Skip to main content
NCBI home page
Research in Pharmaceutical Sciences logoLink to Research in Pharmaceutical Sciences
. 2026 Sep 8;21(5):657–669. doi: 10.4103/RPS.RPS_14_26

Mechanistic insights into sitagliptin’s action in rat inflammatory bowel disease: involvement of the NO-cGMP-KATP pathway

Hasti Dehestani 1, Behnam Ghorbanzadeh 2,*, Tarang Taghvaei Arabi 3,4, Mohammad Seydabadi 5, Fereshteh Beigom Talebpour Amiri 6, Ramin Ataee 5, Mohammad Shokati Sayyad 7, Sara Bayat 3,4, Gholamreza Houshmand 3,1,*
PMCID: PMC13637935  PMID: 42836221

Abstract

Background and purpose:

Inflammatory bowel disease (IBD) involves several intestinal disorders that lead to prolonged inflammation of the gastrointestinal tract. Sitagliptin is an antidiabetic drug that works by increasing incretin hormones. This study examined the effect of sitagliptin, as well as the contribution of the NO-cGMP-KATP channel pathway, in acetic acid-induced colitis.

Experimental approach:

To induce colitis in rats, 4% acetic acid was administered intrarectally. Subsequently, the animals were intraperitoneally pretreated with L-arginine, L-NAME, sildenafil, methylene blue, diazoxide, and glibenclamide for 3 consecutive days, 15 min before sitagliptin administration (90 mg/kg. p.o.). Finally, microscopic and macroscopic parameters and inflammatory indices, apoptotic gene expression, and histopathological observation were evaluated in colon tissue.

Findings/Results:

The findings showed that sitagliptin diminished both the macroscopic and microscopic injuries caused by acetic acid and also decreased IL-1β and TNF-α levels and TNF-α gene expression. Moreover, it enhanced the gene expression of BCL2. The findings revealed that the effects of sitagliptin were significantly reduced by L-NAME (NOS inhibitor), methylene blue (guanylate cyclase inhibitor), and glibenclamide (ATP-sensitive potassium channel blocker). In addition, pretreatment with L-arginine, diazoxide, and sildenafil preserved the protective effect of sitagliptin.

Conclusion and implications:

Finally, this study revealed that sitagliptin effectively alleviated acetic acid-induced colonic tissue injury by reducing inflammation and regulating genes involved in apoptosis. The NO-cGMP-KATP channel pathway plays a significant role in mediating this protective effect.

Keywords: cGMP, Inflammatory bowel disease, Katp channels, Nitric oxide, Sitagliptin.

graphic file with name RPS-21-657-g001.jpg

INTRODUCTION

Inflammatory bowel disease (IBD) is a persistent and progressive disease of the gastrointestinal tract that typically manifests in two main types, including ulcerative colitis and Crohn’s disease. Both disorders lead to chronic inflammation of the intestinal mucosa, causing symptoms such as diarrhea, weight loss, abdominal pain, and severe fatigue (1,2). However, the precise mechanisms underlying IBD onset are not fully understood; research indicates that abnormal activation of immune cells is crucial to its initiation and progression. A dysregulated immune response to environmental, genetic, and gut microbiome factors leads to increased immune cell activity and accumulation in the intestinal wall (3,4). When immune cells encounter specific antigens or stimuli, they secrete inflammatory cytokines such as interleukin-1beta (IL-1β) and tumor necrosis factor-alpha (TNF-α). These cytokines exacerbate inflammation, cause tissue damage, and harm the intestinal mucosal lining, leading to intensified symptoms of disease (3,5).

Previous studies indicated that several molecular pathways are potentially involved in the amelioration of IBD. Some of these pathways include the production and regulation of nitric oxide (NO), the activation of guanylate cyclase and cyclic guanosine monophosphate (cGMP), and the regulation of ATP-sensitive potassium (KATP) channel function (6,7).

Numerous studies have indicated that the production of NO is advantageous in animal models of experimental colitis; however, excessive NO production may worsen inflammation and mucosal injury. Additionally, by scavenging superoxide, NO can potentially prevent the formation of peroxynitrite, thereby protecting the enzymes engaged in the biosynthesis of leukotrienes and prostaglandins (8).

The activation of the guanylate cyclase enzyme by NO causes cGMP synthesis. This molecule plays a crucial role in modulating inflammation and regulatory mechanisms, including the reduction of leukocyte adhesion to the endothelium, the inhibition of platelet aggregation, and the regulation of vascular tone (8,9).

Furthermore, evidence suggests that the activation of KATP channels exerts anti-inflammatory effects through inhibiting the efflux of reactive oxygen species (ROS) from mitochondria. Thus, potassium channel openers may offer therapeutic benefits in managing inflammation-related conditions (3). Therefore, the use of drugs and compounds that target these pathways may represent an effective approach for reducing inflammation and improving clinical symptoms of IBD.

Currently, aminosalicylates and glucocorticoids are the primary medications for the treatment of IBD. Although these drugs are effective, they have numerous side effects. Therefore, research into new medications for the management of IBD is ongoing (10).

Sitagliptin is an oral medication belonging to the group of dipeptidyl peptidase-4 (DPP-4) inhibitors, which is utilized for managing type 2 diabetes. This drug exerts its effect by preventing the activity of the DPP-4 enzyme, which enzymatically degrades incretin hormones such as glucagon-like peptide-1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP), leading to increased levels of these gastrointestinal hormones. Incretin hormones stimulate insulin secretion and simultaneously inhibit glucagon release from pancreatic alpha cells. This mechanism leads to increased insulin production and reduced blood glucose levels (11,12,13). Moreover, several studies have mentioned the possible role of NO in the mechanistic actions of sitagliptin (14). Consequently, in the current study, we explored the role of the NO-cGMP-KATP pathway as a potential mechanism underlying sitagliptin’s effects in a rat model of IBD.

MATERIALS AND METHODS

Animals

Male Wistar rats, with an average weight of 220 ± 20 g and aged 9 to 10 weeks, were procured from the animal facility of Mazandaran University of Medical Sciences, Sari, Iran. The rats were kept under standard conditions (relative humidity ranging from 60% to 70%, a controlled room temperature of 24 ± 2 °C, and a 12/12-h light/dark cycle) with unrestricted access to both water and food, in polycarbonate cages.

Moreover, the Research Ethics Committee of Mazandaran University of Medical Sciences approved the present study (Ethics code: IR.MAZUMS.AEC.1404.055). All experimental procedures were also performed in compliance with established research ethics standards.

Drug and chemicals

Sitagliptin and glibenclamide were obtained from Mahban Shimi Co. (Tehran, Iran). L-arginine hydrochloride, N-ω-nitro-L-arginine methyl ester (L-NAME), sildenafil, methylene blue, and diazoxide were sourced from Sigma-Aldrich (St. Louis, MO, USA).

In the present study, L-arginine was used as an inducer of NO synthase (NOS), while L-NAME was utilized as a non-selective inhibitor of NOS, sildenafil as an inhibitor of phosphodiesterase type 5, methylene blue as an inhibitor of guanylate cyclase, diazoxide as an opener of KATP channel, and glibenclamide as an inhibitor of this channel.

The medications were dissolved in a 0.9% solution of NaCl and administered in a volume of 10 mL/kg body weight. The method of dosing and administration was chosen based on our experiments in the laboratory or other available literature (3,15).

Colitis induction procedure

To induce colitis in rats, the protocol described by McPherson and Pfeiffer was used (16). The animals received general anesthesia that was induced by intraperitoneal administration of ketamine (90 mg/kg) combined with xylazine (10 mg/kg), and a plastic catheter with a length of 8 cm was introduced into the rats’ colon. Following this, 4% acetic acid (1 mL) was administered intrarectally. To reduce the risk of acetic acid leakage, the rats were held upside down for 1 min.

Experimental design

Sitagliptin was administered at 30, 60, and 90 mg/kg (p.o.) 1 h after the intrarectal instillation of 4% acetic acid, and the treatment continued for three days (on days 2 and 3). To investigate the role of the studied pathway, stimulatory and inhibitory agents (L-arginine, L-NAME, sildenafil, methylene blue, diazoxide, and glibenclamide) were administered intraperitoneally 15 min before sitagliptin administration (3).

In this study, 96 rats were randomly assigned into 16 groups (N = 6), including:

Group 1 received normal saline and served as the sham group; groups 2-4 were given 30, 60, and 90 mg/kg sitagliptin (p.o.), respectively; groups 5 and 6 received 750 mg/kg L-arginine and 10 mg/kg L-NAME (i.p.), respectively, followed by 90 mg/kg sitagliptin administration; groups 7 and 8 received merely L-arginine (750 mg/kg, i.p.) or L-NAME (10 mg/kg, i. p.); and were then injected with saline; groups 9 and 10 received 5 mg/kg (i.p.) sildenafil and 20 mg/kg (i.p). methylene blue, respectively, followed by 90 mg/kg sitagliptin administration; groups 11 and 12 received sildenafil (5 mg/kg, i. p.) or methylene blue (20 mg/kg, i. p.) alone, followed by saline injection; groups 13 and 14 received diazoxide (3 mg/kg, i.p.) or glibenclamide (1 mg/kg, i.p.), respectively, followed by 90 mg/kg sitagliptin administration; groups 15 and 16 received merely diazoxide (3 mg/kg, i.p.) or glibenclamide (1 mg/kg, i.p.), followed by saline injection. All treatments were performed for 3 consecutive days after the rectal instillation of 4% acetic acid.

On the 4th day, the animals were euthanized using CO2 chamber. After shaving the abdominal skin, a surgical incision was made. The final 8-cm segment of the colon was then carefully isolated, opened lengthwise, and rinsed. Subsequently, the colon tissues were split into two pieces: one portion was placed in 10% formalin solution for histological examination, while the other part was frozen at -80 °C for biochemical analyses and gene expression studies.

Colonic damage assessment

The macroscopic evaluations were conducted by an independent observer utilizing a magnifying glass. The following criteria were utilized for scoring: 0, no macroscopic changes; 1, limited erythema in the mucosa; 2, mild mucosal edema with erosion or minor bleeding; 3, moderate edema with erosion or bleeding ulcers; 4, severe edema with extensive ulcers and necrosis in the colonic tissue (17).

Measurement of pro-inflammatory cytokine levels

The colon tissues were first homogenized in a 0.1 M phosphate buffer with a pH of 7.4 at a concentration of 10% using an FSH-2A homogenizer. The resulting homogenate was centrifuged at 1000 rpm for 15 min at 4 °C using a refrigerated centrifuge (Hettich Zentrifugen, Germany) to eliminate healthy cells and cellular debris. The protein content of the tissue homogenate was assessed using the Bradford method (18). The tissue homogenate was then used to measure inflammatory biomarkers, including IL-1β and TNF-α.

The levels of TNF-α and IL-1β were quantified using the ELISA kit from Karmania Pars Gene (Kerman, Iran). The results were reported as picograms per gram of tissue (pg/g tissue).

Quantitation of TNF-α, Bcl-2-associated X protein, and B-cell lymphoma 2 gene expression

To quantify mRNA expression levels of Bcl-2-associated X protein (BAX), B-cell lymphoma 2 (BCL2), and TNF-α in rat colon tissue, gene expression analysis was conducted. Immediately post-euthanasia, colon tissue samples were collected and promptly immersed in RNA shield solution (DENA Zist Asia, Iran) to preserve RNA integrity, then stored at -80 °C until processing. Total RNA was separated employing the Pars Toos total RNA extraction kit (Mashhad, Iran), which utilizes a silica column-based protocol to ensure high RNA yield and purity, critical for downstream applications. The purity and concentration of extracted RNA were evaluated spectrophotometrically (Agilent Technologies, USA) by measuring absorbance at 230, 260, and 280 nm. RNA integrity was further verified by agarose gel electrophoresis, with gel images captured using a Biorad documentation system (USA).

Complementary DNA (cDNA) was synthesized utilizing a commercial kit (Pars Toos Company, Iran) in a PCR thermocycler (Biorad, USA), following the manufacturer’s protocol. Quantitative real-time polymerase chain reaction (qRT-PCR) assays were conducted on a Corbett Rotor-Gene 6000 platform (Qiagen, Germany) employing gene-specific primers and optimized cycling conditions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was utilized as the internal control to normalize the target gene expression, adhering to recognized standards for reference gene selection in qRT-PCR. Relative quantification of gene expression was determined utilizing the 2-ΔΔCT comparative method, as outlined in Table 1.

Table 1.

The primers used for real-time polymerase chain reaction in this study.

Gene Primer sequences (5 '-3 ') Thermal condition
BAX Forward: CCAAGAAGCT GAGCGAGT GT Reverse: TGTCCAGCCCATGATGGTTC 95 °C, 5 min 40 cycles (95 °C, 20 s; 65 °C, 20 s; 72 °C, 20 s) 72 °C, 5min
BCL2 Forward: CTGTGGATGACTGAGTACCTGA Reverse: AGCCAGGAGAAATCAAACAGAGG 95 °C, 5 min 40 cycles (95 °C, 20 s; 65 °C, 20 s; 72 °C, 20 s) 72 °C, 5min
TNF-α Forward: TCAGCCTCTTCTCATTCCTGCT Reverse: GCCATTGAACTGATGAGAGGGA 95 °C, 5 min 40 cycles (95 °C, 20 s; 63 °C, 20 s; 72 °C, 20 s) 72 °C, 5 min
Open in a new tab

Histopathological assessment

Following fixation, the intestinal tissues were dehydrated by graded alcohols, clarified by xylene, and embedded in paraffin. The samples were cut into 5-μm sections utilizing a microtome and then stained with hematoxylin and eosin (H&E). Afterward, a histologist investigated the slides with a light microscope (Olympus, Japan).

Statistical analysis

GraphPad Prism software (version 8.5, San Diego, CA, United States) was utilized for statistical examination. The results were expressed as mean ± SEM. The Kolmogorov-Smirnov test was employed to evaluate the normality of the data. Comparison of means was carried out using one-way ANOVA followed by Tukey’s post hoc test. P-values ≤ 0.05 were deemed significant.

RESULTS

Dose-response of sitagliptin on macroscopic appearance

In the first stage, we conducted a dose-response experiment to determine the optimal dose of sitagliptin. As shown in Fig. 1, no colonic lesions were observed in the sham group, which received normal saline rectally. The group treated with acetic acid exhibited severe tissue damage, and the macroscopic score of colonic damage was significantly enhanced compared to the sham group. On the other hand, sitagliptin administration dose-dependently ameliorated the colonic tissue damage, and in the group receiving 90 mg/kg of sitagliptin, the macroscopic score was significantly reduced compared with the group receiving acetic acid alone. Therefore, we selected the 90 mg/kg dose of sitagliptin to be combined with other experimental agents.

Fig. 1.

Fig. 1

Open in a new tab

Dose-Response of sitagliptin on the macroscopic score of colon tissue damage. The results are presented as the means ± SEM (n = 6). ***P < 0.001 indicates significance difference compared to the sham group; ###P < 0.001 versus the acetic acid group.

The involvement of the NO pathway in sitagliptin’s therapeutic effects

To evaluate the role of the NO pathway in the impacts of sitagliptin, the animals were pretreated with either the NOS inhibitor (L-NAME) or the NOS inducer (L-arginine). As shown in Fig. 2, the administration of L-arginine before sitagliptin significantly reduced the macroscopic score of colonic damage compared to the acetic acid-treated group. Moreover, this group did not exhibit a significant difference compared to the group that merely received sitagliptin (P > 0.05; Fig. 2A). In contrast, pretreatment with L-NAME before the sitagliptin significantly increased the macroscopic colonic injury score compared to the sitagliptin-only group (P < 0.05), thereby disrupting the protective effect of sitagliptin on macroscopic injury (Fig. 2B). Additionally, the administration of L-arginine or L-NAME alone did not produce any significant effects compared to the acetic acid group (P > 0.05).

Fig. 2.

Fig. 2

Open in a new tab

Assessment of the NO’s involvement in the protective effect of sitagliptin (90 mg/kg) on the score of macroscopic damage of colon tissue. A and B show the pretreatment effect of L-Arg (750 mg/kg) and L-NAME (10 mg/kg) on the effect of sitagliptin, respectively. The sham group received no treatment. The results are presented as the means ± SEM, n = 6. ***P < 0.001 indicates significant differences compared to the sham group; ##P < 0.01 and ###P < 0.001 versus the acetic acid group; &P < 0.05 against the sitagliptin-treated group. NO, Nitric oxide; Sita, sitagliptin; L-Arg, L-arginine hydrochloride; L-NAME, N-ω-nitro-L-arginine methyl ester.

The involvement of the cGMP pathway in sitagliptin’s therapeutic effects

In this study, we used sildenafil as an inducer and methylene blue as an inhibitor to investigate the role of the cGMP pathway in the effect of sitagliptin on acetic acid-induced colitis. Our findings indicated that administration of sildenafil before sitagliptin did not cause a significant difference compared to the group that received sitagliptin alone (P > 0.05) exhibiting protection against colitis induced by acetic acid (Fig. 3A). Conversely, the administration of methylene blue significantly diminished the protective effect of sitagliptin on the macroscopic score of colonic damage when compared to the sitagliptin-only group (Fig. 3B). In addition, both methylene blue and sildenafil, when administered alone, showed no significant effects in comparison to the acetic acid group (P > 0.05).

Fig. 3.

Fig. 3

Open in a new tab

Assessment of the cGMP’s involvement in the protective effect of sitagliptin (90 mg/kg) on the score of macroscopic damage of colon tissue. A and B show the pretreatment effect of Sil (5 mg/kg) and MB (20 mg/kg) on the effect of Sita, respectively. The sham group received no treatment. The results are presented as the means ± SEM, n = 6. ***P < 0.001 indicates significant differences compared to the sham group; ##P < 0.01 versus the acetic acid group; &P < 0.05 against the sitagliptin-treated group. cGMP, Cyclic guanosine monophosphate; Sita, sitagliptin; Sil, sildenafil; MB, methylene blue.

The involvement of the KATP channel pathway in sitagliptin’s therapeutic effects

To elucidate the role of KATP channels in sitagliptin effects, we administered glibenclamide (as a KATP channel inhibitor) and diazoxide (as a Katp channel opener) before sitagliptin treatment. The findings indicated that co-administration of diazoxide and sitagliptin did not yield a significant difference in comparison to the sitagliptin-only group (P > 0.05) and exerted a safeguarding effect against acetic acid-induced colitis (Fig. 4A). In contrast, the administration of glibenclamide signi ficantly diminished the protective effect of sitagliptin on the macroscopic score of colonic injury (Fig. 4B). Moreover, both glibenclamide and diazoxide, when used alone, exhibited no significant effects compared to the acetic acid group (P > 0.05).

Fig. 4.

Fig. 4

Open in a new tab

Assessment of the Katp channel’s involvement in the protective effect of sitagliptin (90 mg/kg) on the score of macroscopic damage of colon tissue. A and B show the pretreatment effect of Diaz (3 mg/kg) and Gli (1 mg/kg) on the effect of Sita, respectively. The sham group received no treatment. The results are presented as the means ± SEM, n = 6. ***P < 0.001 indicates significant differences compared to the sham group; ##P < 0.01 and ###P < 0.001 versus the acetic acid group; &P < 0.05 against the sitagliptin-treated group. Katp, ATP-sensitive potassium channel; Sita, sitagliptin; Diaz, diazoxide; Gli, glibenclamide.

The impact of sitagliptin on IL-1β and TNF-α in acetic acid-induced colitis

The levels of TNF-α and IL-1β were significantly elevated in the acetic acid group compared to the sham group (Fig. 5A and B). Treatment with sitagliptin (90 mg/kg) led to a significant decline in the concentrations of these pro-inflammatory biomarkers in acetic acid-induced colitis. Furthermore, the efficacy of sitagliptin on TNF-α levels was diminished by co-administration of L-NAME, glibenclamide, and methylene blue. Although co-administration of glibenclamide and methylene blue impaired the efficacy of sitagliptin on IL-1β level, it was not significant.

Fig. 5.

Fig. 5

Open in a new tab

The effect of Sita on the inflammatory parameters (TNF-α and IL-1β) in colon tissue. L-NAME, MB, and Gli disrupted the effect of sitagliptin on TNF-α and IL-Ιβ levels. The sham group received no treatment. The results are presented as the means ± SEM, n = 6. ***P < 0.001 indicates significant differences compared to the sham group; #P < 0.05, ##P < 0.01, and ###P < 0.001 versus the acetic acid group; &&P < 0.01 and &&&P < 0.001 against the sitagliptin-treated group. Sita, sitagliptin; L-NAME, N-ω-nitro-L-arginine methyl ester; MB, methylene blue; Gli, glibenclamide.

The impact of sitagliptin on the expression of BAX, BCL2, and TNF-α genes in acetic acid-induced colitis

As shown in Fig. 6, the expression level of the BAX gene in the acetic acid group significantly increased compared to the control group (saline). However, the administration of sitagliptin (90 mg/kg) did not create a significant impact on the expression level of the BAX gene in the acetic acid-induced colitis model in comparison to the acetic-acid group (P > 0.05). Additionally, pretreatment with L-NAME, methylene blue, and glibenclamide did not significantly modify sitagliptin’s impact on BAX gene expression (P > 0.05) (Fig. 6A). Regarding the expression of the BCL2 gene, the acetic acid group demonstrated a significant downregulation of this gene compared to the sham group. In contrast, the administration of sitagliptin (90 mg/kg) significantly increased the expression level of the BCL2 gene in the acetic acid-induced colitis model. Also, the effect of sitagliptin on BCL2 gene expression was significantly reduced by L-NAME, methylene blue, and glibenclamide (Fig. 6B).

Fig. 6.

Fig. 6

Open in a new tab

The effect of Sita on the gene expression of BAX, BCL2, and TNF-α in colon tissue. L-NAME, MB, and Gli disrupted Sita’s effects on these parameters. The sham group received no treatment. The results are presented as the means ± SEM, n = 6. **P < 0.01 and ***P < 0.001 indicate significant differences compared to the sham group; #P < 0.05 and ##P < 0.01 versus the acetic acid group; and &P < 0.05 against the sitagliptin-treated group. Sita, sitagliptin; BCL2, B-cell Lymphoma 2; BAX, BCL-2-associated X protein; TNF-α, tumor necrosis factor-alpha; L-NAME, N-ω-nitro-L-arginine methyl ester; MB, methylene blue; Gli, glibenclamide.

Additionally, in the acetic acid group, TNF-α gene expression was significantly upregulated compared to the saline control (sham). Sitagliptin (90 mg/kg) administration significantly reduced TNF-α expression in acetic acid-induced colitis. However, its efficacy was diminished by co-administration of glibenclamide (Fig. 6C).

The impact of sitagliptin on histopathologic parameters

Histomicrographs showed the tissue structure of the colon tissue in all groups (Fig. 7). The structure of the colon in the sham group had completely normal characteristics (mucosal, submucosal, muscular, and serosal layers with normal appearance) (Fig. 7A). In acetic acid-treated rats changes in tissue structure were observed, such as thickening of the lamina propria in the basal areas, ulcerations and hemorrhage areas in the mucosal layer, desquamation of epithelium, the histological ulcers showed necrosis in the mucosa layer with submucosal infiltration of inflammatory cells, and edema (Fig. 7B). The animals that received L-arginineas, an agonist of NO, compared to L-NAME as an antagonist of NO, had fewer ulcer lesions in the mucosal layer of the colon, and leucocyte inflammation (Fig. 7E and F). Histologically, the acetic acid-received animals that received diazoxide as an agonist of KATP channels, compared to glibenclamide as an antagonist of KATP channels, had less severe ulcers in the epithelial layer of the colon (Fig. 7G and H). Group of sildenafil as an agonist of cGMP, compared to methylene blue as an antagonist of cGMP, showed minor disruption of the epithelial cells of the mucosal layer (Fig. 7I and J). These findings showed that the large intestinal protective effects of 90 mg/kg of sitagliptin with agonist played a very effective role and restored the architecture of the colonic mucosa.

Fig. 7.

Fig. 7

Open in a new tab

Morphological changes in the large intestine structure after acetic acid administration in all groups. (A) Sham group with normal structure. (B) Acetic acid group, intestinal mucosa in acetic acid-received rats showing areas of hemorrhage in the mucosal layer (black arrow), desquamation of epithelium, infiltration of lymphocytes and inflammatory cells (red arrow), and distortion of normal crypt architecture. (C) Sitagliptin-treated group (30 mg/kg), (D) sitagliptin treated group (90 mg/kg), (E) L-arginine (750 mg/kg) + sitagliptin (90 mg/kg)-treated group, (F) L-NAME (10 mg/kg) + sitagliptin (90 mg/kg)-treated group, (G) diazoxide (3 mg/kg) + sitagliptin (90 mg/kg)-treated group, (H) glibenclamide (1 mg/kg) + sitagliptin (90 mg/kg)-treated group, (I) sildenafil (5 mg/kg) + sitagliptin (90 mg/kg)-treated group, (J) methylene blue (20 mg/kg) + sitagliptin (90 mg/kg)-treated group. Colon in the L-arginine, diazoxide, and sildenafil groups that received a high dose of sitagliptin showed fewer mucosal lesions. Staining: Hematoxylin and eosin. Magnification: 100×. Scale bar: 100 μm.

DISCUSSION

IBD is a chronic disorder associated with damage to intestinal tissue. Although the exact etiology of IBD is unknown, several factors, including genetic predisposition and environmental factors such as stress, diet, certain medications, infections, immune responses, and intestinal microbiota, contribute to the pathogenesis of this disease (19). One of the initial stages of the disease is an increase in the permeability of the intestinal vascular and mucosal barriers. The increased permeability facilitates penetration of molecules, bacteria, and antigens through the intestinal mucosa, stimulates the immune system, and enhances the inflammatory reaction (20). Furthermore, increased mucosal permeability facilitates rapid infiltration of neutrophils into the site of injury. The accumulation of these cells in the inflamed tissue leads to the release of a variety of inflammatory cytokines and proteolytic enzymes, which destroy healthy tissues and exacerbate inflammation (21,22).

Over-activation of the immune system and elevated levels of inflammatory cytokines are the other hallmarks of IBD. Disruption of the regulatory mechanisms of this system causes a persistent inflammatory state (23). In the current study, an experimental model of IBD was established in rats by intrarectal administration of acetic acid. Then, the dose-response effects of sitagliptin on the amelioration of acetic acid-induced colonic injury were evaluated.

The dose-response experiment demonstrated that sitagliptin administration significantly ameliorated colonic damage in a dose-dependent manner, and the highest tested dose (90 mg/kg) significantly reduced the macroscopic injury scores compared to the acetic acid group. Therefore, the dose of 90 mg/kg of sitagliptin was selected as the optimal dose for further experiments.

These findings align with previous studies. For instance, Ning et al. showed in a study that sitagliptin could ameliorate the dextran sulfate sodium-mediated colitis model in murine subjects (24). Additionally, the effects of other DPP-4 inhibitors, such as vildagliptin and linagliptin, on acetic acid-induced colitis have also been investigated, and their therapeutic efficacy confirmed (25,26).

Subsequently, the role of molecular pathways involving NO, cGMP, and Katp channels in mediating the protective effects of sitagliptin on colonic damage was investigated.

The NO pathway is known as a key regulator of inflammatory responses and maintenance of homeostasis in the gastrointestinal tract (27). Our findings showed that pretreatment with L-arginine (substrate of NO synthase) enhanced the protective effect of sitagliptin and reduced colonic damage. Whereas pretreatment with L-NAME (an inhibitor of NO synthase) counteracted this protective effect. These results highlight the critical role of NO production in mediating the protective actions of sitagliptin, which may be exerted through mechanisms such as vasodilation, inhibition of leukocyte adhesion, and attenuation of oxidative stress.

NO increases the production of cGMp through activating guanylate cyclase. cGMP, as a signaling molecule, possesses antiinflammatory effects, such as reducing leukocyte adhesion and regulating vascular muscle tone (28,29). The findings showed that pre-treatment with sildenafil (a cGMP enhancer) did not significantly alter the effect of sitagliptin, indicating saturation of the cGMP pathway by sitagliptin; however, methylene blue (a guanylate cyclase inhibitor) significantly reduced the protective effects of sitagliptin, indicating the crucial role of cGMP pathway activation in mediating the protective effects of this drug.

KATP channels play a crucial role in regulating inflammatory responses and protecting against ischemic injury (30). Recent studies suggest that some antidiabetic drugs, especially sitagliptin, may have anti-inflammatory and protective effects through secondary effects on cellular pathways such as KATP, as well as by declining oxidative stress and inflammation. Therefore, it is possible that sitagliptin indirectly affects KATP channels or their associated pathways by improving metabolic status and reducing free radicals and inflammation (31,32).

The results showed that administration of diazoxide (a channel opener) preserved the protective effects of sitagliptin, whereas glibenclamide (a channel blocker) disrupted this effect. These findings suggest that activation of KATP channels contributes to the protective effects of sitagliptin against acetic acid-induced colonic injury.

Furthermore, in IBD, the production of inflammatory mediators increases uncontrollably, leading to inflammation, cellular damage, and structural changes in the intestinal wall (19). These inflammatory mediators include cytokines such as TNF-α, IL-1β, and IL-6, as well as prostaglandins, which are produced by immune cells and mucosal epithelium. These processes cause persistent and chronic inflammatory responses that finally cause severe tissue injury and clinical symptoms of the disease(33,34).

Our findings indicated that the levels of TNF-α, IL-1β, and TNF-α gene expression were significantly elevated in the acetic acid group in comparison to the sham group, which aligns with the well-established functions of these cytokines in the etiology of IBD. Sitagliptin administration significantly reduced the level of these cytokines. Co-treatment with L-NAME, methylene blue, and glibenclamide reversed the anti-inflammatory effects of sitagliptin. These findings indicate the cooperation of the NO pathway, cGMP, and KATP channels in mediating the anti-inflammatory action of sitagliptin. These findings are consistent with previous reports; for example, in a study conducted by Hajhashemi et al., it was shown that the NO-cGMP-KATP pathways are involved in the anti-inflammatory effects of sitagliptin (31).

Moreover, current literature indicates that sitagliptin enhances anti-inflammatory responses by increasing incretin hormones such as GLP-1. These hormones reduce inflammatory cytokines such as TNF-α and IL-1β and inhibit inflammation-related signaling pathways, including the JAK/STAT and NF-κΒ pathways, which are involved in the activation of inflammatory responses. Ultimately, these inhibitions reduce chronic inflammation and protect the endothelium of blood vessels (32,35).

BAX and BCL-2 are key proteins in the regulation of apoptosis and cell survival, playing a crucial role in IBD (36,37). BCL-2 acts as an anti-apoptotic factor that prevents cell death by inhibiting apoptotic pathways, thereby supporting the survival of immune cells, and plays a protective role in inflammatory conditions (38). BAX is known as a pro-apoptotic protein and enhances the permeability of the mitochondrial membrane, facilitating the release of cytochrome c, and subsequently stimulates the apoptosis cascade (39). Research has shown that in IBD, an imbalance between BAX and BCL-2 proteins can lead to tissue damage and chronic inflammation (40).

Our findings revealed that acetic acid administration significantly increased the expression of the BAX gene while decreasing the expression of the BCL2 gene, indicating the activation of mitochondrial-dependent apoptotic pathways in the colon tissue during acetic acid-induced IBD. These changes are typically observed in response to severe oxidative stress and local inflammation, leading to a disruption in the balance between pro-apoptotic (BAX) and anti-apoptotic (BCL2) proteins (41).

In this study, administration of sitagliptin could compensate for the reduction in BCL2 without affecting BAX expression. These findings suggest that the protective effect of sitagliptin is primarily due to the enhancement of survival (anti-apoptotic) pathways rather than direct inhibition of apoptotic inducers. On the other hand, the simultaneous administration of L-NAME, methylene blue, and glibenclamide abolished the normalizing effect of sitagliptin on BCL2, indicating the mediating role of NO, cGMP, and KATP channels in the protective effect of sitagliptin.

In a similar study, Ning et al. indicated that sitagliptin, as a DPP-4 inhibitor, exhibits protective effects in an in vitro model of dextran sulfate sodium-induced colitis. Their results indicated that sitagliptin plays a crucial role in inhibiting apoptosis while enhancing the proliferation of intestinal epithelial cells through increasing the concentration of the active form of GLP-1 and enhancing the GLP-2 receptor (24).

Histopathological analysis of colon tissue confirmed the macroscopic findings and biochemical results. Acetic acid treatment caused severe tissue damage, including ulcerations, hemorrhage in the mucosal layer, epithelial desquamation, mucosal necrosis, inflammatory cell infiltration, edema, and a decrease in villus height. Treatment with sitagliptin reduced these changes, while cotreatment with L-NAME, methylene blue, and glibenclamide further mitigated the effects. These findings indicated that the gastroprotective effects of sitagliptin are disrupted by these antagonists.

This study had some limitations. First, species differences may prevent the results obtained in rats from being fully generalizable to humans. Second, the acute chemical-induced colitis model does not adequately replicate the chronic and multifactorial complexities of human IBD. Finally, our study primarily focused on the short-term effects of sitagliptin and lacked information regarding the long-term outcomes of treatment.

CONCLUSION

The current study demonstrated that sitagliptin ameliorates the intensity of acetic acid-induced colitis by reducing inflammation and regulating genes involved in apoptosis. The observed effects appear to be linked to the modulation of the NO-cGMP-Katp channel pathway. Therefore, sitagliptin could be considered a promising treatment option for IBD, but more preclinical studies are needed before it can be used in clinical practice.

Authors’ contributions

G. Houshmand and B. Ghorbanzadeh designed and implemented the study, analyzed and interpreted the data, and supervised the project. They also critically edited the manuscript for important intellectual content. H. Dehestani, F.B. Talebpour Amiri, M. Shokati, and S. Bayat conducted the experiments, collected the data, and drafted the initial manuscript. M. Seydabadi, R. Ataee, and T. Taghvaei Arabi provided advice on the experimental methodology. All authors have read and approved the finalized article. Each author has fulfilled the authorship criteria and affirmed that this article represents honest and original work.

Conflict of interest statements

The authors declared no conflict of interest in this study.

AI declaration

During the preparation of this work, the authors used ChatGPT to improve readability and language. After using this tool, the authors reviewed and edited the content and take full responsibility for the content of the publication. Also, AI-assisted design tools were employed for the preparation of the graphical abstract, followed by manual refinement by the authors.

Data availability

The data supporting the findings of this study are documented and available from the

corresponding author upon reasonable request. Researchers interested in accessing the data should contact the corresponding author to discuss the terms and conditions of access

Acknowledgements

This study was financially supported by the Mazandaran University of Medical Sciences, Sari, Iran, through Grant No. 17152.

REFERENCES

  • 1.Motavallian A, Zamani E, Bouzari S, Rezaeyan F, Karimian P, Evazalipour M. Anti-inflammatory effect of pregabalin on acetic acid-induced colitis in the rats. Res Pharm Sci. 2022;17(1):35–42. doi: 10.4103/1735-5362.329924. DOI: 10.4103/1735-5362.329924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Minaiyan M, Mottaghi N. Evaluation of the antiulcerative effects of lacosamide in a rat model of acetic acid-induced colitis. Res Pharm Sci. 2025;21(1):36–46. doi: 10.4103/RPS.RPS_24_25. DOI: 10.4103/RPS.RPS_24_25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ghorbanzadeh B, Behmanesh MA, Mahmoudinejad R, Zamaniyan M, Ekhtiar S, Paridar Y. The effect of montelukast, a leukotriene receptor antagonist, on the acetic acid-induced model of colitis in rats: Involvement of NO-cGMP-KATP channels pathway. Front Pharmacol. 2022;13:1011141,1–10. doi: 10.3389/fphar.2022.1011141. DOI: 10.3389/fphar.2022.1011141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jalalipour M, Yadganeh A, Talebi A, Minaiyan M. Salvia officinalis leaf extracts protect against acute colitis in rats. Res Pharm Sci. 2022;17(4):350–359. doi: 10.4103/1735-5362.350236. DOI: 10.4103/1735-5362.350236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kangwn N, Pintha K, Khanaree C, Kongkarnka S, Chewonarin T, Suttajit M. Anti-inflammatory effect of Perilla frutescens seed oil rich in omega-3 fatty acid on dextran sodium sulfate-induced colitis in mice. Res Pharm Sci. 2021;16(5):464–473. doi: 10.4103/1735-5362.323913. DOI: 10.4103/1735-5362.323913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Rana T. Influence and implications of the molecular paradigm of nitric oxide underlying inflammatory reactions of the gastrointestinal tract of dog:a major hallmark of inflammatory bowel disease. Inflamm Bowel Dis. 2022;28(8):1280–1288. doi: 10.1093/ibd/izac017. DOI: 10.1093/ibd/izac017. [DOI] [PubMed] [Google Scholar]
  • 7.Graham DB, Xavier RJ. Pathway paradigms revealed from the genetics of inflammatory bowel disease. Nature. 2020;578(7796):527–539. doi: 10.1038/s41586-020-2025-2. DOI: 10.1038/s41586-020-2025-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Iwata M, Inoue T, Asai Y, Hori K, Fujiwara M, Matsuo S, et al. The protective role of localized nitric oxide production during inflammation may be mediated by the heme oxygenase-1/carbon monoxide pathway. Biochem Biophys Rep. 2020;23:100790,1–10. doi: 10.1016/j.bbrep.2020.100790. DOI: 10.1016/j.bbrep.2020.100790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wen L, Feil S, Feil R. Platelets, Haemostasis and Inflammation. Springer; 2017. cGMP signaling in platelets; pp. 231–252. DOI: 10.1007/978-3-319-66224-4_15. [Google Scholar]
  • 10.Cai Z, Wang S, Li J. Treatment of inflammatory bowel disease:a comprehensive review. Front Med. 2021;8:765474,1–24. doi: 10.3389/fmed.2021.765474. DOI: 10.3389/fmed.2021.765474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Scott LJ. Sitagliptin: a review in type 2 diabetes. Drugs. 2017;77(2):209–224. doi: 10.1007/s40265-016-0686-9. DOI: 10.1007/s40265-016-0686-9. [DOI] [PubMed] [Google Scholar]
  • 12.Waget A, Cabou C, Masseboeuf M, Cattan P, Armanet M, Karaca M, et al. Physiological and pharmacological mechanisms through which the DPP-4 inhibitor sitagliptin regulates glycemia in mice. Endocrinology. 2011;152(8):3018–3029. doi: 10.1210/en.2011-0286. DOI: 10.1210/en.2011-0286. [DOI] [PubMed] [Google Scholar]
  • 13.Quadros-Pereira L, de Oliveira Nery-Neto JA, Da Silva EM, Doretto-Silva L, Yariwake VY, Câmara NO, et al. Treatment with sitagliptin exacerbates the M2 phenotype in macrophages in vitro. Int Immunopharmacol. 2025;145:113730. doi: 10.1016/j.intimp.2024.113730. DOI: 10.1016/j.intimp.2024.113730. [DOI] [PubMed] [Google Scholar]
  • 14.Ibrahim MA, Geddawy A, Abdel-Wahab S. Sitagliptin prevents isoproterenol-induced myocardial infarction in rats by modulating nitric oxide synthase enzymes. Eur J Pharmacol. 2018;829:63–69. doi: 10.1016/j.ejphar.2018.04.005. DOI: 10.1016/j.ejphar.2018.04.005. [DOI] [PubMed] [Google Scholar]
  • 15.Ajaman M, Naserzadeh R, Ghorbanzadeh B. Pharmacological evaluation of NO/cGMP/KATP channels pathway in the antidepressant-like effect of carbamazepine in mice. Behav Pharmacol. 2021;32(1):32–42. doi: 10.1097/FBP.0000000000000600. DOI: 10.1097/FBP.0000000000000600. [DOI] [PubMed] [Google Scholar]
  • 16.MacPherson B, Pfeiffer C. Experimental production of diffuse colitis in rats. Digestion. 1978;17(2):135–150. doi: 10.1159/000198104. DOI: 10.1159/000198104. [DOI] [PubMed] [Google Scholar]
  • 17.Deshmukh C, Veeresh B, Pawar A. Protective effect of Emblica officinalis fruit extract on acetic acid-induced colitis in rats. J Herb Med Toxicol. 2010;4(2):25–29. [Google Scholar]
  • 18.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. DOI: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 19.Minaiyan M, Abolhasani S, Sima S, Yegdaneh A. Effect of Tamarindus indica L. fruit pulp and seed extracts on experimental ulcerative colitis in rats. Res Pharm Sci. 2024;19(3):276–286. doi: 10.4103/RPS.RPS_131_23. DOI: 10.4103/RPS.RPS_131_23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Motavallian A, Minaiyan M, Rabbani M, Mahzouni P, Andalib AS. Anti-inflammatory effects of alosetron mediated through 5-HT3 receptors on experimental colitis. Res Pharm Sci. 2019;14(3):228–236. doi: 10.4103/1735-5362.258489. DOI: 10.4103/1735-5362.258489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wéra O, Lancellotti P, Oury C. The dual role of neutrophils in inflammatory bowel diseases. J Clin Med. 2016;5(12):118,1–24. doi: 10.3390/jcm5120118. DOI: 10.3390/jcm5120118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Motavallian-Naeini A, Andalib S, Rabbani M, Mahzouni P, Afsharipour M, Minaiyan M. Validation and optimization of experimental colitis induction in rats using 2, 4, 6-trinitrobenzene sulfonic acid. Res Pharm Sci. 2012;7(3):159–169. PMID: 23181094. [PMC free article] [PubMed] [Google Scholar]
  • 23.Neurath MF. Cytokines in inflammatory bowel disease. Nat Rev Immunol. 2014;14(5):329–342. doi: 10.1038/nri3661. DOI: 10.1038/nri3661. [DOI] [PubMed] [Google Scholar]
  • 24.Ning MM, Yang WJ, Guan WB, Gu YP, Feng Y, Leng Y. Dipeptidyl peptidase 4 inhibitor sitagliptin protected against dextran sulfate sodium-induced experimental colitis by potentiating the action of GLP-2. Acta Pharmacol Sin. 2020;41(11):1446–1456. doi: 10.1038/s41401-020-0413-7. DOI: 10.1038/s41401-020-0413-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fouad MR, Salama RM, Zaki HF, El-Sahar AE. Vildagliptin attenuates acetic acid-induced colitis in rats via targeting PI3K/Akt/NFκB, Nrf2 and CREB signaling pathways and the expression of lncRNA IFNG-AS1 and miR-146a. Int Immunopharmacol. 2021;92:107354,1–11. doi: 10.1016/j.intimp.2020.107354. DOI: 10.1016/j.intimp.2020.107354. [DOI] [PubMed] [Google Scholar]
  • 26.El-Ghannam MS, Saad MA, Nassar NN, El-Yamany MF, El-Bahy AA. Linagliptin ameliorates acetic acid-induced colitis via modulating AMPK/SIRT1/PGC-1α and JAK2/STAT3 signaling pathway in rats. Toxicol Appl Pharmacol. 2022;438:115906. doi: 10.1016/j.taap.2022.115906. DOI: 10.1016/j.taap.2022.115906. [DOI] [PubMed] [Google Scholar]
  • 27.Kamalian A, Asl MS, Dolatshahi M, Afshari K, Shamshiri S, Roudsari NM, et al. Interventions of natural and synthetic agents in inflammatory bowel disease, modulation of nitric oxide pathways. World J Gastroenterol. 2020;26(24):3365–3370. doi: 10.3748/wjg.v26.i24.3365. DOI: 10.3748/wjg.v26.i24.3365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ahluwalia A, Foster P, Scotland RS, McLean PG, Mathur A, Perretti M, et al. Antiinflammatory activity of soluble guanylate cyclase: cGMP-dependent down-regulation of P-selectin expression and leukocyte recruitment. Proc Natl Acad Sci USA. 2004;101(5):1386–1391. doi: 10.1073/pnas.0304264101. DOI: 10.1073/pnas.0304264101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Flores-Costa R, Duran-Güell M, Casulleras M, López-Vicario C, Alcaraz-Quiles J, Díaz A, et al. Stimulation of soluble guanylate cyclase exerts antiinflammatory actions in the liver through a VASP/NF-KB/NLRP3 inflammasome circuit. Proc Natl Acad Sci USA. 2020;117(45):28263–28274. doi: 10.1073/pnas.2000466117. DOI: 10.1073/pnas.2000466117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Szeto V, Chen NH, Sun HH, Feng ZP. The role of KATP channels in cerebral ischemic stroke and diabetes. Acta Pharmacol Sin. 2018;39(5):683–694. doi: 10.1038/aps.2018.10. DOI: 10.1038/aps.2018.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hajhashemi V, Sadeghi H, Madab FK. Antiinflammatory and antinociceptive effects of sitagliptin in animal models and possible mechanisms involved in the antinociceptive activity. Korean J Pain. 2024;37(1):26–33. doi: 10.3344/kjp.23262. DOI: 10.3344/kjp.23262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kothari V, Galdo JA, Mathews ST. Hypoglycemic agents and potential anti-inflammatory activity. J Inflamm Res. 2016;9:27–38. doi: 10.2147/JIR.S86917. DOI: 10.2147/JIR.S86917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kakatum N, Itharat A, Pipatrattanaseree W, Kanokkangsadal P, Davies NM. Validation of an HPLC method for quantification of anti-inflammatory markers in an ethanolic extract of Sahastara and its antiinflammatory activity in vitro. Res Pharm Sci. 2021;16(3):227–239. doi: 10.4103/1735-5362.314821. DOI: 10.4103/1735-5362.314821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ghanbari A, Jalili C, Salahshoor MR, Javanmardy S, Ravankhah S, Akhshi N. Harmine mitigates cisplatin-induced renal injury in male mice through antioxidant, anti-inflammatory, and anti-apoptosis effects. Res Pharm Sci. 2022;17(4):417–427. doi: 10.4103/1735-5362.350242. DOI: 10.4103/1735-5362.350242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Alharbi SH. Anti-inflammatory role of glucagon-like peptide 1 receptor agonists and its clinical implications. Ther Adv Endocrinol Metab. 2024;15:1–18. doi: 10.1177/20420188231222367. DOI: 10.1177/20420188231222367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Moradi M, Hassanshahi J, Rahmani MR, Shamsizadeh A, Kaeidi A. Antiapoptotic and antinociceptive effects of Achillea millefolium L. aqueous extract in rats with experimental painful diabetic neuropathy. Res Pharm Sci. 2024;19(5):561–572. doi: 10.4103/RPS.RPS_140_23. DOI: 10.4103/RPS.RPS_140_23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Safi A, Mohammadi S, Emami M, Radaei A, Kalantari-Hesari A, Nouri A, et al. Thymoquinone mitigates diclofenac-induced hepatorenal toxicity in male Wistar rats by balancing the redox state and modulating Bax/Bcl-2/caspase-3 apoptotic pathways and NF-ĸB signaling. Res Pharm Sci. 2025;20(1):95–108. doi: 10.4103/RPS.RPS_141_24. DOI: 10.4103/RPS.RPS_141_24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Vogler M, Braun Y, Smith VM, Westhoff MA, Pereira RS, Pieper NM, et al. The BCL2 family : from apoptosis mechanisms to new advances in targeted therapy. Signal Transduct Target Ther. 2025;10(1):1–31. doi: 10.1038/s41392-025-02176-0. DOI: 10.1038/s41392-025-02176-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Gómez-Crisóstomo NP, López-Marure R, Zapata E, Zazueta C, Martínez-Abundis E. Bax induces cytochrome c release by multiple mechanisms in mitochondria from MCF7 cells. J Bioenerg Biomembr. 2013;45(5):441–448. doi: 10.1007/s10863-013-9508-x. DOI: 10.1007/s10863-013-9508-x. [DOI] [PubMed] [Google Scholar]
  • 40.Asadzadeh Aghdaei H, Kadijani AA, Sorrentino D, Mirzaei A, Shahrokh S, Balaii H, et al. An increased Bax/Bcl-2 ratio in circulating inflammatory cells predicts primary response to infliximab in inflammatory bowel disease patients. United Eur Gastroenterol J. 2018;6(7):1074–1081. doi: 10.1177/2050640618774637. DOI: 10.1177/2050640618774637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Luo Y, Fu C, Wang Z, Zhang Z, Wang H, Liu Y. Mangiferin attenuates contusive spinal cord injury in rats through the regulation of oxidative stress, inflammation and the Bcl-2 and Bax pathway. Mol Med Rep. 2015;12(5):7132–138. doi: 10.3892/mmr.2015.4274. DOI: 10.3892/mmr.2015.4274. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data supporting the findings of this study are documented and available from the

corresponding author upon reasonable request. Researchers interested in accessing the data should contact the corresponding author to discuss the terms and conditions of access

Articles from Research in Pharmaceutical Sciences are provided here courtesy of Wolters Kluwer -- Medknow Publications

RESOURCES