Exploring the potential role of miR-124 in angiogenesis in colorectal cancer

Abstract

Background

Colorectal cancer (CRC) is a significant contributor to cancer-associated mortality globally, emphasizing the urgent requirement for effective therapeutic strategies. Angiogenesis, a key process in CRC progression, has garnered attention as a target for anti-cancer therapies. microRNAs (miRNAs) have emerged as potential regulators of angiogenesis in cancer, including CRC. The goal of this investigation was to discover miRNAs that regulate angiogenesis in CRC and assess the impact of selected miRNA on CRC cells.

Methods

Through an in-silico analysis of angiogenesis-related genes (ARGs), we identified miRNAs with concurrent targeting of key genes involved in CRC angiogenesis, employing bioinformatic databases. Subsequently, the suppressive impacts of overexpressed miRNA on the expression of target genes were confirmed using quantitative real-time PCR. To evaluate angiogenesis, chicken chorioallantoic membrane (CAM) assays were employed.

Results

Our computational study identified hsa-miR-124-3p, hsa-miR-16-5p, hsa-miR-1-3p, hsa-miR-101-3p, and hsa-miR-146a-5p as possible angiogenesis modulators in CRC. Among these, hsa-miR-124-3p targeted the greatest number of genes. In CRC cells, miR-124 overexpression reduced mRNA levels of ANGPT2, HIF1A, MMP9, and VEGFA genes. Furthermore, it was discovered that upregulation of miR-124 can inhibit vascularization of the CAM.

Conclusion

These observations imply that miR-124 offers prospects as a potential therapy for CRC treatment. Further investigations are warranted to ascertain the therapeutic potential of miR-124-3p in animal models and patient samples. Our investigation underscores the significance of miRNAs as therapeutic targets for cancer angiogenesis and preliminary highlights the potential of miR‑124‑3p–mediated pathways as candidates for targeted intervention in CRC.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s00432-026-06550-5.

Introduction

Colorectal cancer (CRC) continues to pose a significant global health challenge, as it holds the third spot in terms of cancer incidence and the second spot in terms of cancer-related death on a global scale (Zygulska and Pierzchalski 2022; Bazyari et al. 2023; Firouzjaei et al. 2023a, b). Angiogenesis, an essential mechanism involving the formation of new blood vessels, plays a critical role in the development and spread of solid tumors, such as CRC (Darvish et al. 2023). Targeting angiogenesis has emerged as a promising therapeutic approach for CRC, as it can impede cancer cell growth and spread by disrupting their blood supply (Khazaei-Poul et al. 2021). Anti-angiogenic therapies, such as bevacizumab, ramucirumab, and aflibercept, which target vascular endothelial growth factor (VEGF) and its receptors, have been demonstrated to be effective in CRC (Tampellini et al. 2016; Battaglin et al. 2018). When used in combination with chemotherapy, these drugs can improve overall and progression-free survival in individuals with metastatic CRC. Nevertheless, current anti-angiogenic treatments suffer from several limitations (Procaccio et al. 2019). Drug resistance is a significant constraint, which may arise due to the activation of alternative angiogenic pathways or mutations in VEGF receptors (Itatani et al. 2018; Le et al. 2021). Another limitation is toxicity, as anti-angiogenic drugs can cause adverse effects such as hypertension, bleeding, and impaired wound healing (Pories and Wulf 2010). Moreover, the high cost of these drugs may impede patient access (Su et al. 2021). Furthermore, some studies have suggested that anti-angiogenic treatments may not be effective in all CRC patients, and the response to these treatments may depend on the tumor's molecular characteristics (Lavacchi et al. 2022; Zhang et al. 2023). Therefore, to find biomarkers that can indicate whether patients will benefit from anti-angiogenic therapies, further studies are required.

MicroRNAs (miRNAs), recognized as key modulators of gene expression, exert substantial influence on a wide array of biological processes, encompassing the development and progression of cancers (Mohammadi Yeganeh, Vasei et al., Bogaczyk et al. 2023; Firouzjaei et al. 2023a, b). Within the realm of CRC, miRNAs have been implicated in the regulation of angiogenesis, a critical process that underlies the new blood vessel formation derived from present ones. Numerous miRNAs have been identified as key regulators of anti-angiogenesis in CRC. Illustrative instances encompass miR-126 (Zhang et al. 2013), miR-34a (Hosseini et al. 2022), miR-200 family (Shen et al. 2015), and miR-145 (Yin et al. 2013), although these serve as merely a subset of the multitude of miRNAs engaged in the regulation of anti-angiogenesis within the context of CRC. It is crucial to note that miRNA regulation is an intricate process, where multiple miRNAs can act synergistically or antagonistically to modulate angiogenesis and tumor progression in CRC. Further investigation is necessary to fully comprehend the intricate mechanisms underlying miRNA-mediated anti-angiogenesis and its potential as a therapeutic intervention in CRC.

In this study, we aimed to utilize bioinformatic approaches to identify the most promising miRNAs targeting angiogenesis in CRC. Subsequently, we planned to assessed one of the selected miRNAs experimentally, further exploring their potential as therapeutic interventions.

Materials and methods

Identifying crucial genes

Identifying crucial genes is an initial and pivotal step in the quest to identify effective miRNAs for CRC. It is imperative to verify the efficacy of selected genes. Relevant information regarding angiogenesis-related genes (ARGs) was gathered from the GeneCards databases, accessible at https://www.genecards.org/. GeneCards is an all-inclusive database encompassing a wide array of features, including transcriptomics, proteomics, and genomics.

Identification of druggable angiogenesis genes in CRC

We used the Drug Gene Interaction Database (DGIdb) to discover drug-targeted genes associated with angiogenesis in CRC. DGIdb is a web-based resource that collects data from several sources to offer information on known and expected interactions between drugs and genes. The DGIdb search yielded several promising drug-gene interactions, providing information on possible therapeutic targets for regulating angiogenesis in CRC. To establish the correlation between druggable genes and CRC, we employed the Disease Specificity Index of Genes (DSIg) and Genes-Disease Association score (GDA score) from the DisGeNet database. DisGeNet, a comprehensive repository of gene-disease associations, was utilized to validate the relationship between these genes and CRC. By considering the GDA score and DSIg values, researchers can assess the significance and specificity of gene-disease associations, aiding in the identification of druggable genes and furthering our understanding of the molecular mechanisms underlying diseases such as CRC.

Identifying differentially expressed genes (DEGs) in the angiogenesis pathway of CRC

To identify DEGs within the angiogenesis pathway of CRC, we leveraged the NCBI Gene Expression Omnibus (GEO) database, accessible at http://www.ncbi.nlm.nih.gov/geo. GEO serves as a comprehensive functional genomics data repository, encompassing a diverse range of data, including microarrays, chips, and high-throughput gene expression data. From the GEO database, we selected a specific dataset and divided it into two groups based on the expression data, distinguishing CRC samples from normal colorectal tissues.

Analyzing datasets and identifying overexpressed genes

We utilized GEO2R, an online program based on the limma-Bioconductor package, available at http://www.ncbi.nlm.nih.gov/geo/geo2r/, to process the comparisons of datasets. Genes were chosen as overexpressed mRNAs if they exhibited adjusted (adj.) p-values less than 0.05. Furthermore, a volcano diagram was employed to visually represent the expression levels of genes.

Integration of protein–protein interaction (PPI) networks

We used the STRING web tool (version 11.5) available at https://string-db.org/ to investigate PPI and examine the relationship between certain genes. With the use of this instrument, one can examine protein interactions that are direct (physical) as well as indirect (functional). Within the scope of this study, we employed STRING to examine potential connections among the candidate genes. The interactions were evaluated utilizing different confidence scores, and the complete STRING network was constructed based on the medium confidence score.

Identification of miRNAs targeting ARG with high potential

To identify miRNAs with potential regulatory effects on ARG-related genes, we used miRNet 2.0 (https://www.mirnet.ca/) to screen miRNA–gene interactions. Genes with a GeneCards relevance score ≥ 5 were entered into the miRNet query to ensure inclusion of ARG-associated candidates. To examine their relevance in CRC, we cross-referenced the identified miRNAs with CRC-associated expression profiles in the miRCancer database(http://mircancer.ecu.edu/). This integrated approach enabled the selection of miRNAs both predicted to target ARG and dysregulated in CRC.

Insights into potential biological functions and pathway associations of selected miRNAs

To investigate the functional relevance of the selected miRNAs, we performed pathway and enrichment analysis using miRPathDB (https://mpd.bioinf.uni-sb.de/). The identifiers of the shortlisted miRNAs were submitted to the database, and enrichment outputs for biological processes, molecular functions, cellular components, and pathway associations were retrieved. This analysis enabled us to identify pathways potentially regulated by the candidate miRNAs and to contextualize their roles within ARG-related mechanisms and CRC biology.

miRNA-mRNA duplex analysis

Computational tools for predicting gene-miRNA interactions have become more widely available compared to experimental methods, although only a few of these algorithms have undergone experimental validation. One of the commonly used approaches for identifying potential miRNA-target interactions is by focusing on the seed region sequences of miRNAs to promote base pairing between the miRNA and the target mRNA. The present investigation utilized the RNAhybrid 2.2 tool, which is accessible at the BiBiServ2 website (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid), to examine the binding characteristics between specific miRNAs and their target genes. RNAhybrid is a computational method that is particularly useful for predicting miRNA targets because it is designed to identify the minimum free energy (MFE)-driven annealing of a longer and a shorter RNA strand.

Culturing of CRC cell lines

This project received approval and oversight from the ethics committee at Shahid Beheshti University of Medical Sciences in Tehran, Iran (ethics code: IR.SBMU.RETECH.REC.1402.128).

The SW480 and Caco-2 human colorectal cancer cell lines were obtained from the National Cell Bank of the Pasteur Institute of Iran in Tehran, Iran. These cell lines were completely authenticated with the supplier (National Cell Bank of Iran) and have not been previously reported as misidentified or contaminated. Furthermore, the supplier provided PCR confirmation that the cell lines were free of mycoplasma contamination. SW480 Cells (Also known as SW-480, Research Resource Identifier: CVCL_0544) are derivatives from a 50-year-old male of ethnicity White diagnosed with large intestine CRC. Caco-2 Cells (Originally named CACO2, Research Resource Identifier: CVCL_0025) are also derived from a male primary tumor of CRC.

Both cell lines were cultivated under tightly regulated environmental conditions at 37°C, 5% CO₂, and 95% humidity. The SW480 cell line was cultured in Roswell Park Memorial Institute (RPMI-1640) medium from Gibco, USA, while the Caco-2 cell line was cultured in Dulbecco's Modified Eagle Medium (DMEM) also from Gibco, USA. The nutrient medium for both cell lines was enriched with 10% fetal bovine serum (FBS) from Gibco, USA, and 1% antibiotics comprising penicillin and streptomycin.

Transfection of the candidate miRNA to CRC cell lines

The transfection process involved introducing the pLenti-III-GFP-hsa-miR-124 and pLenti-III-GFP control plasmids into the CRC cells. This was accomplished using the iN-fect™ in-vitro Transfection Reagent (Cat. no: 15081, iNtRON Biotechnology, Inc, Korea) following the supplier's instructions. Initially, 7 × 10⁴ cells were cultured into 24-well plates and allowed to reach 90% cellular confluence under controlled conditions at 37 °C, 5% carbon dioxide, and 95% moisture. Subsequently, the transfection procedure was conducted by introducing 1µg of plasmid DNA to the iN-fect™ working transfection reagent. The mixture was then cultivated for 15 min at ambient temperature. Then, the plasmid/iN-fect™ transfection reagent complex was introduced into each well and subjected to a 48-h incubation period at a temperature of 37 °C.

Isolation of RNA and quantitative real-time PCR (qRT-PCR)

The isolation of total RNA, encompassing miRNAs as well, was performed 48 h following cell treatment utilizing the RNX-Plus™ solution (SinaClon, Iran) as per the instructions provided by the manufacturer. The concentration of RNA was determined using a NanoDrop instrument (Aosheng, China), and afterward, 1 μg of total RNA underwent reverse transcription to produce complementary DNA (cDNA). For gene amplification, random hexamer primers were utilized, while stem-loop primers were employed for miRNA amplification. The reaction mixture was subjected to incubation at 70 °C for 5 min, followed by an additional incubation at 42 °C for 60 min upon the addition of 5X RT-buffer, RT-enzyme (Thermo Fisher, USA), and dNTPs. Subsequently, the reaction was terminated by incubating at 70 °C for 10 min. QRT‑PCR was conducted using a SYBR GreenI–based master mix (Ampliqon, Denmark) on a real‑time PCR detection system (Applied Biosystems, StepOnePlus™). For the evaluation of gene and miRNA expression levels, a 20 μL reaction mixture was prepared with both forward and reverse primers. The primers were designed using the AlleleID 6 software and Primer-BLAST websites (additional information can be found in Table 1). Cycling conditions consisted of an initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 20 s and annealing/extension at 60 °C for 40 s. The expression levels of miRNAs were normalized to SNORD47, while GAPDH was used as the reference gene for normalizing mRNA expression. QRT-PCR was utilized to assess the relative expression levels of both miRNAs and mRNAs in the experimental and control groups. The 2^{^–ΔΔCt} method was utilized for data analysis (Karami et al. 2016). To ensure accuracy, three independent experiments were conducted, each performed in triplicate.

Table 1.

The sequences of primers used in this study

Gene/miRNA name	Forward forward primer	Reverse reverse primer
ANGPT2	GCTCTTGGAACACTCCCTCTC	CACCTTCTTTTCTAGGAAACTGTTC
MMP9	TTCAGGGAGACGCCCATTTC	AACCGAGTTGGAACCACGAC
HIF1A	GTGTACCCTAACTAGCCGAGG	TGTGCAGTGCAATACCTTCCA
VEGFA	GCAGAATCATCACGAAGTGGT	CCAGGGTCTCGATTGGATGG
GAPDH	CCTCAAGATCATCAGCAATG	CATCACGCCACAGTTTCC
hsa-miR-124-3p	CTAAGGCACGAGGTGAA	GAGCAGGGTCCGAGGT
SNORD 47	CGCTTCGGCAGCACATATACTA	GGAACGCTTCACGAATTTGC
RT Stem-loop hsa-miR-124-3p	GGTCGTATGCAGAGCAGGGTCCGAGGTATCCATCGCACGCATCGCACTGCATACGACCGGCA
RT Stem-loop SNORD 47	GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAACGTC

Cell viability assessment

The viability of the cells was determined through the implementation of the MTT assay protocol. In 96-well plates, approximately 5 × 10³ SW480 and Caco-2 cells were seeded per well and cultured in RPMI and DMEM media, respectively, supplemented with 10% FBS. The next day, the cells were switched to a serum-free medium. Simultaneously, the cells were transfected with two lentiviral vectors: pLenti-III-GFP-hsa-miR-124 and the control vector pLenti-III-GFP. To quantify mitochondrial dehydrogenase activity, the cells in each well were exposed to 50 μL of a 0.5 mg/ml MTT solution for 3 h. After the removal of the supernatant, the formazan crystals were dissolved by adding 100 μL of DMSO. Following 10 min of shaking, the optical density (OD) of each well was measured at 570 nm and 620 nm (background) using a microplate reader (Epoch, BioTek Instruments, USA).

Angiogenesis assay using chicken chorioallantoic membrane (CAM)

Fertilized chicken eggs (provided by Morghak company, Mashhad, Iran) were incubated for a duration of 8 days at a temperature of 37°C and a humidity level of 70%. Initially, an artificial airbag was created, followed by the careful carving of a small window into the eggshell. On the ninth day, cells including those transfected with either pLenti-III-GFP-hsa-miR-124 for miR-124 overexpression or pLenti-III-GFP as control, were collected from culture plates, suspended in serum-free media, and applied to the CAM of the developing embryos. After a period of 72 h, angiogenesis images were captured in the peeled area of the CAM, and the number of vascular branches was quantified. All procedures involving the CAM assay were conducted by institutional and national regulations on animal welfare. The experiments were terminated on embryonic day 12, before the development of pain perception in avian embryos. The study adheres to the ARRIVE guidelines for responsible and transparent reporting of animal research (https://arriveguidelines.org/).

Statistical analysis

The data presented in this study are expressed as means ± Standard Deviations (SD) and were obtained from at least three independent experiments. To analyze differences between groups, both the one-way analysis of variance and the Kruskal–Wallis test were employed as non-parametric alternatives. Statistical significance was defined as p-values < 0.05. For assessing overall survival and determining significant differences among multiple comparisons, GraphPad Prism version 8.0.1 (GraphPad, La Jolla, CA) was utilized. ANOVA followed by Tukey or Bonferroni post-hoc testing was conducted to evaluate the significance of differences.

Results

Study design

Our study sought to gain significant insights into the potential modulation of angiogenesis in CRC through the integration of in-silico analysis and in-vitro experiments. By employing these complementary approaches, we aimed to unravel the role of specific miRNAs in influencing the angiogenesis process in CRC. The utilization of in-silico analysis allowed us to computationally analyze vast datasets, enabling the identification of promising miRNA candidates for further investigation. Subsequently, through in-vitro experiments conducted on CRC cell cultures, we scrutinized the effects of one of these miRNAs on angiogenesis-related phenomena. To provide a clear and comprehensive understanding of our research methodology, we diagrammatically summarized the employed techniques and experimental workflow in Fig. 1.

Fig. 1.

Overview of the integrated experimental workflow. This figure summarizes the multi‑step approach used to investigate the role of miR‑124‑3p in CRC angiogenesis. The workflow combines in-silico bioinformatic analyses, in-vitro functional assays, and the CAM assay to predict, validate, and assess miRNA–gene interactions. Bioinformatic tools were used to identify candidate targets and pathways; cell‑based experiments evaluated miR‑124‑3p expression and functional effects; and the CAM assay provided a semi‑in-vivo platform to examine its impact on angiogenesis

Identification and prioritization of ARGs

In our study, we utilized the GeneCards website and conducted a keyword search for angiogenesis. Through this search, we identified 184 genes (Supplementary Table 1) that had a score of 5 or above and were also found in the MSigDB and DGIdb databases. In this study, the GSE74602 dataset was used to evaluate the expression profile of selected genes in CRC. Gene expression analysis was performed using the Illumina human Ref-8 v2.0 expression beadchip (platform GPL6104) on the GSE74602 dataset, which was produced by the Genome Institute of Singapore. This platform makes it possible to simultaneously evaluate many genes' levels of expression. The GSE74602 dataset focuses mainly on CRC and includes 30 pairs of samples. Each pair contains a normal tissue sample and a colorectal tumor sample. A total of 20 genes have been identified as being associated with angiogenesis in CRC (Fig. 2). This implies that these genes play a role in the formation of new blood vessels within CRC tumors, which is a key process in tumor growth and progression (Table 2). In our analysis using the STRING database, we discovered that the dataset of 20 selected genes exhibited a total of 117 edges, representing the protein–protein interactions (PPIs) among these genes. The number of edges signifies the connections or interactions between the proteins encoded by these genes (Fig. 3A). The substantial number of edges suggests a complex network of interactions between the proteins associated with the selected genes. These interactions may involve various molecular mechanisms, such as physical binding, signaling pathways, or functional collaborations, which collectively contribute to the regulation of critical cellular processes.

Fig. 2.

The volcano plot was utilized to visualize the expression levels of angiogenesis genes, employing the following cut-off criteria: genes with a log2 fold change ([log2FC]) greater than 0 and a significance threshold of Adj. p-value less than 0.05. A Significantly upregulated genes are shown in blue, significantly downregulated genes in red, and non-significant genes in grey. B Highlights the expression changes of angiogenesis genes according to these significance criteria, with 20 genes shared across the GSE74602, GeneCards, DGIdb, and MSigDB datasets specifically emphasized

Table 2.

The list comprises essential ARGs, chosen based on their elevated scores in the GeneCards database and their previously established effectiveness in clinical trials

Genes	Full names	DisGeNet
		DSI g	GDA score
VEGFA	Vascular Endothelial Growth Factor A	0.266	0.1
PTGS2	Prostaglandin-endoperoxide synthase 2	0.314	0.4
HIF1A	Hypoxia-inducible factor 1 subunit alpha	0.327	0.1
PLAU	Plasminogen activator urokinase	0.425	0.1
IL6	Interleukin 6	0.248	0.1
RAC1	Rac family small GTPase 1	0.429	0.1
ANGPT2	Angiopoietin 2	0.41	0.08
MET	MET proto-oncogene, receptor tyrosine kinase	0.38	0.1
PGF	Placental growth factor	0.46	0.05
PTK2	Protein tyrosine kinase 2	0.497	0.06
CXCL10	C-X-C motif chemokine ligand 10	0.378	0.07
CXCL8	C-X-C motif chemokine ligand 8	0.31	0.4
SOD2	Superoxide dismutase 2	0.379	0.37
SPP1	Secreted phosphoprotein 1	0.353	0.1
MMP9	Matrix metallopeptidase 9	0.305	0.1
MMP1	Matrix metallopeptidase 1	0.385	0.4
NOTCH1	Notch receptor 1	0.369	0.1
MMP3	Matrix metallopeptidase 3	0.408	0.1
F3	Coagulation factor III, tissue factor	0.415	0.1
COL4A1	Collagen alpha-1(IV)	–	–

Fig. 3.

Integrated network analysis of protein–protein and miRNA–gene interactions in CRC. A Construction of the PPI network for genes associated with angiogenesis and tumor progression was carried out using a minimum interaction score threshold of 0.400 (medium confidence) in the STRING database. Nodes represent proteins encoded by the selected genes, and edges indicate predicted functional associations between proteins based on known and computational evidence. B The network illustrates the interactions between angiogenesis-associated genes and miRNAs in CRC. It visualizes how individual genes and miRNAs are interconnected, with genes shown as pink circles and miRNAs as blue squares. Node size corresponds to Degree centrality, meaning larger nodes have a greater number of connections within the network. The visualization was produced using the miRNet 2.0 platform’s integrated analysis interface

Exploring the interplay between miRNAs and genes

This investigation used the miRNet database to explore the complex relationship between miRNAs and genes. The findings highlighted several miRNAs with strong evidence of their role in the process of angiogenesis. Notably, miR-124-3p, miR-16-5p, miR-1-3p, and miR-101-3p showed the highest levels of interaction with genes related to angiogenesis (Fig. 3B and Table 3). Importantly, expression profiling (Table 3) revealed that miR-124-3p is downregulated in CRC, suggesting a potential tumor-suppressive activity. Selecting a downregulated miRNA for overexpression experiments provides an opportunity to restore its diminished regulatory function, offering therapeutic relevance in the context of CRC. Based on both its network centrality and disease-associated suppression, miR-124-3p was prioritized for subsequent functional analyses.

Table 3.

The top ten miRNAs discovered by miRNet databases to be involved in the angiogenesis process in CRC. The number of direct interactions or connections that a node has with other nodes in the network is determined by its “Degree”. The number of times a node falls on the shortest path between two other nodes in the network was shown with “Betweenness”. The expression profiles of each miRNA are depicted, showcasing their levels of expression in CRC

miRNA	Degree	Betweenness	Expression Profile
hsa-miR-124-3p	16	7414.315	Downregulated
hsa-miR-16-5p	15	7504.84	Downregulated
hsa-miR-1-3p	14	5772.0815	Downregulated
hsa-miR-101-3p	13	4690.77	Downregulated
hsa-miR-146a-5p	13	5606.55	-
hsa-miR-20a-5p	12	4756.557	Upregulated
hsa-miR-34a-5p	12	2671.047	Downregulated
hsa-miR-23b-3p	12	5863.154	-
hsa-miR-138-5p	12	2856.52	Downregulated
hsa-miR-107	11	3438.858	-

Pan-cancer expression patterns of miR-124-3p

Analysis of miRCancer data showed that miR‑124‑3p is predominantly downregulated across multiple human cancers, including astrocytoma, bladder, breast, cervical, esophageal, gastric, glioma, and hepatocellular carcinoma. Reported functional studies consistently link this reduction to enhanced proliferation, migration, invasion, and reduced apoptosis, supporting a broad tumor‑suppressive role. Notably, papillary thyroid carcinoma was the only cancer type in which miR‑124‑3p was reported as upregulated, suggesting a context‑specific regulatory pattern. Overall, miRCancer evidence highlights miR‑124‑3p as a widely suppressed miRNA with strong relevance to tumor progression (Table 4).

Table 4.

Expression and functional roles of hsa-miR-124-3p across human cancers. Reported expression patterns and biological effects of hsa-miR-124-3p in various cancer types based on published studies. miR-124-3p is predominantly downregulated and exhibits tumor-suppressive functions, including inhibition of proliferation, migration, invasion, and promotion of apoptosis. Upregulation in papillary thyroid carcinoma suggests context-specific regulatory roles

Cancer type	Expression	Reported functional role
Astrocytoma	Downregulated	Reduced expression of miR-124-3p
Bladder cancer	Downregulated	Inhibits migration, suppresses proliferation, and invasion
Breast cancer	Downregulated	Dual-targeting, tumor suppressor function, decreased expression
Cervical cancer	Downregulated	Inhibits cell growth
Esophageal cancer	Downregulated	Implicated in DNMT1/miR-124-3p axis
Gastric Cancer	Downregulated	Clinically significant; potential biomarker
Glioma	Downregulated	Represses proliferation, suppresses aggressiveness, and induces apoptosis
Hepatocellular carcinoma	Downregulated	Associated with tumor suppression and progression
Papillary thyroid carcinoma	Upregulated	Circulating biomarker potential

Integration of robust datasets and identification of crucial genes and miRNA

To further investigate the intricate relationship between specific genes and the miRNAs under consideration, our study employed robust datasets, including GSE10950 and GSE74604, along with the Drugbank database, to enhance the reliability and credibility of our findings. Our analysis revealed that 4 out of the 20 genes, including ANGPT2, HIF1A, MMP9, and VEGFA, were not only found to be overexpressed in the CRC-related GEO datasets (GSE74604 and GSE10950) but were also identified as drug targets in the DrugBank database. These four genes are overexpressed in CRC, and to know their pharmacological targets, which suggests that they may be important players in the disease process and possible therapeutic targets. Accordingly, ANGPT2, HIF1A, MMP9, and VEGFA were selected for further in-depth investigation.

In this investigation, we identified miR-124-3p as the most potent miRNA affecting angiogenesis in CRC. Subsequently, we proceeded to analyze the impact of miR-124-3p overexpression on the expression pattern of the selected genes and its influence on the angiogenesis process in CRC.

Investigating miR-124's involvement in key angiogenesis pathways

The results derived from the analysis conducted using miRPathDB showcased the top five angiogenesis pathways in which miR-124-3p exhibits substantial regulatory involvement. These pathways include angiogenesis, blood vessel morphogenesis, blood vessel development, tube morphogenesis, and vasculature development (Table 5). The comprehensive analysis conducted through miRPathDB provided valuable insights into the specific pathways and biological processes through which miR-124-3p exerts its influence on angiogenesis.

Table 5.

The top five angiogenesis routes, in which miR-124-3p has a significant regulatory role, retrieved from miRPathDB

Angiogenesis-related process	p-value	Number of targets
Angiogenesis	3.78e−10	87
Blood vessel morphogenesis	3.78e−10	98
Blood vessel development	4.44e−10	107
Tube morphogenesis	4.44e−10	126
Vasculature development	4.88e−10	110

Hybridization between miR-124-3p and the selected genes

By utilizing the RNAhybrid database, we were able to determine the MFE linked to the hybridization of miR-124-3p with the chosen genes. There were -32.7 kcal/mol, -23.1 kcal/mol, -26.1 kcal/mol, and -28 kcal/mol values for the miR-124-3p connections to ANGPT2, HIF1A, MMP9, and VEGFA, respectively (Fig. 4).

Fig. 4.

Prediction of miR‑124‑3p binding interactions with ARGs using RNAhybrid. This figure presents computational models of miR‑124‑3p hybridization with the 3′ untranslated regions (3′UTRs) of four angiogenesis‑associated genes: A ANGPT2, B HIF1A, C MMP9, and D VEGFA. Each panel displays the predicted miRNA–mRNA duplex structure, including seed‑region complementarity, MFE values, and the precise nucleotide positions of the binding sites. Lower MFE values indicate more thermodynamically favorable interactions. These predicted pairings suggest potential post‑transcriptional regulatory effects of miR‑124‑3p on angiogenesis pathways. ANGPT2—angiopoietin-2; HIF1A—hypoxia-inducible factor 1-alpha; MMP9—matrix metalloproteinase 9; VEGFA—vascular endothelial growth factor A; 3′UTR—3 prime untranslated region

miR-124 overexpression reduced cell viability and ARGs expression

The MTT method was used to investigate the impact of miR-124 overexpression on the viability of SW480 and Caco-2 cells. Compared to untreated cells, pLenti-III-GFP (empty vector group) treatment had no significant effect on CRC cell viability after 24 and 48 h (p-value > 0.05). CRC cells treated with pLenti-III-GFP-hsa-miR-124 showed similar findings (p-value > 0.05) after 24 and 48 h, but after 72 h, the percentage of viable cells in pLenti-III-GFP-hsa-miR-124 treated group was considerably lower than other groups (Fig. 5 A, B). To investigate the findings obtained through in-silico analysis, both SW480 and Caco-2 cells were subjected to transfection with pLenti-III-GFP-hsa-miR-124 and pLenti-III-GFP. miR-124 overexpression was approved in both cell lines compared to the controls (about 10 folds, p-value < 0.0001, Fig. 5C). Furthermore, the cells transfected with the vectors exhibited a significantly higher proportion of GFP expression compared to the untransfected cells. This confirms the successful overexpression of miR-124-3p in both SW480 and Caco-2 cells.

Fig. 5.

Evaluation of miR-124 expression and its impact on cell viability in CRC cell lines. Cell viability of SW480 (A) and Caco-2 cells (B) was assessed up to 72 h of transfection using an MTT assay. Ectopic overexpression of miR-124 significantly reduced cell viability 72 h' post-transfection in both cell lines compared to the control. Data represent mean ± standard deviation (SD) from three independent biological replicates. C QRT-PCR was performed to measure miR-124 expression levels in SW480 and Caco-2 cells following transfection with either pLenti-III-GFP-hsa-miR-124 (miR-124 overexpression group) or pLenti-III-GFP (vector control group). Statistical analysis was performed using one-way ANOVA followed by Tukey’s multiple comparison test (ns—not significant; ****p < 0.0001)

The analysis presented in Fig. 6 demonstrates a significant reduction in gene expression within CRC cells after transfection with the pLenti-III-GFP-hsa-miR-124 vector. Notably, genes such as ANGPT2, HIF1A, MMP9, and VEGFA exhibited noticeably diminished expression levels compared to both the cells transfected with pLenti-III-GFP and the untransfected cells.

Fig. 6.

Quantification of angiogenesis-related gene expression in transfected CRC cells 48 h after transfection. Relative mRNA expression levels of A ANGPT2, B HIF1A, C MMP9, and D VEGFA in untreated cells, cells transfected with control vector pLenti-III-GFP, and cells transfected with pLenti-III-GFP-hsa-miR-124. Data represent the mean ± standard deviation of three independent biological replicates. Statistical analysis was conducted using one-way ANOVA followed by Tukey's multiple comparison test (*p ≤ 0.05; **p < 0.01; ***p < 0.001; ns—not significant)

These results highlight the effectiveness of the pLenti-III-GFP-hsa-miR-124 vector in successfully downregulating the expression of specific genes in CRC cells. It suggests that miR-124, when delivered through the pLenti-III-GFP vector, possesses the capability to modulate the expression of crucial genes involved in CRC, including ANGPT2, HIF1A, MMP9, and VEGFA.

Angiogenesis in the CAM decreased via miR-124 expression

To investigate the impact of miR-124 overexpression on CRC angiogenesis, we utilized the CAM model as a semi‑in-vivo evaluation method. CRC cells transfected with pLenti‑III‑GFP‑hsa‑miR‑124 were compared with the untreated and vector control groups. As shown in Fig. 7, the experimental group exhibited fewer vessel branching points, based on image-based quantification using ImageJ. Data are presented as mean ± SD, and statistical analysis was performed using one‑way ANOVA, with p-value less than 0.05 as significant. These results suggest that miR‑124‑3p may influence angiogenic activity in the CAM model of CRC.

Fig. 7.

Effect of miR‑124‑3p overexpression on angiogenic activity in the CAM model of CRC. Representative CAM images (left) and the corresponding quantification of vessel number branching points (right) are shown for CRC cells transfected with pLenti‑III‑GFP‑hsa‑miR‑124, pLenti‑III‑GFP, or untreated group. ImageJ‑based analysis was used to compare branching patterns across groups, with data expressed as mean ± SD. Statistical evaluation was performed using one‑way ANOVA, and the resulting p-values are indicated in the graph. Cells transfected with pLenti‑III‑GFP‑hsa‑miR‑124 exhibited fewer vessel‑branching points compared with controls (*p < 0.05)

Discussion

Angiogenesis is a critical process in the progression of CRC, and miRNAs have emerged as potential regulators of this process (Tang et al. 2021). Identifying and characterizing specific miRNAs involved in angiogenesis in CRC could lead to the development of innovative therapeutic approaches that target this pathway. By better understanding the intricate interplay between miRNAs and angiogenesis, researchers aim to improve patient outcomes and reduce the global burden of CRC (Zhang et al. 2021).

In our study, we employed several resources, including GeneCards, GEO datasets, and DGIdb, to obtain ARGs that are known to be overexpressed in CRC. These resources are valuable tools in genomic research and provide access to extensive databases and information on genes and their associations with various diseases, including CRC (Shao et al. 2021; Firouzjaei et al. 2023a, b; Wu et al. 2023). By incorporating these resources into our study, we aimed to gather comprehensive information on ARGs that are overexpressed in CRC. This information is essential for figuring out possible treatment targets and comprehending the molecular underpinnings of angiogenesis in CRC. By elucidating the roles of these genes and their interactions with miRNAs, we can gain insights into the complex regulatory networks involved in angiogenesis in CRC and potentially develop more effective treatment strategies for this disease.

Identifying overexpressed ARGs in CRC improves our grasp of the molecular mechanisms involved in angiogenesis and its relationship to tumor progression and metastasis. These genes may represent potential biomarker candidates for CRC; however, their diagnostic and prognostic value requires validation in larger clinical cohorts. Some of these genes are crucial in angiogenic pathways and tumor growth, making them potential candidates for targeted therapeutic investigation that could reduce tumor growth and improve outcomes. Analyzing the expression of ARGs allows for personalized treatment approaches, leading to more effective therapies with fewer side effects. Insights into these genes can guide the development of combination therapies that target multiple pathways, potentially enhancing treatment effectiveness and overcoming resistance. It is important to note that further research and validation are necessary to confirm the functional significance and therapeutic potential of these ARGs in CRC. However, the identification of these genes provides a foundation for future investigations and shows potential for the creation of cutting-edge therapeutic approaches for the treatment of CRC.

The identification of ANGPT2, HIF1A, MMP9, and VEGFA as key ARGs that are upregulated in CRC and have drug-targeting capacity is significant. These genes play crucial roles in angiogenesis and tumor progression, making them attractive targets for therapeutic interventions (Li et al. 2020).

Among these, ANGPT2, a growth factor and component of the angiopoietin/Tie signaling pathway, stands out for its pivotal role in angiogenesis (Akwii et al. 2019). Extensive research has highlighted ANGPT2's importance in cancer, suggesting its potential as a biomarker in various malignancies (Baganha et al. 2021). The promising results observed from ANGPT2 blockade in xenograft models have led to clinical trials exploring its targeting, both as a standalone therapy and in combination with other pathway inhibitors, including those targeting VEGFR (Gerald et al. 2013; Papadopoulos et al. 2016). Furthermore, research has demonstrated that ANGPT2 and VEGF synergistically stimulate angiogenesis in several cancer types, including colorectal and hepatocellular cancers.

In addition to ANGPT2, HIF1A plays a central role in mediating responses to low oxygen levels (hypoxia), activating the expression of angiogenic genes, including VEGFA. In CRC, HIF1A promotes oncogenesis through various mechanisms, particularly by facilitating tumor angiogenesis, which is essential for cancer progression. Overexpression of HIF1A has been observed in CRC and is associated with increased angiogenesis and poor prognosis (Fan et al. 2008; Simiantonaki et al. 2008). Its importance as a therapeutic target is highlighted by the association between its overexpression and enhanced angiogenesis and a poor prognosis. The relationship between HIF1A and angiogenesis highlights the complex regulatory environment in CRC, as research consistently demonstrates the activation of the HIF-1α/VEGF pathway in tumor tissues (Giatromanolaki et al. 2007; Kwon et al. 2010; Kuo et al. 2013).

Similarly, MMP9 has emerged as another overexpressed gene critical to angiogenesis and a potential drug target in CRC. As a matrix metalloproteinase, MMP9 is involved in extracellular matrix turnover and promotes angiogenesis by facilitating endothelial cell migration (Buttacavoli et al. 2021; Liu et al. 2022). Its role in tumor invasion and immune escape suggests that targeting MMP9 could disrupt its pro-angiogenic effects, thereby limiting the nutrients and oxygen supply necessary for tumor growth and metastasis (Kim and Ma 2018; Buttacavoli et al. 2021).

Additionally, VEGFA is a key pro-angiogenic factor that promotes the growth and proliferation of blood vessels (Wang et al. 2023). It is upregulated in CRC and contributes to tumor angiogenesis by increasing blood vessel development (Shi et al. 2023). VEGFA has been extensively studied as a therapeutic target in CRC, and several anti-VEGF therapies, such as bevacizumab, have been developed and approved for clinical use (Chionh et al. 2022). These therapies aim to block VEGFA signaling and inhibit angiogenesis, thereby reducing tumor growth and improving patient outcomes.

In this study, we used MFE calculations to estimate the thermodynamic stability of hybridization between miR‑124‑3p and its predicted target genes. MFE provides a quantitative measure of the energy required to dissociate two nucleic acid strands, with lower values indicating more stable and energetically favorable interactions. Such stability is important for applications including gene expression analysis, RNA interference, and probe design, where specific and efficient binding is essential. Computational tools evaluate MFE by considering base‑pairing patterns, loop structures, and other thermodynamic parameters, allowing prediction of the most likely miRNA–mRNA duplexes. However, MFE represents only a computational approximation of binding affinity, and predicted interactions must be experimentally validated, ideally through assays such as luciferase reporter analysis, which directly confirms miRNA binding to the 3′UTR of target genes. Integrating MFE‑based predictions with 3′UTR‑focused validation strategies provides a more comprehensive and biologically meaningful assessment of miRNA–target interactions.

Although the MTT assay demonstrated a decrease in cell viability after 72 h of miR‑124‑3p overexpression, the underlying mechanism responsible for this reduction remains unclear. The observed effect could reflect direct inhibition of cell proliferation, induction of apoptosis, or an indirect consequence of altered expression of ARGs. Since apoptosis detection or cell‑cycle profiling were not in the design of this study, we cannot distinguish among these possibilities. Future experiments incorporating Annexin V/PI flow cytometry or cell‑cycle analysis would help clarify whether miR‑124‑3p reduces viability through apoptotic pathways, cell‑cycle arrest, or other regulatory mechanisms. This limitation should be considered when interpreting the functional specificity of miR‑124‑3p.

The impact of selected miRNAs on the angiogenesis process in CRC was evaluated using the CAM assay, a widely used model of semi-in-vivo assessing angiogenesis (Ma et al. 2020). Our findings suggest that hsa-miR-124-3p may influence the development of blood vessels in the CAM.

Given that resistance to anti‑VEGF therapies remains a major clinical challenge in cancer (Haibe et al. 2020), the identification of miR‑124‑3p as a regulator of key angiogenic mediators such as VEGFA, ANGPT2, and HIF1A highlights its potential translational value. Aberrant activation of these pathways is frequently implicated in both intrinsic and acquired resistance to anti‑angiogenic agents. Thus, targeting miR‑124‑3p or its downstream signaling network may represent a potential complementary strategy for overcoming resistance mechanisms; however, this possibility requires experimental and clinical validation.

Overall, this study provides an exploratory assessment of angiogenesis in CRC, highlighting the regulatory potential of miRNAs. Using bioinformatic screening and functional assays, we identified key ARGs (ANGPT2, HIF1A, MMP9, and VEGFA) and examined their interactions with selected miRNAs through MFE analysis. CAM assay findings further suggest that miR‑124‑3p may modulate angiogenic pathways in CRC. However, the underlying mechanism remains unresolved; the observed effects could reflect changes in proliferation, apoptosis, or indirect regulation through downstream ARGs. As such, additional mechanistic studies, including protein-level validation, direct 3′UTR binding assays, and assays assessing apoptosis or cell-cycle status, will be necessary to clarify the specific pathways through which miR-124-3p influences angiogenesis-related gene networks in CRC.

Limitations

Confirming the downstream targets and signaling pathways by which miR-124-3p regulates angiogenesis in Colorectal Cancer (CRC) requires further investigation. Although preliminary evidence supports miR-124-3p’s regulatory role, significant limitations exist. Our validation focused on a single miRNA and a small fraction of predicted targets, likely underrepresenting the broader transcript interactions within CRC’s complex regulatory networks. Another limitation relates to the dependence on publicly available datasets and bioinformatic prediction tools, which may introduce selection bias and variability arising from differences in sample processing, experimental platforms, and analytical pipelines.

The functional impact of miR-124-3p in the full tumor microenvironment, including interactions with stromal and immune cells, ECM dynamics, and hypoxic gradients, was not assessed in vitro. Moreover, our conclusions, drawn from a limited cell line panel, may not reflect the full heterogeneity of patient tumors; validation with diverse subtypes and patient-derived models is needed for broader generalizability. In addition, our analyses primarily relied on transcript-level data and computational predictions. Corresponding protein expression levels of candidate genes were not evaluated, despite the possibility that post-transcriptional regulation may alter mRNA–protein relationships.

Although the CAM assay is a useful model for evaluating angiogenesis, it does not entirely reflect the complex biological environment of human colorectal cancer, especially the interactions among tumor, stromal, and immune cells. Future studies must employ complementary in-vivo models (e.g., xenografts, GEMMs) and multi-omics approaches to definitively establish the biological relevance and therapeutic potential of miR-124-3p’s angiogenic regulation. Methodological considerations, such as empty vector controls and potential cell viability effects on gene expression, also warrant further clarification.

Conclusion

This study explored the possible role of miR-124-3p in angiogenesis-related pathways in colorectal cancer by integrating bioinformatic analyses with functional experiments. Our results indicate that miR-124-3p may contribute to the regulation of several angiogenesis-associated genes, including ANGPT2, HIF1A, MMP9, and VEGFA. Nevertheless, the precise mechanisms underlying these interactions have not yet been fully clarified, and the direct regulatory relationships require further confirmation. Therefore, additional studies involving protein-level analyses, target-binding validation assays, patient-derived models, and in vivo experiments are needed to better define the biological and potential clinical relevance of miR-124-3p in CRC.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contribution

Ali Ahmadizad Firouzjaei: Conceptualization, investigation, formal analysis, methodology, resources, writing—original draft, writing—review, and editing. Kazem Sharifi: Methodology and writing—review and editing. Samira Mohammadi-Yeganeh and Seyed Hamid Aghaee-Bakhtiari: Conceptualization, formal analysis, funding acquisition, methodology, writing—original draft, and writing—review and editing.

Funding

This research was funded by Shahid Beheshti University of Medical Sciences in Tehran, Iran (grant number 43005434).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval

This project was approved and supervised under the supervision of the ethics committee of Shahid Beheshti University of Medical Sciences in Tehran, Iran (ethics code: IR.SBMU.RETECH.REC.1402.128) and carried out following the guidelines of the National ethics committee.

Consent for publication

This manuscript/data, or parts thereof, has not been submitted for possible publication to another journal and the work has previously been published elsewhere.