IGFBP3 and cisplatin synergistically suppress HeLa cell proliferation and migration through NRF2 inhibition

Abstract

Background and purpose:

Cisplatin is a cornerstone of cervical cancer treatment, but chemoresistance and toxicity limit its efficacy. The NRF2-mediated antioxidant pathway contributes to cisplatin resistance. This study investigated whether insulin-like growth factor-binding protein 3 (IGFBP3) could enhance cisplatin efficacy by suppressing NRF2 signaling.

Experimental approach:

HeLa cervical cancer cells were treated with IGFBP3, cisplatin, or their combination. Cytotoxicity and drug synergy were evaluated using the MTT assay and combination index analysis. Oxidative stress markers and antioxidant enzyme activities were assessed. NRF2 protein expression was determined by Western blotting and ELISA. Cell migration was evaluated using a scratch assay, and NRF2 target gene expression was measured by RT-qPCR.

Findings/Results:

IGFBP3 combined with cisplatin produced synergistic cytotoxicity (combination index <1). Compared with either monotherapy, the combination significantly suppressed NRF2 expression, increased oxidative stress, reduced antioxidant enzyme activities, and inhibited cell migration. Expression of NRF2 target genes, including HO-1, CAT, SOD, and GPX, was also downregulated.

Conclusion and implications:

IGFBP3 synergized with cisplatin to inhibit cervical cancer cell proliferation and migration, at least partly through suppression of the NRF2-mediated antioxidant pathway. IGFBP3 may therefore represent a promising chemosensitizing agent for overcoming cisplatin resistance and warrants further preclinical investigation.

INTRODUCTION

Cervical cancer persists as a major global health challenge, ranking as the fourth most common cancer and cause of cancer-related mortality among women worldwide, with a disproportionately high burden in less developed regions (1,2). Despite advances in screening and the implementation of vaccination programs against high-risk human papillomavirus (HPV), the primary etiological agent, cervical cancer continues to account for significant morbidity and mortality, underscoring the urgent and continuous need for enhanced therapeutic strategies (3).

The current cornerstone for managing locally advanced and metastatic cervical cancer encompasses a multimodal approach, including surgery, radiotherapy, and platinum-based chemotherapy like Cisplatin. Cisplatin exerts its cytotoxic effects primarily through DNA cross-linking, which triggers apoptosis (4). An important facet of its mechanism is the generation of reactive oxygen species (ROS), contributing to oxidative DNA damage and apoptotic signalling; however, the clinical utility of cisplatin is often limited by chemoresistance and systemic toxicities (5,6).

This oxidative stress induced by cisplatin engages cellular defence mechanisms, notably the antioxidant pathway regulated by nuclear factor erythroid 2-related factor 2 (NRF2). A central pathway implicated in both carcinogenesis and chemoresistance is the cellular response to oxidative stress. Oxidative stress arises from an imbalance between the production of ROS and the capacity of the cellular antioxidant defence system (7). While moderate ROS levels can facilitate normal signaling, excessive and sustained oxidative stress inflicts damage on lipids, proteins, and nucleic acids, driving genomic instability and promoting tumour progression (8). The transcription factor NRF2 serves as the master regulator of the cellular antioxidant response (9). Under homeostatic conditions, NRF2 is bound by Kelch-like ECH-associated protein 1 (KEAP1) and targeted for degradation. Under oxidative stress, NRF2 stabilizes, translocates to the nucleus, and activates genes encoding antioxidant enzymes such as heme oxygenase (HO)-1, superoxide dismutase (SOD), catalase, and glutathione peroxidase (GPX) (10). NRF2 target genes encode key antioxidant enzymes, including HO-1, SOD, catalase, and GPX, which collectively mitigate oxidative damage (8,11).

While NRF2 activation protects normal cells, its persistent upregulation in tumors promotes chemoresistance. Consequently, targeting NRF2 has emerged as a strategy to resensitize cancer cells to chemotherapy (12,13). Insulin-like growth factor binding protein 3 (IGFBP3) has demonstrated IGF- independent antitumor functions, including modulation of oxidative stress and apoptosis in various cancers (14,15). Recent evidence suggests that IGFBP3 can influence critical signalling pathways and gene expression programs related to DNA damage repair, senescence, and oxidative stress (15,16). Its expression and function are context-dependent in various cancers, positioning it as a potential modulator of therapeutic response (17,18). However, its role in regulating NRF2 activity and its potential to synergize with cisplatin in cervical cancer remain unexplored.

Given the established role of NRF2- mediated antioxidant response in conferring cisplatin resistance in cervical cancer (12,19), and emerging evidence that IGFBP3 can modulate oxidative stress and apoptotic pathways, we hypothesized that IGFBP3 could sensitize cervical cancer cells to cisplatin by disrupting NRF2 activity. We hypothesized that IGFBP3 enhances cisplatin sensitivity in cervical cancer cells by suppressing the NRF2- mediated antioxidant response. This study aimed to investigate the synergistic effects of IGFBP3 and cisplatin in HeLa cells, with a focus on NRF2 pathway activity, oxidative stress markers, and cell migration.

MATERIALS AND METHOD

Chemicals and reagents

Recombinant human IGFBP-3 (Bio Basic, Canada, Cat. No. RC216-12B3, expressed in E. coli) is a single non-glycosylated polypeptide chain containing 264 amino acids and was reconstituted in sterile phosphate-buffered saline (PBS) as per the manufacturer's protocol. Cisplatin (Sobhan Oncology, Iran) was dissolved in sterile 0.9% saline solution immediately before each experiment to prevent aquation. Enzyme-linked immunosorbent assay (ELISA) kits for SOD (Cat. No. KSOD96), catalase (Cat. No. KCAT96), and MDA (Cat. No. KMDA96) were obtained from Kiazist, IRAN. ELISA kits for GPX (Cat. No. RS 504) and NRF2 (Cat. No. SL2664Hu) were procured from RANDOX (Ireland) and SunLong Biotec (China), respectively.

Cell culture and cell viability analysis

Cervix adenocarcinoma cells (HeLa) were purchased from Bonbiotech (Tehran, Iran). HeLa cells were maintained in Dulbecco's modified Eagle medium (DMEM)-high glucose medium (Gibco, USA) supplemented with 10 % fetal bovine serum (FBS; Gibco, USA) and 1% penicillin/streptomycin (Gibco, USA) in a 5% CO2 incubator at 37 °C.

For cell viability evaluation, [3-(4,5- dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), cell proliferation, and metabolic assays were performed. HeLa cells (2.5 × 10³ cells/well) were seeded in a 96-well plate for 24 h in 100 μL of medium per well. After acclimatization, cells were treated with cisplatin (1.5, 3.1, 6.2, 12.5, and 25 μg/mL), IGFBP3 (0.25, 0.5, 1, 2, and 4 μg/mL), and their combination for 48 h. Then, 10 μL of MTT solution (0.5 mg/mL) was added, and the plates were incubated for 4 h. After the culture medium was discarded, 150 μL of dimethyl sulfoxide (DMSO) was added to each well to disperse formazan crystals for 20 min at 37 °C and gentle shaking. The absorbance was quantified at a wavelength of 570 nm by an ELISA microplate reader, and the IC50 was determined using GraphPad Prism 10. The Chou-Talalay combination index (CI) theory is based on the median-effect equation, first described in 1984. This method is most widely used to interpret pharmacological chemical interactions. CI was calculated using CompuSyn software, and CI values indicate drug combination as follows: synergism (CI < 1), additive effect (CI = 1), and antagonism (CI > 1).

Culture of normal human kidney epithelial cells

Normal human embryonic kidney cells (HEK293 cell line) were obtained from the Pasteur Institute (Tehran, Iran). Cells were cultured in DMEM high-glucose medium (Gib co, USA) supplemented with 0.1 ng/mL human recombinant epidermal growth factor, 1 0 % FBS (Gibco, USA), and 1% penicillin/streptomycin (Gibco, USA) in a 5% CO2 incubator at 37 °C and used within passages 15-25 for all experiments.

Western blot analysis

HeLa cells seeded at 3 × 10⁵ per well in 6- well plates were treated with IGFBP3, cisplatin, and IGFBP3 co-treated with cisplatin for 48 h. Cell lysates were collected using RIPA lysis buffer (Sigma-Aldrich, USA), and the BCA protein assay kit (DNA Biotech, USA) was used to quantify the total protein in the HeLa cells. Equal amounts of protein were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), and finally, proteins were transferred to polyvinylidene difluoride (PVDF) membranes after blocking with 5% skim milk for 1 h at room temperature. Membranes were incubated with anti-NRF2 primary antibodies (Cell Signalling: 12721, 1:1000 dilution). GAPDH (Santa Cruz Biotechnology, sc-47724, 1:2000) was used as an internal control. After washing, membranes were incubated with HRP-conjugated anti-rabbit secondary antibody (Santa Cruz Biotechnology, sc-2357, 1:5000) for 1 h at room temperature. Lastly, the ECL solution (Parstous, Iran) was used for signal detection, and images were recorded and quantified using FUSION FX software version 5.

NRF2 protein levels

The NRF2 ELISA kit used Sandwich- ELI SA as the m ethod. The microELISA strip plate provided in this kit has been pre-coated with an antibody specific to NRF2. Supernatant was collected after centrifuging for 20 min at 2000-3000 rpm. In the microELISA strip plate, 40 pL of sample dilution buffer and 10 pL of the sample were added, sealed with the closure plate membrane, and incubated for 30 min at 37 °C. Subsequently, cells were washed twice with 1 mL of PBS. Following that, the medium was removed, standards or samples were added to the appropriate microELISA strip plate wells, and combined with the specific antibody. Then, a horseradish peroxidase (HRP)-conjugated antibody specific for NRF2 was added to each microELISA strip plate well and incubated. Free components were washed away. The TMB substrate solution was added to each well. Only those wells that contained NRF2 and HRP-conjugated NRF2 antibody appeared blue in color and then turned yellow after the addition of the stop solution. The optical density (OD) was measured spectrophotometrically at a wavelength of 450 nm. The OD value was proportional to the concentration of NRF2. The concentration of NRF2 in the samples was calculated by comparing the OD of the samples to the standard curve.

Real time-quantitative polymerase chain reaction analysis

Total RNA from HeLa cells was extracted using the total RNA extraction kit (Parstous, Iran), and RNA concentration was measured with a NanoDrop 2000 (Thermo Fisher, USA). cDNA was synthesized using the Easy^TM cDNA synthesis kit (Parstous, Iran), RT-qPCR was performed with SYBR® Green RT-PCR master mix (Parstous, Iran), and PCR reactions were carried out in the Lava96 RT-PCR detection system (DaAnGene Co Ltd, China). GAPDH was considered a housekeeping gene for an internal control, and fold changes in target gene expression were calculated by the comparative 2^-ΔΔCt method. The primers used are presented in Table 1.

Table 1.

Primer sequences used for real-time quantitative polymerase chain reaction analysis.

Gene	Forward	Reverse
SOD	CTCACTCTCAGGAGACCATTGC	CCACAAGCCAAACGACTTCCAG
GPX	GTGCTCGGCTTCCCGTGCAAC	CTCGAAGAGCAT GAAGTT GGGC
CAT	GTGCGGAGATTCAACACTGCCA	CGGCAATGTTCTCACACAGACG
HO-1	CCAGCAACAAAGTGCAAGATTC	AAGCTGAGTGTAAGGACCCA
GAPDH	GGTGGTCTCCTCTGACTTCAACA	GTTGCTGTAGCCAAATTCGTTGT

Migration analysis

HeLa cells were seeded in a 6-well plate at a density of 5 × 10⁵ cells per well (500,000 cells/mL) and incubated for 24 h in medium with 10% FBS. After confluency reached 60%, a sterile, crystal-clear pipette tip was used to create a wound. To minimize the contribution of cell proliferation to wound closure, cells were pre-treated with 10 μg/mL mitomycin C (Sigma-Aldrich, USA) for 2 h before scratch creation and during the subsequent incubation period. Then, wells were washed with PBS to remove detached cells. Scratch images were acquired with an inverted microscope at time zero (T0). Then, the cells were treated with various designed concentrations and subsequently incubated for 24 h at 5% CO₂ and 37 °C. Re-imaging was performed after 24 and 48 h. Images were analyzed using the ImageJ software to measure the scratch area.

Determination of oxidative stress markers

ROS detection

HeLa cells were seeded in black 96-well plates and incubated at 37 °C for 30 min with dichlorofluorescein diacetate (DCFH-DA) dye (20 μM), an indicator for detecting the intracellular levels of ROS. Then, ROS fluorescence was measured using a spectrophotometer microplate reader at 480- 520 nm.

Lipid peroxidation assay

Malondialdehyde (MDA) is a byproduct formed as a result of lipid peroxidation and direct oxidative damage to cellular polyunsaturated fatty acids (PUFA). Thiobarbituric acid reactive substances (TBARS) were measured as an indicator of MDA levels. Briefly, 2 × 10⁶ cells were collected and washed with PBS. The cells were homogenized with MDA lysis buffer and BHT100X on ice, and the homogenate was centrifuged at 6000 g for 10 min. Then, the supernatant was incubated at 95 °C for 60 min and cooled to room temperature for 10 min. The mixture was exposed to n-butanol for maximum sen sitivity and centrifuged at 6000 g for 3 min. Finally, the absorbance was measured at 532 nm. Concentrations of MDA are presented as nmol/mg protein.

GPX activity assay

GPX activity was measured using a method based on that of Kraus & Ganther. GPX catalyzes the oxidation of GSH by cumene hydroperoxide. In the presence of glutathione reductase and NADPH, the oxidized GSSG is immediately converted to the reduced form with a concomitant oxidation of NADPH to NADP⁺. The decrease in absorbance at 340 nm was measured.

SOD activity assay

HeLa cells were collected by centrifugation for 8 min (2500 g, 4 °C). The cell pellet was lysed in PBS containing a protease inhibitor cocktail and centrifuged at 12000 g (15 min, 4 °C). The supernatant was used for the experiment. The reactions were started by adding the XO working solution to the samples and then shaking, followed by incubation at 37 °C for 20 min. The SOD activity was then read at 570 nm.

Catalase activity assay

In this method, catalase present in the sample breaks down H₂O₂ and produces H₂O and O₂. After collecting the cell suspension by centrifugation, the cell pellets were frozen and thawed in PBS with a protease inhibitor cocktail to lyse cells and centrifuged at 12000 g for 15 min at 4 °C. The supernatant was used for the test. According to the manufacturer’s protocols, 20 μL of the sample, standard, and blank were transferred into a 96-well plate. The reactions were started by adding 100 μL catalase buffer assay 1X, 30 μL catalase methanol, and 20 μL catalase substrate, respectively (incubation at room temperature, 20 min). Then, the catalase stop solution and catalase chromogen were added and incubated for 10 min in the dark at room temperature. The reactions were terminated by catalase periodate, with produce purple dye, and OD was measured at 540 nm by a microplate reader.

Statistical analysis

GraphPad Prism 8.4.2 software (GraphPad Software, USA) and one-way ANOVA followed by Tukey’s multiple comparison tests were used for the data analysis. The results have been presented as mean ± SEM of five independent experiments (n = 6). P-values ≤ 0.05 were considered statistically significant. Data normality was assessed using the Shapiro-Wilk test before applying ANOVA.

RESULT

Effects of IGFBP3 and cisplatin on HeLa cell viability

Based on initial cytotoxicity screening (detailed methodology as previously described for this model system) (20). The half-maximal inhibitory concentrations (IC₅₀) for cisplatin and IGFBP3 in HeLa cells were determined to be 6.06 ± 0.26 μg/mL and 1.12 ± 0.03 μg/mL, respectively, calculated using GraphPad Prism software. Cisplatin was tested at concentrations of 1.5, 3.1, 6.2, 12.5, and 25 μg/mL, and IGFBP-3 was tested at 0.25, 0.5, 1, 2, and 4 μg/mL.

For the combination therapy, the fixed-ratio method described by Chou and Talalay was employed. A constant ratio of 5.5:1 was established by dividing the IC₅₀ of cisplatin (6.06 ± 0.26 μg/mL) by the IC₅₀ of IGFBP3 (1.12 ± 0.03 μg/mL). Based on this ratio, combination treatments were prepared using serial dilutions of cisplatin ranging from 0.5 to 8 μg/mL, with corresponding proportional concentrations of IGFBP3 ranging from 0.09 to 1.45 μg/mL to maintain the 5.5:1 ratio across all samples. HeLa cells were treated with these combinations for 48 h, and cell viability was assessed via the MTT assay. The IC₅₀ value for the combination treatment was calculated to be 3.63 ± 0.28 μg/mL.

For subsequent experiments, the CI was determined to be 0.935, indicating a modest synergistic interaction. Consequently, based on an effect level of 45%, the concentrations selected for the combination treatment in all further assays were 2.53 μg/mL for cisplatin and 0.46 μg/mL for IGFBP3. The dose- response curves for cisplatin, IGFBP3, and their combination are shown in Fig. 1. The combination treatment demonstrated a leftward shift in the curve, indicating synergistic cytotoxicity.

Fig. 1.

Dose-response curves of cisplatin, IGFBP3, and their combination in HeLa cells. Values are presented as mean ± SEM based on a minimum of three experiments. **P < 0.01 and ***P < 0.001 indicate significant differences in comparison with the control group. IGFBP3, Insulin-like growth factor-binding protein-3.

To evaluate the safety profile of this combination, the same concentrations were also applied to normal human kidney epithelial (HEK293) cells as a non-cancerous control model (Fig. 2). The MTT assay confirmed that the combination treatment exhibited no significant toxicity in these normal cells, highlighting its potential selectivity for targeting cancer cells while sparing healthy tissues. This finding underscores the therapeutic potential of the IGFBP3 and cisplatin combination, as it effectively impairs cancer cell viability without harming normal cells at the tested concentrations.

Fig. 2.

Dose-response curves of cisplatin, IGFBP3, and their combination in HEK293 cells. Values are presented as mean ± SEM based on a minimum of three experiments. **P < 0.01 and ***P < 0.001 indicate significant differences in comparison with the control group. IGFBP3, Insulin-like growth factor-binding protein-3.

The NRF2 protein expression

NRF2 protein levels were assessed by western blot (Fig. 3A), and the results were quantified by ImageJ software (Fig. 3B), demonstrating that cisplatin monotherapy significantly decreased NRF2 protein expression compared to the control group. Co-treatment with IGFBP3 and cisplatin significantly reduced NRF2 protein and mRNA expression compared to cisplatin alone. NRF2 protein levels were quantified by ELISA, demonstrating that cisplatin treatment alone reduced NRF2 levels compared to control. The combination of IGFBP3 and cisplatin further decreased NRF2 levels, showing a significant reduction compared to cisplatin monotherapy (Fig. 4).

Fig. 3.

The impact of cisplatin and IGFBP3 monotherapy, along with their combination therapy, on NRF2 protein expression, assessed by Western blot assay in HELA cells, is reported. (A) The NRF2 protein expression was assessed by Western blot, and (B) the bar chart of Western blot signals was generated using ImageJ software. Values are presented as mean ± SEM based on a minimum of three experiments. *P < 0.05 and ***P < 0.001 indicate significant differences compared to the control group; #P < 0.05 versus cisplatin group. IGFBP3, Insulin-like growth factor-binding protein-3; NRF2, nuclear factor erythroid 2-related factor 2.

Fig. 4.

The impact of cisplatin and IGFBP3 monotherapy, along with their combination, on NRF2 protein levels, assessed by ELISA in HeLa cells, is reported. Values are presented as mean ± SEM based on a minimum of three experiments. **P < 0.01 and ***P < 0.001 indicate significant differences compared to the control group; ##P < 0.01 versus cisplatin group. IGFBP3, Insulin-like growth factor-binding protein-3; NRF2, nuclear factor erythroid 2-related factor 2.

Expression of NRF2 target genes

The studied genes included HO-1, catalase, SOD, and GPX, all of which play key roles in cellular antioxidant defense. Results demonstrated that cisplatin monotherapy significantly downregulated HO-1 (Fig. 5A), catalase (Fig. 5B), and SOD (Fig. 5C) in comparison with the control group, indicating suppression of the NRF2 pathway in response to drug-induced oxidative stress. The combination treatment of IGFBP3 and cisplatin showed a more potent effect, significantly suppressing the expression of NRF2 target genes, especially catalase and GPX (Fig. 5D), compared to cisplatin alone. This finding suggests that IGFBP3 alone did not significantly affect the expression of these genes, indicating its inhibitory effect is specifically manifested in combination with cisplatin.

Fig. 5.

The impact of cisplatin and IGFBP3 monotherapy, along with their combination, on mRNA fold change of (A) HO-1, (B) CAT, (C) SOD, and (D) GPX was assessed by RT-PCR assay in HeLa cells, as reported. Values are presented as mean ± SEM based on a minimum of three experiments. ***P < 0.001 indicates significant differences compared to the control group; ^##P < 0.01 versus cisplatin group. IGFBP3, Insulin-like growth factor-binding protein-3; HO-1, heme oxygenase-1; CAT, catalase; SOD, superoxide dismutase; GPX, glutathione peroxidase.

Inhibition of cell migration

Cell migration is a critical processin cancer metastasis, and its inhibition represents a key therapeutic target. The wound-healing (scratch) assay was employed to evaluate the anti-migratory effects of cisplatin, IGFBP3, and their combination in HeLa cells.

The results demonstrated significant differences in migration capacity across treatment groups:

Control group (Fig. 6A) exhibited robust migration, with ~75-86% wound closure after 24-48 h. This reflects the inherent metastatic potential of untreated cervical cancer cells.

Fig. 6.

The impact of cisplatin and IGFBP3 monotherapy, along with their combination, on the inhibition of cell migration was assessed by a migration assay in HeLa cells, as reported: (A) Control; (B) cisplatin; (C) IGFBP3; (D) the combination; and (E) percent of cell migration in each treatment. Values are presented as mean ± SEM based on a minimum of three experiments. **P < 0.01 and ***P < 0.001 indicate significant differences compared to the control group; ###P < 0.001 versus cisplatin group. IGFBP3, Insulin-like growth factor-binding protein-3.

Cisplatin monotherapy (Fig. 6B) showed moderate migration inhibition (59-67% closure). Aligned with cisplatin’s known anti-proliferative effects, though its impact on migration is typically limited.

IGFBP3 monotherapy (Fig. 6C) slightly decreased migration (70-78% closure), though not statistically significant versus the control group. This suggests context- dependent roles of IGFBP3 in cell motility, potentially through IGF-independent mechanisms.

Combination therapy (Fig. 6D) markedly suppressed migration (27-36% closure). The synergistic effect indicates that IGFBP3 potentiates cisplatin’s anti-migratory action, possibly by disrupting cytoskeletal dynamics or adhesion signaling (Fig. 6A-E).

Oxidative stress markers

ROS and MDA levels

MDA, a marker of lipid peroxidation, was significantly elevated in cisplatin-treated cells compared to the control group. The combination therapy further increased MDA levels, indicating exacerbated oxidative membrane damage.

Cisplatin treatment increased ROS levels, while IGFBP3 alone had no significant effect. The combination therapy further amplified ROS accumulation, suggesting a synergistic pro-oxidant mechanism (Fig. 7A and B).

Fig. 7.

The impact of cisplatin and IGFBP3 monotherapy, along with their combination, on (A) MDA and (B) ROS levels was assessed by fluorescence assay in HeLa cells, as reported. Values are presented as mean ± SEM based on a minimum of three experiments. ***P < 0.001 indicates significant differences compared to the control group; ^###P < 0.001 versus cisplatin group. IGFBP3, Insulin-like growth factor-binding protein-3; MDA, malondialdehyde; ROS, reactive oxygen species.

Antioxidant enzyme activities

Catalase, a key antioxidant enzyme, plays a crucial role in detoxifying hydrogen peroxide (H₂O₂) into water and oxygen. As shown in Fig. 8A, cisplatin monotherapy significantly reduced catalase activity compared to the control group, indicating oxidative stress induction. The combination therapy led to a further reduction in catalase activity compared to cisplatin alone. SOD is a primary defence against superoxide radicals (O₂^-). As shown in Fig. 8B, the combination therapy caused a further significant decrease, suggesting enhanced oxidative stress.

Fig. 8.

The impact of cisplatin and IGFBP3 monotherapy, along with their combination, on (A) CAT, (B) SOD, and (C) GPX activity levels was assessed by ELISA in HeLa cells, as reported. Values are presented as mean ± SEM based on a minimum of three experiments. ***P < 0.001 indicates significant differences compared to the control group; ^#P < 0.05 and ^###P < 0.001 versus cisplatin group. IGFBP3, Insulin-like growth factor-binding protein-3; CAT, catalase; SOD, superoxide dismutase; GPX, glutathione peroxidase.

GPX is essential for reducing lipid hydroperoxides and hydrogen peroxide, protecting cells from oxidative damage. Figure 8C demonstrates that cisplatin treatment decreased GPX activity compared to the control group, though insignificant (P > 0.05). The combination therapy resulted in a further decline in GPX activity, indicating a synergistic pro-oxidant effect.

DISCUSSION

Cervical cancer remains a formidable challenge, with cisplatin resistance representing a major obstacle to successful treatment. Our study identifies IGFBP3 as a potent synergistic partner to cisplatin in HeLa cervical cancer cells. The principal novel finding is that this synergy is mechanistically rooted in the profound suppression of the NRF2-mediated antioxidant pathway, leading to an irreversible state of oxidative stress, culminating in enhanced cell death and a marked inhibition of migration.

The Chou-Talalay analysis confirmed a synergistic interaction (CI < 1), which was notably selective for cancer cells, as evidenced by the minimal toxicity in normal kidney epithelial cells. This favorable therapeutic window is critical, as it suggests the combination could potentially mitigate the dose-limiting toxicities associated with cisplatin monotherapy. Crucially, this synergistic cytotoxicity was not observed in normal human kidney epithelial cells, highlighting a favorable therapeutic window and suggesting a cancer cell-specific vulnerability that is exploited by the combination. This selective toxicity is of paramount clinical importance, as it hints at the potential for reduced off-target effects, a major drawback of conventional cisplatin therapy (5).

The core of our mechanistic investigation centered on the NRF2 pathway, a master regulator of cellular antioxidant response frequently hijacked in cancers to promote chemoresistance (7,20). While cisplatin alone can transiently activate NRF2 as a compensatory survival mechanism, co-treatment with IGFBP3 potently prevented this adaptation. Our data demonstrate that the combination led to a significant reduction in both NRF2 protein levels and its transcriptional activity, resulting in the coordinated downregulation of key antioxidant enzymes (HO-1, catalase, SOD, GPX) at the gene and functional levels. This collapse of the antioxidant defense system created a permissive environment for the unchecked accumulation of ROS and extensive lipid peroxidation, as measured by elevated MDA levels. This cascade effectively pushes cancer cells beyond a survivable threshold of oxidative stress (9).

Furthermore, the combination therapy exhibited a pronounced anti-migratory effect, significantly surpassing the moderate impact of cisplatin alone. This finding aligns with the broader context of IGFBP3 as a modulator of cell motility. For instance, in oral squamous cell carcinoma, IGFBP3 was shown to inhibit invasion by downregulating matrix metalloproteinases (18). Conversely, a study in glioblastoma reported a pro-migratory role for IGFBP3 through PD-L1 signaling (15) highlighting its context-dependent functions. Our data in cervical cancer cells strongly support the tumor-suppressive, anti-migratory arm of IGFBP3's activity. This suggests that the strategy may not only enhance cytotoxicity at the primary site but could also impede metastatic dissemination, a property of high therapeutic value.

Our findings position IGFBP3 within a growing class of chemosensitizers that function by targeting redox homeostasis. However, it extends the existing literature in several key aspects. Previous studies have shown that IGFBP3 can influence radiosensitivity and apoptosis in other cancers (21,22,23,24). Our work is among the first to directly link IGFBP3 to the suppression of the NRF2 pathway in cervical cancer and to demonstrate its synergistic potential with cisplatin.

While other chemosensitizing agents, such as ginsenoside CK (targeting Ras/ERK/MAPK signaling) or pharmacological ascorbic acid (acting as a direct pro-oxidant), have shown promise in cervical cancer models, our findings position IGFBP3 as a distinct and novel candidate. Its primary mechanism, direct suppression of the NRF2 transcriptional program, uniquely targets the master regulator of cellular antioxidant defense, thereby disabling a fundamental adaptive survival pathway used by cancer cells to evade cisplatin-induced oxidative stress (25,26).

The precise molecular step at which IGFBP3 interferes with the KEAP1-NRF2 axis remains to be fully elucidated. Metastasis is a multi-step process that remains the primary cause of mortality in cancer patients, and the migration of cells from the primary tumor site is a pivotal early event in this cascade (27). Our wound-healing assay demonstrated that while cisplatin alone offered moderate inhibition of migration and IGFBP3 alone had a negligible effect, their combination resulted in a dramatic suppression of wound closure. This profound anti-migratory effect suggests that the combination therapy may not only be effective at eradicating the primary tumor but could also potentially impede the metastatic spread of the disease. The molecular underpinnings of this effect warrant further investigation, but may be linked to the disruption of cytoskeletal dynamics, alterations in adhesion molecule expression, or the activation of signaling pathways that govern cell motility, all of which can be influenced by the severe oxidative stress imposed by the treatment (25,26). The multifaceted role of IGFBP3 itself adds a layer of complexity and promise to these findings. Initially identified as a carrier protein for IGF-1 in the circulation, IGFBP3 has since been recognized as a molecule with potent IGF- independent tumor-suppressive functions (28,29). It has been implicated in inducing apoptosis, promoting senescence, and inhibiting cell growth in various cancer models (16). Based on our results, we propose two testable hypotheses for future investigation: (1) IGFBP3 may enhance the degradation of NRF2 by modulating KEAP1 function or the ubiquitin-proteasome system, and (2) IGFBP3 might impair the nuclear translocation of stabilized NRF2. These could be experimentally addressed by assessing NRF2 ubiquitination status and performing nuclear-cytoplasmic fractionation studies following IGFBP3 treatment. The observed reduction in wound closure likely results from a combination of cytotoxic, anti-proliferative, and potential anti-migratory effects of the combination therapy.

Crucially, this synergistic cytotoxicity was not observed in normal human kidney epithelial cells at the tested concentrations, suggesting a potential therapeutic window. This selectivity is paramount, as the clinical utility of any chemosensitizer depends on widening the therapeutic index, sensitizing the tumor while protecting normal tissue, particularly the dose-limiting kidneys. Future in vivo studies must explicitly evaluate the impact of the combination on renal function and other healthy tissues.

While our data robustly establish the suppression of the NRF2 pathway as a key effector of the synergy, the precise molecular trigger by which IGFBP3 achieves this remains to be fully elucidated. Based on known biology, several testable hypotheses emerge: (A) IGFBP3 may bind to IGF-1R, inhibiting the PI3K/AKT survival pathway, which is known to phosphorylate and stabilize NRF2 (30); (B) internalized IGFBP3 could interact directly with the KEAP1 ubiquitin ligase complex, enhancing NRF2 degradation (28); and (C) IGFBP3 might induce a competing cellular stress response (e.g., ER stress) that reprioritizes transcriptional programs away from the antioxidant defense (16). Future studies employing co-immunoprecipitation, kinase activity assays, and targeted genetic knockdowns are warranted to discriminate between these and other mechanisms upstream of NRF2.

It is noteworthy that in our experimental setup, cisplatin monotherapy at the 48-h time point led to reduced NRF2 levels. While this contrasts with studies reporting acute NRF2 induction by cisplatin, it may reflect the collapse of general protein synthesis during late-stage apoptosis at the tested concentration. Crucially, the combination treatment drove NRF2 expression significantly lower, demonstrating IGFBP3's active role in suppressing this pathway.

We acknowledge the limitations of our in vitro study using a single cell line. Future work must validate this synergy in vivo using patient-derived xenografts and a panel of cervical cancer cell lines with varying genetic backgrounds and resistance profiles. Additionally, exploring the interaction in non-HPV-associated cervical cancer models would be valuable. Furthermore, the analysis of NRF2 in total cell lysates, rather than nuclear fractions, serves as a proxy for pathway activity. Future studies employing subcellular fractionation would more precisely delineate the effect on NRF2 translocation.

In summary, this study provides novel and compelling evidence that IGFBP3 acts as an effective chemosensitizer to cisplatin in cervical cancer by disabling the NRF2-mediated antioxidant response. This strategy of targeting a key resistance pathway offers a rational and promising approach to overcoming cisplatin resistance. Given its selective toxicity, the IGFBP3-cisplatin combination warrants serious consideration for further preclinical development as a potential therapeutic strategy for cervical cancer.

CONCLUSION

In conclusion, our study demonstrated that IGFBP3 is a powerful synergistic partner to cisplatin, with a mechanism fundamentally rooted in the abrogation of the NRF2-mediated antioxidant response. This leads to an irreversible accumulation of oxidative damage, culminating in enhanced cell death and inhibited wound closure. The favorable toxicity profile in normal cells underscores its therapeutic potential. Therefore, targeting the NRF2 pathway with adjunctive agents like IGFBP3 represents a promising strategy to overcome cisplatin resistance, meriting accelerated preclinical evaluation to improve outcomes for patients with cervical cancer.

Authors’ contributions

M. Shokarzadeh and M. Rahmati Kukandeh designed the study. M. Rahmati Kukandeh conducted the study, analyzed the data, and wrote the article. M. Shokarzadeh and R. Ataee edited and revised the article. A. Bagheri reviewed the data analysis. M. Rahmati Kukandeh and E. Gharekhani drafted the manuscript and edited the article. All authors have read and approved the finalized article. Each author has fulfilled the authorship criteria and affirmed that this article represents honest and original work.

Conflicts of interest statement

The authors declared no conflicts of interest in the study.

AI declaration

We utilized AI-powered tools to check grammar and enhance the quality of readability and language. After using these tools, the authors reviewed and edited the content and take full responsibility for the content of the publication.

Data availability

The data supporting the findings of this study are documented and available from the corresponding author upon reasonable request. Researchers interested in accessing the data should contact the corresponding author to discuss the terms and conditions of access.