Aptamer targeting proprotein convertase subtilisin/kexin type 9: in vivo efficacy in a hypercholesterolemic rat model

Abstract

Background and purpose:

Inhibition of proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a key therapeutic target for lowering low-density lipoprotein cholesterol (LDL-C). This study aimed to evaluate the LDL-C-lowering efficacy of a PCSK9-targeting aptamer (AP-1) in a hypercholesterolemic rat model.

Experimental approach:

Wistar male rats (n = 48) were divided into 8 groups (n = 6): normal control, negative control, positive control receiving atorvastatin (4 mg/kg body weight) plus ezetimibe (1 mg/kg BW), and a PBS vehicle group. Experimental groups received the aptamer intraperitoneally at 1, 3, and 8 μM;, and one group received 3 μM; aptamer combined with atorvastatin (4 mg/kg BW). Hypercholesterolemia was induced for over 90 days, followed by a 4-week treatment period. Serum lipid parameters, including triglycerides (TG), total cholesterol (T-Chol), LDL-C, and atherogenic indices, were assessed.

Findings/Results:

TG, 143.2 ± 16.44 vs. 109 ± 23.05 mg/dL; T-Chol, 88 ± 3.11 vs. 80 ± 7.16 mg/dL, and LDL-C, 19.4 ± 1.12 vs. 14.5 ± 1.56 mg/dL, levels were significantly increased in the hypercholesterolemic rat model compared to the normal group. Treatment with the 3 μM; aptamer produced the most pronounced lipidlowering effects, significantly reducing TG, 95.2 ± 8.76 vs. 143.2 ± 16.44 mg/dL; T-Chol, 61.2 ± 5.11 vs. 88 ± 3.11 mg/dL, and LDL-C, 11.4 ± 0.75 vs. 19.4 ± 1.12 compared to the hypercholesterolemic control group. Furthermore, the atherogenic index of plasma, remnant cholesterol, and Castelli risk index-II were reduced significantly.

Conclusion and implications:

AP-1 aptamer-mediated PCSK9 inhibition significantly improved lipid profiles and atherogenic indices, supporting aptamers as a viable alternative to monoclonal antibody-based PCSK9 inhibition.

INTRODUCTION

Excessive concentrations of low-density lipoprotein cholesterol (LDL-C) are a major factor in cardiovascular diseases (CVDs), which remain a significant global health problem (1,2). The earliest pathological alteration in CVDs is the development of atherosclerosis and an inflammatory condition in which atherosclerotic plaques build up inside the arteries (3).

Based on recent discoveries, the decrease in atherosclerosis is prominently attributed to the reduction of LDL-C (4). Statins, 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, represent the primary pharmacologic approach for reducing LDL-C (5). Ezetimibe, a second-line therapy, reduces LDL-C by inhibiting dietary cholesterol absorption. Nevertheless, the incidence of CVDs is progressively increasing (6). Patients with familial hypercholesterolemia, who have genetically elevated LDL-C, often exhibit intolerance or inadequate responses to conventional therapies (7). These limitations encouraged us to investigate more advanced treatment strategies. The discovery of proprotein convertase subtilisin/kexin type 9 (PCSK9) marked a pivotal advancement in CVDs (8). PCSK9, secreted from the liver, binds to the epidermal growth factor-like domain A (EGF-A) domain of the hepatic LDL receptor. This interaction promotes receptor degradation in lysosomes, impedes its return to the cell surface during recycling, and reduces the clearance of serum LDL-C (8,9). It has been shown that loss-of-function mutations in PCSK9 are associated with low LDL-C and significant cardioprotection, thereby validating PCSK9 as a high-value target for the treatment of hypercholesterolemia and CVDs (8).

Inhibition of PCSK9 has therefore become a prominent strategy in cardiovascular medicine. Clinical trials have confirmed that monoclonal antibodies (mAbs) against circulating PCSK9 have notably reduced LDL-C by 40-50% (10). Despite their efficacy, high production costs can limit their widespread availability and sustained therapy (11). As biological agents, mAbs carry an inherent risk of immunogenicity and degradation (12). The immunogenicity of monoclonal antibodies could induce the formation of antidrug antibodies, thereby reducing their clinical efficacy (13). Furthermore, the complex manufacturing of mAbs can result in batch-to-batch variations, challenging quality control and clinical performance (14,15). These limitations and disadvantages highlighted the interest in designing alternative inhibitory compounds such as small interfering RNA (siRNA), RNA, and DNA aptamers. Among these approaches, aptamers offer a convincing and compelling option. Aptamers are short, single-stranded RNA or DNA selected from a library via several cycles of enrichment, polymerase chain reaction (PCR) amplification, and nucleic acid purification to obtain high-affinity molecules. The method is named systematic evolution of ligands by exponential enrichment (SELEX) (16,17,18,19).

An oligonucleotide aptamer folds into distinct three-dimensional structures, enabling it to bind to a protein target with high affinity and specificity (20). This binding reduces or prevents the function of the intended protein, making it valuable for clinical application (20,21). The selection of a specific aptamer requires a precise and specialized technique, and capillary electrophoresis (CE) was selected for this purpose. CE is a specific method of SELEX for aptamer enrichment that improves the efficiency (22). The aptamer presents several advantages, including ease of chemical synthesis, lower immunogenicity, structural modifiability for enhanced stability, and superior batch-to-batch consistency. Therefore, these properties position aptamers as cost-effective, versatile tools for therapeutics compared to monoclonal antibodies against PCSK9 (15).

Recent in vitro studies have identified PCSK9-specific aptamers, such as aptamer-1 (AP-1), that inhibit PCSK9-LDL receptor (LDLR) interactions, bringing back cellular LDL-C uptake, which results in increased hepatic uptake of LDL and lower LDL levels in the blood. This mechanism offers a promising road for hypercholesterolemia treatment. The aptamer targets PCSK9 with specificity and high affinity to inhibit the interaction with LDLR (22,23). Despite its promising characteristics, no studies have yet conclusively demonstrated its ability to lower LDL-C in vivo. This study aimed to understand how different concentrations of the aptamer (AP-1) affect serum levels of LDL-C, lipid profiles, and markers of atherosclerosis in a hypercholesterolemic rat model. We compared the effectiveness of the aptamer to established LDL-C-lowering medications, such as statins and ezetimibe. Additionally, we evaluated the potential additive effects of using AP-1 in combination with statins in rats. Ultimately, our goal was to demonstrate AP-1’s potential as an innovative therapeutic option to reduce LDL-C levels and slow the progression of CVDs.

MATERIALS AND METHODS

Design of an aptamer targeting PCSK9

In our previous study, a DNA aptamer, AP-1, was selectively generated using CE-SELEX (22), a method for isolating an oligonucleotide aptamer with high affinity for a specific target from a library of randomized sequences. In this approach, after selection of a DNA library, the library was incubated with the target molecule (human PCSK9 protein) before injection into CE. The separation of the components was performed using CE based on electrophoretic mobility (Ep) and electroosmotic flow (EOF) of the analytes. The Kd value for AP-1 binding affinity was 294 nM. The sequence of the aptamer (AP-1) is: 5’ATACCAGCTTATTCAATTGACCCGT TTCGTTCCCTCTGGGAAGTTTAGCCCAG TTGCCTGGGCGATACCAAGATAGTAAG TGCAATCT3’ (22). The molecular weight of the 88-mer single-strand DNA (ssDNA) aptamer was calculated based on nucleotide composition and was 27.10 kDa. The 3’-end of high-performance liquid chromatography (HPLC) pure AP-1 (330 nmol) was ordered to be biotinylated (Pishkam Biotechnology, Tehran, I.R. Iran).

Aptamer preparation and conjugation

We prepared a 2 mL biotinylated-aptamer stock solution with 330 nM aptamer concentration. Initially, the aptamer solution was heated at 90 °C for 1 min in a boiling water bath. Next, it was immediately cooled on ice for 15 min, followed by an additional 8 min of incubation at room temperature. Subsequently, to perform the conjugation of the aptamer, a stock solution of streptavidin was prepared. Five mg of streptavidin (Molekula, Durham, United Kingdom, batch no. 242015) was dissolved in 5 mL of calcium-free Dulbecco’s phosphate-buffered saline (D-PBS) at room temperature. Streptavidin conjugation was employed to enhance aptamer stability and pharmacokinetics (24,25).

The final aptamer solution was prepared in a total volume of 500 μL for each injection (25). To ensure stability, the solution was freshly prepared immediately before each experiment. The aptamer was administered at low, medium, and high concentration levels to assess its concentration-dependent inhibitory effects on PCSK9. In this study, the initial dose of the aptamer was set at 13.55 μg/animal (500 pmol per animal), based on its reported Kd of 294 nM. This dosing strategy is supported by evidence from previous in vivo studies that have successfully administered DNA aptamers at similar dose ranges, showing adequate systemic exposure and effective pharmacodynamic activity (25,26,27).

Therefore, the low concentration (1 μM;), the intermediate concentration (3 μM;), and the high concentration (8 μM;) of conjugated aptamer were prepared with 500, 1500, and 4000 pmol of aptamer plus 125 (6.6 μg), 375, and 1000 pmol of streptavidin solution, respectively. To each reaction, 50 mmol MgCl₂ was incorporated into the formulation solution to stabilize the aptamer’s structure and enhance its biological activity (28). The final volume was adjusted to 500 μL using PBS buffer. The solution was gently agitated at 37 °C for 30 min (29). The biotinylated conjugated aptamer with streptavidin is shown in Fig. 1.

Fig. 1.

Schematic representation of 3 ’-biotinylated aptamer (AP-1) conjugated with streptavidin. The 2D structure of the aptamer is depicted at the top left. A biotin molecule was attached to the 3’ ends of AP-1, followed by the conjugation of streptavidin, resulting in the formation of the aptamer-streptavidin conjugate, as illustrated at the top right.

Confirmation of aptamer-streptavidin conjugation

The successful conjugation of the biotinylated aptamer to streptavidin was confirmed by agarose gel electrophoresis (3% w/v). This technique rigorously separates the DNA-based aptamer and the aptamer-streptavidin conjugate based on their unique charges and molecular weights (30,31). The gel was made by dissolving 0.6 g of agarose powder in 20 mL of 1× Tris-borate-EDTA buffer, following the standard equation below: Agarose (g) = Gel percentage (%) × buffer volume (mL)

The mixture was heated to complete agarose dissolution, subsequently cast into a tray, and allowed to solidify. After solidification, the samples were loaded into the wells in the following order: a DNA ladder as a molecular weight standard, the conjugated biotin-streptavidin-aptamer, and the unconjugated aptamer. Electrophoresis was then performed at a constant voltage to facilitate separation. The gel was subsequently stained with an appropriate DNA-binding dye and immediately visualized under UV-light Gel Documentation System (Bio-Rad, USA), as shown in Fig. 2.

Fig. 2.

Aptamer conjugation confirmation. Line 1: DNA ladder (100-1000bp), line 2: conjugated aptamer of biotin-streptavidin-aptamer, and line 3: unconjugated aptamer. DNA aptamer = 88 bp, biotin = 0.224 kDa, streptavidin (tetramer) = 60, 3 kDa unconjugated aptamer = 88 bp.

Animal models and experimental design

This study involved 48 male Wistar rats, aged 8-10 weeks and weighing between 200 and 250 g. The animals were obtained from the animal facility at the Isfahan University of Medical Sciences, Iran. Rats were housed under standard conditions, including a 12/12-h light/dark cycle, 25 °C, and ad libitum access to water and food. All experimental protocols were approved by the Isfahan University of Medical Sciences Ethics Committee (Approval Code: IR.MUI.AEC.1401.007). After a 10-day acclimatization, the rats were randomly divided into 8 groups (n = 6). During the study, one rat mortality occurred in each group. Ultimately, each group consisted of five rats. Group 1: the normal group, received a standard pellet diet throughout the study. To induce hypercholesterolemia, groups 2 through 8 were fed a reliable high-cholesterol diet for 90 days (32,33). The precise composition of both the normal and hypercholesterolemic diets is presented in Table 1. After the 90-day induction period, hypercholesterolemia was confirmed by randomly assessing blood cholesterol levels in a subset of animals from the high-cholesterol diet groups. In most in vivo studies, aptamers typically require a treatment period of about 2-6 weeks to achieve a measurable and meaningful therapeutic response (34,35,36).

Table 1.

The ingredients of normal and hyper- cholesterolemic diets for the rats.

Nutrients (g/kg of diet)	High-cholesterol diet (g)	Normal diet (g)
Casein	120	200
Corn starch	401.6	550
Soybean oil	230	25
Cholesterol powder	4	0
Coline	0.4	0
Salt mixture	50	50
Vitamin mixture	10	10
Cellulose	110	50
Sheep fat	74	0
Others	0	115

Accordingly, a 4-week treatment phase was implemented in the present study. The groups and their respective interventions were as follows:

The normal group was maintained on a standard diet throughout the study and received no treatment. The negative control group still received no mediation (hypercholesterolemic without treatment). The positive control group underwent conventional therapy by daily oral gavage (atorvastatin 4 mg/kg BW and ezetimibe 1 mg/kg BW). The vehicle control group (PBS) was administered biweekly intraperitoneal (i.p.) injections of PBS (500 μL). The low, intermediate, and high concentration groups received biweekly i.p. injections (500 μL) of aptamer solution at 1 μM;, 3 μM;, and 8 μM;, respectively (25,26,27).

Finally, the combination group received 3 μM; aptamer solution alongside 4 mg/kg atorvastatin.

Sample collection and processing

Following treatment, rats were subjected to an overnight fast before euthanasia. Ketamine (100 mg/kg) and xylazine (10 mg/kg) were given via i.p. injection to induce strong anesthesia (37).

The terminal blood draw was performed via cardiac puncture. The collected blood could coagulate at ambient temperature and was later subjected to centrifugation at 3000 g for 15 min to separate serum. The resulting serum was collected for biochemical analysis.

Lipid profile measurement

The serum lipid profile was assessed using a Mindray chemistry analyzer (Mindray, Shenzhen, China) with the Audit diagnosis assay kit (Cork, Ireland) as the reagent. Total cholesterol (T-Chol) and triglycerides (TG) were quantified via colorimetric assays, whereas LDL-C and high-density lipoprotein cholesterol (HDL-C) were measured using direct enzymatic methods. Additionally, cardiovascular risk factors were assessed by calculating remnant cholesterol levels and the LDL/HDL ratio (Castelli risk index-II).

Statistical analyses

The data are presented as mean ± SEM. Statistical analyses were performed using SPSS version 24.0 and GraphPad PRISM version 9.5.0 for graphical representations. One-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was used to evaluate statistical significance among multiple treatment groups. P-values ≤ 0.05 were considered statistically significant.

RESULTS

Lipid profile assessment

The negative control group showed elevated TG levels compared with the normal group. The positive control (ezetimibe and atorvastatin) group showed a considerable reduction in TG compared with the normal group. Administration of aptamer at 1 and 3 μM; significantly reduced TG levels compared to the negative control. Furthermore, the combination of 3 μM; aptamer with atorvastatin resulted in a noticeable reduction of TG versus the negative control (Fig. 3A).

Fig. 3.

Effects of different treatments on serum lipid profiles in experimental groups. (A) TG levels (mg/dL); (B) T-Chol levels (mg/dL); (C) HDL-C levels (mg/dL); and (D) LDL-C levels (mg/dL). The positive control group received atorvastatin 4 mg/kg and ezetimibe 1 mg/kg, and the vehicle group received phosphate-buffered saline. Data are presented as mean ± 8ΕΜ, n = 5. ^*P < 0.05, ^**P < 0.01, and ***P < 0.001 indicate significant differences in comparison with the normal group; ^#P < 0.05, ^##P < 0.01, ^###P < 0.001 versus the negative control group. TG, Triglycerides; LDL, low-density lipoprotein; HDL, high-density lipoprotein; T-Chol, total cholesterol; STA, atorvastatin.

A significant difference in T-Chol was observed among the groups, as shown in Fig. 3B. The negative control group showed a significant increase in T-Chol compared to the normal group. The conventional therapy of atorvastatin (4 mg/kg) and co-administration with ezetimibe (1 mg/kg), considered the positive control, significantly reduced the T-Chol compared to the negative control. Treatment with aptamer at 8 μM; and the combination of 3 μM; aptamer and atorvastatin significantly reduced T-Chol levels compared to the negative control group. The greatest reduction in T-Chol levels was observed in the group receiving 3 μM; aptamer compared to the negative control group.

As shown in Fig. 3C, the analysis of HDL-C did not show significant changes among the normal, negative, positive controls, and aptamer treatment groups. A slight increase in HDL levels was observed only in the group receiving 1 μM; aptamer compared to the negative control, although insignificant.

LDL-C levels were significantly reduced by the treatments (Fig. 3D). The negative control group indicated significantly elevated LDL compared to the normal group. This increase was significantly attenuated by treatment with the aptamer at 3 and 8 μM;. The combination treatment of aptamer (3 μM;) and atorvastatin also resulted in a significant decrease in LDL-C.

Analysis of atherogenic factors

Additional parameters of the lipid profile were evaluated, including the LDL/HDL ratio and remnant cholesterol levels in the same experimental groups. Figure 4A illustrates the LDL/HDL ratio, where the negative control group showed an elevated ratio compared to the normal group. Significant reductions relative to the negative control group were observed in the 8 μM; aptamer and 3 μM; aptamer plus atorvastatin groups. The LDL/HDL ratio was markedly reduced in the combination therapy group (APT 3 μM; + atorvastatin) compared to the positive control group receiving statin, indicating a probable additive effect in alleviating hypercholesterolemia.

Fig. 4.

Effects of different treatments on (A) LDL/HDL ratio and (B) remnant cholesterol levels (mg/dL) in experimental groups. The positive control group received atorvastatin 4 mg/kg and ezetimibe 1 mg/kg, and the vehicle group received phosphate-buffered saline. Data are presented as mean ± SEM, n = 5. ^**P < 0.01 indicates significant difference in comparison with the normal group; ^#P < 0.05, ^##P < 0.01, ^###P < 0.001 versus the negative control group; and ^$P < 0.05 against the positive control group. TG, Triglycerides; LDL, low-density lipoprotein; HDL, high-density lipoprotein; STA, atorvastatin.

Figure 4B presents remnant cholesterol levels, with non-significant increases in the untreated groups, negative control and PBS, relative to the normal group, which decreased in all treated groups. Statistical significance was marked in the 8 μM; aptamer and 3 μM; aptamer plus atorvastatin groups compared to the negative control group.

DISCUSSION

The present study investigated the therapeutic potential of a modified ssDNA aptamer targeting PCSK9 (APT-1) in a hypercholesterolemic rat model to reduce LDL-C levels. Although the overall amino acid sequence homology of PCSK9 between humans and rats is approximately 77% (38), the functional interaction between PCSK9 and the LDL receptor is specifically mediated by its catalytic domain. Comparative BLAST analysis revealed that the amino acid sequence of the PCSK9 catalytic domain is highly conserved between humans and rats, exhibiting 86.49% sequence identity with 99% query coverage. Therefore, the rat was considered an appropriate choice for this study. To induce hypercholesterolemia in Wistar rats, a specific diet was utilized at the start of the study to increase serum LDL-C levels. Various protocols for inducing hypercholesterolemia in Wistar rats using different dietary approaches were reviewed (39).

To effectively implement hyper-cholesterolemic diets for the rats, a pilot study was conducted using the diet ingredients before the main investigation. The ingredients used in this study were found to increase serum LDL-C in rats by up to 55%. As a result, these diet ingredients were selected for use in further experiments.

For intraperitoneal administration, the aptamer was freshly prepared daily and conjugated with streptavidin before injection. Streptavidin conjugation was employed to improve the stability and pharmacokinetic profile of the aptamer. While this modification carries a potential risk of immune activation, the resulting enhancement in molecular integrity and prolonged systemic circulation was justified in the experimental model (24,25). The conjugation process was verified through agarose gel electrophoresis. Successful conjugation was indicated by a distinct band shift of the biotinylated aptamer after it was incubated with streptavidin. This shift appeared at a higher molecular weight when using a molar ratio of 1:4 (streptavidin to Ap-1) for a duration of 30 min.

Our principal findings demonstrate that aptamer administration significantly improved the atherogenic lipid profile. The key results include a concentration-dependent reduction in T-Chol, LDL-C, and TG, with the most pronounced effects at the 3 and 8 μM; concentrations. Notably, the combination of 3 μM; aptamer plus statin yielded greater effects, significantly lowering LDL-C, TG, and T-Chol, and producing a more preferable LDL/HDL ratio and remnant cholesterol level than the positive control statin-ezetimibe group. These findings suggest a concentration-dependent recovery for dyslipidaemia by aptamer, particularly at the concentration of 3 μM; and in combination with statins, highlighting its efficacy in modulating lipid metabolism. It should be noted that in the rodent model, which features an HDL-dominant (α-dominant) lipoprotein profile due to the lack of cholesteryl ester transfer protein, HDL levels generally show minimal variations in studies that induce hypercholesterolemia (40).

The observed effects on lipid levels are in agreement with the expected mechanism of inhibition of PCSK9. PCSK9 binds to the hepatic LDLR, promoting its lysosomal degradation (41). By inhibiting PCSK9, our aptamer is postulated to prevent this degradation, thereby increasing the availability of LDLR on hepatocytes. This enhances the clearance of LDL-C and other apoB-containing lipoproteins from the circulation, directly explaining the significant reductions in LDL-C, T-Chol, and remnant cholesterol (42). The reduction in TG, while less directly linked to PCSK9, may be attributed to the increased clearance of TG-rich very low-density lipoproteins (VLDL) and their remnants via the same upregulated LDLR pathway (43). The modifications applied to the 3’-biotinylated aptamer and streptavidin conjugation likely contributed to its prolonged circulation and resistance to nuclease degradation, enabling effective in vivo targeting of PCSK9 in hypercholesterolemic rats (16,44).

The efficacy of the 3 μM; aptamer compared to the 3 μM; aptamer combined with statin did not significantly change LDL-C levels. Statins, while potently upregulating LDLR expression, concurrently increase circulating PCSK9 levels, which reduces their full therapeutic potential (45).

The aptamer used in this study, by neutralizing the statin-induced rise in PCSK9, likely allows for a more sustained and effective LDLR activity, leading to enhanced cholesterol clearance.

Existing literature on PCSK9 inhibitors primarily concentrates on mAbs and siRNAs, with aptamers rising as a promising but less explored option. In vitro studies have demonstrated the potential of the anti-PCSK9 aptamer to inhibit PCSK9-LDLR interactions and restore LDL uptake in hepatic cell lines. For instance, Sattari et al. selected an ssDNA aptamer (AP-1) via CE-SELEX, achieving dissociation constants (Kd) of 294 nM and halfmaximal inhibitory concentrations (IC₅₀) around 325-327 nM, verifying their inhibitory effects on PCSK9 (22).

Recently, aptamers have become more popular in research focusing on PCSK9 (15). Steffen et al. used a DNA aptamer-based array to analyze plasma levels of different proteins, such as PCSK9, in the Atherosclerosis Risk in Communities (ARIC) study (46). Gupta et al. utilized an anti-PCSK9 aptamer chemically modified with nucleotides (NapdU), which mimics amino acid side chains, to enhance and specify interactions between nucleic acids and proteins. A comparative analysis was undertaken to evaluate the efficacy of this anti-PCSK9 aptamer in relation to a PCSK9 mAb. The utility of the aptamer reagent in immunoaffinity liquid chromatography-mass spectrometry (IA-LC-MS) was validated through immunoaffinity enrichment experiments, showing advantages over the mAb in this context (47). Ando et al. highlighted that a PCSK9-binding RNA aptamer has potential applications both as an affinity reagent for analyzing PCSK9 protein and as a therapeutic agent for treating hypercholesterolemia (23). They also developed another aptamer, which is an RNA aptamer. DNA aptamer generally exhibits greater stability than RNA aptamers because of the presence of C-H bonds at the 2’ position of the deoxyribose sugar. This chemical difference provides the DNA aptamer with an inherent advantage in terms of stability. Additionally, the selection process for DNA aptamers tends to be simpler compared to that of RNA aptamers. Selecting an RNA aptamer typically involves reverse transcription and in vitro transcription during each selection round, along with the initial transcription required to generate an RNA library from a DNA library. In contrast, the selection process for a DNA aptamer does not necessitate these extra steps (23).

Our findings align with the established efficacy of PCSK9-targeted therapies but highlight the unique advantages of an aptamer-based approach. mAbs like alirocumab and evolocumab have proven highly effective in clinical trials, reducing LDL-C significantly (48). The magnitude of LDL-C reduction observed with our aptamer (particularly at 3 μM; and in combination) is comparable to these benchmarks.

Crucially, aptamers offer potential distinct benefits over mAbs. A recent review by Zhou et al. highlighted the advantages of nucleic acid aptamers, including lower immunogenicity, easier chemical synthesis and modification, and potentially lower production costs (16). The aptamer used in this study, in view of its enhanced stability, was modified through 3’-biotinylation and streptavidin conjugation to reduce nuclease degradation and renal clearance, which is a key step in realizing these theoretical benefits in vivo, a challenge noted in earlier aptamer development studies (16,44). A metaanalysis by Guedeney et al. confirmed that adding PCSK9 inhibitors to consistent background lipid-lowering therapy provides significant LDL-C reduction and cardiovascular risk reduction (49). Our study provides preclinical evidence that the aptamer can be an alternative to biologic antibodies. On the other hand, small nucleic acid therapeutics, including siRNAs and aptamers, offer targeted modulation of gene or protein function. However, siRNAs face inherent challenges related to stability, delivery, and immunogenicity. Without protective carriers, siRNAs are rapidly degraded by nucleases in the bloodstream, necessitating complex delivery systems such as lipid nanoparticles or viral vectors to achieve effective intracellular uptake and RNAi-mediated gene silencing. In contrast, aptamers like AP-1 are chemically synthesized and can directly bind extracellular targets such as PCSK9 with high affinity and specificity, bypassing the need for cellular internalization. Their smaller size and chemical versatility allow enhanced tissue penetration, longer circulation time, and lower immunogenicity compared with siRNA constructs. Furthermore, aptamers can be easily modified to improve stability and pharmacokinetics, providing precise control over dosing and rapid therapeutic effects. In fact, the most significant limitation of siRNA therapeutics resides in their dependence on complex delivery systems for efficient cellular uptake, whereas aptamers inherently function as precise molecular targeting agents (50,51).

Collectively, these properties render aptamers a highly attractive alternative to siRNAs for extracellular protein targets, offering simplified formulation, predictable pharmacodynamics, and translational potential for clinical application (52).

The main limitation of this study is its relatively short treatment duration. Although the aptamer exhibited a clear therapeutic effect within the 4-week treatment period, extending the duration of intervention is warranted to more accurately define its maximal efficacy profile. A longer treatment window would also permit a rigorous head-to-head comparison with an anti-PCSK9 monoclonal antibody within the same experimental model, an essential requirement, as the current timeframe precludes any definitive conclusions regarding the relative potency of the aptamer versus established biologics. In addition, comprehensive toxicological assessments, detailed pharmacokinetic and pharmacodynamic analyses, and early dosefinding studies will be crucial to delineate its safety margins and to inform the selection of appropriate starting doses for eventual translation into human studies.

CONCLUSION

This study provides compelling preclinical evidence for the efficacy of a modified ssDNA aptamer in ameliorating dyslipidemia by targeting PCSK9. The aptamer demonstrated a concentration-dependent ability to improve the atherogenic lipid profile, with the most promising results observed when combined with statin therapy. Our findings position this aptamer as a viable and potential alternative to existing PCSK9 inhibitors, such as mAbs. The successful modifications, which enhanced in vivo stability, underscore the potential of aptamer technology to resolve inherent limitations. Ultimately, this research validates the promise of aptamer-based strategies for addressing residual dyslipidemia.

Authors’ contributions

Y. Eshaghi Milasi conducted the methodology, investigation, formal analysis, and wrote the initial draft of the manuscript. F. Sakhaei contributed to the project management, while A.A. Palizban designed and supervised the study, analyzed the data, and reviewed and edited the article. All authors have read and approved the finalized article. Each author has fulfilled the authorship criteria and affirmed that this article represents honest and original work.

Conflicts of interest statement

The authors declared no conflict of interest in this study.

AI declaration

During the preparation of this work, the authors used ChatGPT and Grammarly to improve readability and language. After using these tools, the authors reviewed and edited the content and take full responsibility for the content of the publication.

Data availability

The data supporting the findings of this study are documented and available from the corresponding author upon reasonable request. Researchers interested in accessing the data should contact the corresponding author to discuss the terms and conditions of access.