culman J, Miller CC, and Unger T. Sympathetic denervation blocks blood pressure elevation in episodic hypoxia. Hypertension 20: 612–619, 1992. [DOI] [PubMed] [Google Scholar]
  • 13.Fletcher EC, Lesske J, Qian W, Miller CC 3rd, and Unger T, . Repetitive, episodic hypoxia causes diurnal elevation of blood pressure in rats. Hypertension 19: 555–561, 1992. [DOI] [PubMed] [Google Scholar]
  • 14.Cunningham JT, Knight WD, Mifflin SW, and Nestler EJ. An essential role for ΔFosB in the median preoptic nucleus in the sustained hypertensive effects of chronic intermittent hypoxia. Hypertension 60: 179–187, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Marciante AB, Wang LA, Little JT, and Cunningham JT. Caspase lesions of PVN-projecting MnPO neurons block the sustained component of CIH-induced hypertension in adult male rats. American journal of physiology Heart and circulatory physiology 318: H34–h48, 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Paundralingga OT, Jia S, Farmer GE Jr., Toney GM, and Cunningham JT. Optogenetic stimulation of the median preoptic nucleus: Effects on hypothalamic paraventricular nucleus magnocellular neurons after chronic intermittent hypoxia exposure. J Neuroendocrinol 38: e70100, 2026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mourão AA, de Mello ABS, Dos Santos Moreira MC, Rodrigues KL, Lopes PR, Xavier CH, Gomes RM, Freiria-Oliveira AH, Blanch GT, Colombari E, and Pedrino GR. Median preoptic nucleus excitatory neurotransmitters in the maintenance of hypertensive state. Brain Res Bull 142: 207–215, 2018. [DOI] [PubMed] [Google Scholar]
  • 18.Mourão AA, Moreira MC, Melo AB, Lopes PR, Rebelo AC, Rosa DA, Freiria-Oliveira AH, Colombari E, and Pedrino GR. Does the median preoptic nucleus contribute to sympathetic hyperactivity in spontaneously hypertensive rats? Auton Neurosci 195: 29–33, 2016. [DOI] [PubMed] [Google Scholar]
  • 19.Farmer GE, Balapattabi K, Bachelor ME, Little JT, and Cunningham JT. AT1a influences GABAA-mediated inhibition through regulation of KCC2 expression. Am J Physiol Regul Integr Comp Physiol 315: R972–r982, 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Farmer GE, Little JT, Marciante AB, and Cunningham JT. AT1a-dependent GABA(A) inhibition in the MnPO following chronic intermittent hypoxia. Am J Physiol Regul Integr Comp Physiol 321: R469–r481, 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Appiah CB, Gardner JJ, Farmer GE, Cunningham RL, and Cunningham JT. Chronic intermittent hypoxia-induced hypertension: the impact of sex hormones. Am J Physiol Regul Integr Comp Physiol 326: R333–R345, 2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hinojosa-Laborde C, and Mifflin SW. Sex differences in blood pressure response to intermittent hypoxia in rats. Hypertension 46: 1016–1021, 2005. [DOI] [PubMed] [Google Scholar]
  • 23.Souza GM, Bonagamba LG, Amorim MR, Moraes DJ, and Machado BH. Cardiovascular and respiratory responses to chronic intermittent hypoxia in adult female rats. Exp Physiol 100: 249–258, 2015. [DOI] [PubMed] [Google Scholar]
  • 24.Appiah CB, Little JT, Farmer GE, Cunningham RL, and Cunningham JT. Chronic Intermittent Hypoxia and Ovariectomy Exert Independent and Region-specific Effects on ΔFosB Expression and Increase Blood Pressure in Female Rats. Am J Physiol Regul Integr Comp Physiol 2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kight KE, and McCarthy MM. Sex differences and estrogen regulation of BDNF gene expression, but not propeptide content, in the developing hippocampus. J Neurosci Res 95: 345–354, 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Carbone DL, and Handa RJ. Sex and stress hormone influences on the expression and activity of brain-derived neurotrophic factor. Neuroscience 239: 295–303, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wei YC, Wang SR, and Xu XH. Sex differences in brain-derived neurotrophic factor signaling: Functions and implications. J Neurosci Res 95: 336–344, 2017. [DOI] [PubMed] [Google Scholar]
  • 28.Black EAE, Smith PM, McIsaac W, and Ferguson AV. Brain-derived neurotrophic factor acts at neurons of the subfornical organ to influence cardiovascular function. Physiol Rep 6: e13704, 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Erdos B, Backes I, McCowan ML, Hayward LF, and Scheuer DA. Brain-derived neurotrophic factor modulates angiotensin signaling in the hypothalamus to increase blood pressure in rats. Am J Physiol Heart Circ Physiol 308: H612–622, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Colino-Oliveira M, Rombo DM, Dias RB, Ribeiro JA, and Sebastião AM. BDNF-induced presynaptic facilitation of GABAergic transmission in the hippocampus of young adults is dependent of TrkB and adenosine A2A receptors. Purinergic Signal 12: 283–294, 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gibon J, Barker PA, and Séguéla P. Opposing presynaptic roles of BDNF and ProBDNF in the regulation of persistent activity in the entorhinal cortex. Mol Brain 9: 23, 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pan E, Zhao Z, and McNamara JO. LTD at mossy fiber synapses onto stratum lucidum interneurons requires TrkB and retrograde endocannabinoid signaling. J Neurophysiol 121: 609–619, 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Thapliyal S, Arendt KL, Lau AG, and Chen L. Retinoic acid-gated BDNF synthesis in neuronal dendrites drives presynaptic homeostatic plasticity. Elife 11: 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Fuochi S, Galasso ME, Colombo R, Giaquinto D, De Girolamo P, and D'Angelo L. Puberty onset curve in CD (Sprague Dawley) and Long Evans outbred male rats. Lab Anim 56: 471–475, 2022. [DOI] [PubMed] [Google Scholar]
  • 35.Jia S, Rybalchenko N, Kunwar K, Farmer GE Jr., Little JT, Toney GM, and Cunningham JT. Chronic intermittent hypoxia enhances glycinergic inhibition in nucleus tractus solitarius. J Neurophysiol 128: 1383–1394, 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Marciante AB, Farmer GE, and Cunningham JT. G(q) DREADD activation of CaMKIIa MnPO neurons stimulates nitric oxide activity. J Neurophysiol 124: 591–609, 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Shell B, Farmer GE, Nedungadi TP, Wang LA, Marciante AB, Snyder B, Cunningham RL, and Cunningham JT. Angiotensin type 1a receptors in the median preoptic nucleus support intermittent hypoxia-induced hypertension. Am J Physiol Regul Integr Comp Physiol 316: R651–R665, 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Balapattabi K, Little JT, Bachelor M, and Cunningham JT. Brain-Derived Neurotrophic Factor and Supraoptic Vasopressin Neurons in Hyponatremia. Neuroendocrinology 110: 630–641, 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Carreno FR, Walch JD, Dutta M, Nedungadi TP, and Cunningham JT. Brain-derived neurotrophic factor-tyrosine kinase B pathway mediates NMDA receptor NR2B subunit phosphorylation in the supraoptic nuclei following progressive dehydration. J Neuroendocrinol 23: 894–905, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sharpe AL, Calderon AS, Andrade MA, Cunningham JT, Mifflin SW, and Toney GM. Chronic intermittent hypoxia increases sympathetic control of blood pressure: Role of neuronal activity in the hypothalamic paraventricular nucleus. American Journal of Physiology - Heart and Circulatory Physiology 305: H1772–H1780, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Clayton SC, Zhang Z, Beltz T, Xue B, and Johnson AK. CNS neuroplasticity and salt-sensitive hypertension induced by prior treatment with subpressor doses of ANG II or aldosterone. Am J Physiol Regul Integr Comp Physiol 306: R908–917, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Clark CG, Hasser EM, Kunze DL, Katz DM, and Kline DD. Endogenous brain-derived neurotrophic factor in the nucleus tractus solitarius tonically regulates synaptic and autonomic function. J Neurosci 31: 12318–12329, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kim YI, Choi HJ, and Colwell CS. Brain-derived neurotrophic factor regulation of N-methyl-D-aspartate receptor-mediated synaptic currents in suprachiasmatic nucleus neurons. J Neurosci Res 84: 1512–1520, 2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sherwood NT, and Lo DC. Long-term enhancement of central synaptic transmission by chronic brain-derived neurotrophic factor treatment. J Neurosci 19: 7025–7036, 1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Wu Y, Liu Q, Guo B, Ye F, Ge J, and Xue L. BDNF Activates Postsynaptic TrkB Receptors to Induce Endocannabinoid Release and Inhibit Presynaptic Calcium Influx at a Calyx-Type Synapse. J Neurosci 40: 8070–8087, 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Zong Z, Fujikawa-Yamamoto K, Li A, Yamaguchi N, Chang YG, Murakami M, Tanino M, and Odashima S. Cell membrane changes of structure and function in protein kinase inhibitor-induced polyploid cells. Cell Prolif 33: 29–38, 2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kase H, Iwahashi K, Nakanishi S, Matsuda Y, Yamada K, Takahashi M, Murakata C, Sato A, and Kaneko M. K-252 compounds, novel and potent inhibitors of protein kinase C and cyclic nucleotide-dependent protein kinases. Biochem Biophys Res Commun 142: 436–440, 1987. [DOI] [PubMed] [Google Scholar]
  • 48.Knusel B, and Hefti F. K-252 compounds: modulators of neurotrophin signal transduction. J Neurochem 59: 1987–1996, 1992. [DOI] [PubMed] [Google Scholar]
  • 49.Cazorla M, Premont J, Mann A, Girard N, Kellendonk C, and Rognan D. Identification of a low-molecular weight TrkB antagonist with anxiolytic and antidepressant activity in mice. J Clin Invest 121: 1846–1857, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kovalchuk Y, Hanse E, Kafitz KW, and Konnerth A. Postsynaptic Induction of BDNF-Mediated Long-Term Potentiation. Science 295: 1729–1734, 2002. [DOI] [PubMed] [Google Scholar]
  • 51.Fortin DA, Srivastava T, Dwarakanath D, Pierre P, Nygaard S, Derkach VA, and Soderling TR. Brain-derived neurotrophic factor activation of CaM-kinase kinase via transient receptor potential canonical channels induces the translation and synaptic incorporation of GluA1-containing calcium-permeable AMPA receptors. J Neurosci 32: 8127–8137, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.McKinley MJ, Pennington GL, and Ryan PJ. The median preoptic nucleus: A major regulator of fluid, temperature, sleep, and cardiovascular homeostasis. Handb Clin Neurol 179: 435–454, 2021. [DOI] [PubMed] [Google Scholar]
  • 53.Thorsdottir D, Einwag Z, and Erdos B. BDNF shifts excitatory-inhibitory balance in the paraventricular nucleus of the hypothalamus to elevate blood pressure. J Neurophysiol 126: 1209–1220, 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Schaich CL, Wellman TL, Einwag Z, Dutko RA, and Erdos B. Inhibition of BDNF signaling in the paraventricular nucleus of the hypothalamus lowers acute stress-induced pressor responses. J Neurophysiol 120: 633–643, 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Zhang W, Li SS, Han Y, and Xu XH. Sex Differences in Electrophysiological Properties of Mouse Medial Preoptic Area Neurons Revealed by In Vitro Whole-cell Recordings. Neurosci Bull 37: 166–182, 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Mabry S, Bradshaw JL, Gardner JJ, Wilson EN, Sunuwar J, Yeung H, Shrestha S, Cunningham JT, and Cunningham RL. The impact of chronic intermittent hypoxia on enzymatic activity in memory-associated brain regions of male and female rats. Biol Sex Differ 16: 5, 2025. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES