Skip to main content
NCBI home page
Veterinary and Animal Science logoLink to Veterinary and Animal Science
. 2026 Sep 22;34:100876. doi: 10.1016/j.vas.2026.100876

Modulatory effects of interferon-γ and interleukin-13 on tumor necrosis factor-α-induced chemokine gene expression in canine keratinocytes

Takehiro Hasegawa a,b, Yuzuki Kaida c, Kaho Takahashi a, Rina Yoshimatsu c, Miori Ando c, Keitaro Ohmori a,d,e,⁎
PMCID: PMC13639160  PMID: 42840476

Abstract

Keratinocytes play a crucial role in the pathogenesis of canine atopic dermatitis (cAD). Tumor necrosis factor (TNF)-α, a proinflammatory cytokine, is highly expressed in the lesional skin of dogs with atopic dermatitis. Additionally, interferon (IFN)-γ, a T-helper (Th)1-type cytokine, and interleukin (IL)-13, a Th2-type cytokine, are also detected in the lesional skin during the acute and/or chronic phases of cAD. However, their effects on chemokine expression in canine keratinocytes remain unclear. This study investigated the effects of TNF-α on chemokine mRNA expression in canine keratinocytes and how IFN-γ or IL-13 modulates these responses. Canine progenitor epidermal keratinocyte (CPEK) cells were stimulated with TNF-α alone or in combination with IFN-γ or IL-13. Chemokine mRNA expression was analyzed by real-time PCR. TNF-α induced the mRNA expression of chemokines, including CCL2, CCL5, CCL17, CCL20, CCL22, CCL27, CCL28, and CXCL8. Co-stimulation with IFN-γ enhanced TNF-α-induced CCL5 and CXCL8 mRNA expression, but reduced TNF-α-induced CCL17, CCL20, CCL27, and CCL28 mRNA expression. IL-13 augmented TNF-α-induced CCL17 mRNA expression, while suppressing TNF-α-induced CCL20 and CCL27 mRNA expression. IL-4, another Th2-type cytokine, was also confirmed to have effects similar to those of IL-13. These results indicate that TNF-α induces multiple chemokine genes in canine keratinocytes and that IFN-γ, IL-13, and IL-4 modulate this induction in a chemokine-specific manner, producing both enhancement and suppression. As these findings were obtained exclusively at the mRNA level in a canine keratinocyte cell line, their relevance to the pathogenesis and phases of cAD remains to be determined in vivo.

Keywords: Chemokine, Dog, IFN-γ, IL-13, Keratinocyte, TNF-α

1. Introduction

Canine atopic dermatitis (cAD) is a chronic recurrent cutaneous inflammatory disease characterized by aberrant immune reactions in the skin (Marsella, 2021). In this disease, keratinocytes play a pivotal role not only in regulating skin barrier functions but also in modulating skin immunity by producing a variety of cytokines and chemokines in response to external stimuli, such as allergens and pathogens (Asahina & Maeda, 2017; Nishifuji & Yoon, 2013; Tamamoto-Mochizuki et al., 2024). Keratinocyte-derived chemokines recruit immune cells, including T cells, eosinophils and mast cells, into the skin (Chieosilapatham et al., 2021). These immune cells were shown to be activated in the lesional skin of cAD (Olivry et al., 1997). These findings suggest that keratinocytes may be an initiator or an amplifier of skin inflammation in cAD. Given the function of keratinocytes, they are a key cell for elucidating the pathogenesis of cAD.

Tumor necrosis factor (TNF)-α is a proinflammatory cytokine. The increased expression of TNF-α was detected in the lesional skin of dogs with atopic dermatitis (AD) (Nuttall et al., 2002; Maeda et al., 2002). Previous studies have shown that TNF-α activated canine keratinocytes to produce chemokines, including C-C motif chemokine ligand (CCL)2, CCL5, CCL17, CCL28, and C-X-C motif chemokine ligand (CXCL)8 (Jung et al., 2025; Shibata et al., 2010; Takahashi et al., 2024). In addition, IFN-γ synergistically enhanced TNF-α-mediated CCL2 and CCL5 production in canine keratinocytes (Jung et al., 2025; Takahashi et al., 2024). Considering the function of TNF-α as a proinflammatory cytokine, it may induce other cAD-related chemokines in canine keratinocytes.

Skin immune phenotypes vary across different phases of cAD. During the acute phase, Th2-skewed immunity is dominant in the lesional skin, where Th2-type cytokine genes, such as IL-13 and IL-4, are upregulated (Blubaugh et al., 2024; Olivry et al., 2016). In contrast, during the chronic phase, increased mRNA expression of IFN-γ, a Th1-type cytokine, and IL-13 has been detected in the skin (Schlotter et al., 2011), indicating activation of both Th1- and Th2-type immune responses. However, the precise roles of IFN-γ and IL-13 in the pathogenesis of cAD remain unclear. Specifically, it remains to be elucidated how these cytokines modulate TNF-α-driven keratinocyte responses and whether such modulation differs between the acute and the chronic phase of the disease.

The present study primarily aimed to characterize cytokine-mediated regulation of chemokine gene expression in an in vitro model of canine keratinocytes. Specifically, we investigated the effects of TNF-α on the mRNA expression of chemokines that have been implicated in the pathogenesis of cAD. The eight chemokines—CCL2, CCL5, CCL17, CCL20, CCL22, CCL27, CCL28, and CXCL8—were selected based on their previously reported roles in immune cell recruitment and cAD pathogenesis (Asahina et al., 2020; Maeda et al., 2002, 2005, 2008; Olivry et al., 2016; Pucheu-Haston et al., 2006; Santoro et al., 2022; Sparling et al., 2022). This study also aimed to determine how IFN-γ, used to model a Th1-dominant inflammatory environment, or IL-13, used to model a Th2-dominant inflammatory environment, modulates TNF-α-induced chemokine gene expression. In addition, IL-4, another Th2-type cytokine, was examined to confirm whether its effects on chemokine expression were similar to those of IL-13.

2. Materials and methods

2.1. Cell culture

CPEK cells (CELLnTEC Advanced Cell Systems; Bern, Switzerland) were cultured in CnT-09 medium (CELLnTEC Advanced Cell Systems) as previously described (Takahashi et al., 2024, 2025). Totals of 5 × 104 cells were seeded in each well of a 12-well plate. After 48 h incubation, CPEK cells reached confluence. Confluent CPEK cells were cultured in Opti-MEM I reduced serum medium (Thermo Fisher Scientific; Waltham, MA, USA) without serum supplementation for 24 h and then stimulated with 10 ng/mL recombinant canine TNF-α (R&D Systems; Minneapolis, MN, USA) in Opti-MEM I medium for 6, 12, or 24 h at 37 °C. Phosphate-buffered saline (PBS) was used as a negative control at each time point.

To examine the modulatory effects of Th1- and Th2-type cytokines on TNF-α-induced chemokine gene expression, CPEK cells were incubated in Opti-MEM I medium with PBS, 10 ng/mL TNF-α, 10 ng/mL recombinant canine IFN-γ (R&D Systems), 50 ng/mL recombinant canine IL-13 (R&D Systems), or 10 ng/mL recombinant canine IL-4 (R&D Systems), either alone or in combination with TNF-α, for 6 h for CCL22 gene and 24 h for other chemokine genes at 37 °C. A 6 h incubation time for CCL22 was chosen because a 24 h incubation resulted in high variability of the gene expression in TNF-α-treated CPEK cells (Fig. 1e). Opti-MEM I medium was used without serum supplementation throughout the pre-incubation and cytokine-stimulation periods.

Fig. 1.

Fig. 1

Open in a new tab

Effects of tumor necrosis factor (TNF)-α on chemokine gene expression in canine progenitor epidermal keratinocyte (CPEK) cells. CPEK cells were incubated with phosphate-buffered saline (white bars) or 10 ng/mL TNF-α (gray bars) for 6, 12, and 24 h. The relative mRNA expression levels of CCL2 (a), CCL5 (b), CCL17 (c), CCL20 (d), CCL22 (e), CCL27 (f), CCL28 (g), and CXCL8 (h) were quantified by real-time PCR. Data represent the mean ± standard deviation from five independent experiments. Data between the two groups at each time point were analyzed using the Mann–Whitney U test. To compare mRNA expression levels across the three time points (6, 12, and 24 h) within the TNF-α-treated group, the Kruskal–Wallis test was performed, followed by the Steel-Dwass test. Significance: *P < 0.05, **P < 0.01.

All cytokines used in this study were diluted in PBS. The concentrations of all cytokines were determined based on our previous study (Takahashi et al., 2024, 2025). After cytokine stimulation, CPEK cells were immediately preserved in RNAlater solution (Thermo Fisher Scientific) until RNA extraction. All experiments were repeated five times.

2.2. Real-time PCR

Total RNA extraction, cDNA synthesis, and real-time PCR analysis were performed as described previously (Takahashi et al., 2020). Primers for real-time PCR, except for those targeting CCL5 (Table 1), were designed based on previously published reports (Chimura et al., 2011; Maeda et al., 2013, 2014). Primers for CCL5 were designed by the Perfect Real Time Support System (Takara Bio, Shiga, Japan). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and TATA-binding protein (TBP) were used (Table 1) as reference genes according to our previous report (Takahashi et al., 2025). The relative mRNA expression of each chemokine was calculated by the 2-ΔΔCT method (Takahashi et al., 2020). Each sample was analyzed in technical duplicate, and the mean CT value of the duplicates was used for the calculation. Each value was presented as an n-fold change in mRNA expression relative to the control group.

Table 1.

Sequences of primers used for real-time PCR.

Gene Primer Sequence (5′-3′) GenBank accession number Size (bp)
CCL2 Forward CACCTGCTGCTATACACTCACC NM_001003297.1 100
Reverse GATCACAGCTTCTTTGGGACA
CCL5 Forward TCACCCACGTCCAGGAGTATTTC NM_001003010.2 125
Reverse GATGTACTCCCGCACCCATTTC
CCL17 Forward GGCTGACAAGGTGGTACAAGACTTC NM_001003051.1 82
Reverse CAGATGGACTTGCCTTGGACAG
CCL20 Forward ATCATGGGCTTCACACAACA NM_001005254 118
Reverse TCCGTTTCACCCATTTCTTC
CCL22 Forward TATGGTGCCAACGTGGAAGA DD171279.1 147
Reverse GATCTCCCGATCCTTGACAGTTAG
CCL27 Forward AGCCACTCTCGAACAAGCTACTGA NM_001003968.1 108
Reverse CACTGCGTCGAGACAGGTGAA
CCL28 Forward CAGACAGGACTCACTCTCGCTCTC NM_001005257.1 128
Reverse TGTGAAACCTCAGTGCAACAGCTA
CXCL8 Forward CTTCCAAGCTGGCTGTTGCTC NM_001003200.1 173
Reverse TGGGCCACTGTCAATCACTCTC
GAPDH Forward CATTGCCCTCAATGACCACT NM_001003142 105
Reverse TCCTTGGAGGCCATGTAGAC
TBP Forward CTATTTCTTGGTGTGCATGAGG XM_849432.4 96
Reverse CCTCGGCATTCAGTCTTTTC
Open in a new tab

2.3. Cell viability assay

CPEK cells were incubated in Opti-MEM I medium with PBS, 10 ng/mL TNF-α, 10 ng/mL IFN-γ, 50 ng/mL IL-13, or 10 ng/mL IL-4, either alone or in combination with TNF-α, for 24 h at 37 °C. Cell viability was determined by the trypan blue exclusion test. All experiments were repeated five times.

2.4. Statistical analysis

The normality of the data was assessed using the Shapiro–Wilk test. Differences in chemokine mRNA expression between PBS-treated and TNF-α-treated groups at each time point were compared using the Mann–Whitney U test. To compare chemokine mRNA expression levels across the three time points (6, 12, and 24 h) within the TNF-α-treated group, the Kruskal–Wallis test was performed, followed by the Steel-Dwass test. To compare the effects of IFN-γ, IL-13, or IL-4 on TNF-α-induced chemokine mRNA expression among the four or six treatment groups, data were analyzed using the Kruskal–Wallis test, followed by the Steel test with the TNF-α-treated group as the control. Differences in cell viability among the eight treatment groups were compared using the Kruskal–Wallis test. Statistical analyses were conducted using BellCurve for Excel v4.09 (Social Survey Research Information, Shinjuku, Tokyo, Japan). P < 0.05 was considered statistically significant.

3. Results

3.1. Effects of TNF-α on chemokine mRNA expression in canine keratinocytes

TNF-α significantly upregulated the mRNA expression levels of CCL2, CCL5, CCL17, CCL20, CCL22, CCL27, CCL28, and CXCL8 in CPEK cells compared to PBS-treated control groups at 6, 12, or 24 h (P < 0.01, respectively; Fig. 1a–h). Among the chemokines analyzed, TNF-α induced the highest upregulation of CCL20 mRNA expression (Fig. 1d), whereas the lowest induction was observed for CCL27 mRNA expression (Fig. 1f). Additionally, the peak expression time varied among the chemokine genes. CCL2 mRNA expression was highest at 6 h (P < 0.01), with significantly higher expression at 6 h and 12 h than at 24 h (P < 0.05, respectively) (Fig. 1a). The highest expression of CCL20 mRNA was observed at 6 h, although the difference did not reach statistical significance (P > 0.05) (Fig. 1d). CCL27 mRNA expression was highest at 6 h (P < 0.05), with significantly higher expression at 6 h than at 24 h (P < 0.05) (Fig. 1f). The highest expression of CCL28 mRNA was numerically observed at 12 h (P < 0.01); the difference between 6 h and 12 h was not statistically significant (P > 0.05), whereas both 6 h (P < 0.05) and 12 h (P < 0.05) were significantly higher than 24 h (Fig. 1g). The highest expression of CXCL8 mRNA was observed at 12 h, although the difference did not reach statistical significance (P > 0.05) (Fig. 1h). The highest CCL5 mRNA expression was observed at 24 h, although the difference did not reach statistical significance (P > 0.05) (Fig. 1b). CCL17 mRNA expression was significantly higher at 24 h than at 6 h (P < 0.05) and 12 h (P < 0.05) (Fig. 1c). The highest expression of CCL22 mRNA was observed at 24 h, although the difference did not reach statistical significance (P > 0.05) (Fig. 1e).

3.2. Effects of IFN-γ, IL-13, or IL-4 on TNF-α-induced chemokine mRNA expression in canine keratinocytes

IFN-γ significantly enhanced TNF-α-induced mRNA expression of CCL5 and CXCL8 (P < 0.05; Fig. 2b, h), while significantly reducing TNF-α-induced mRNA expression of CCL17, CCL20, CCL27, and CCL28 (P < 0.05; Fig. 2c, d, f, g). In contrast, IL-13 significantly increased TNF-α-induced mRNA expression of CCL17 (P < 0.05; Fig. 2c), but significantly suppressed TNF-α-induced mRNA expression of CCL20 and CCL27 (P < 0.05; Fig. 2d, f). To further examine the effects of Th2-type cytokines, IL-4 was tested on the chemokines that showed significant responses to IL-13, namely CCL17, CCL20, and CCL27. Similar to IL-13, IL-4 exerted comparable effects: it significantly upregulated TNF-α-induced mRNA expression of CCL17 (P < 0.05; Fig. 3a), while significantly downregulating TNF-α-induced mRNA expression of CCL20 and CCL27 (P < 0.05; Fig. 3b, c). These results were summarized in Table 2.

Fig. 2.

Fig. 2

Open in a new tab

Effects of interferon (IFN)-γ or interleukin (IL)-13 on tumor necrosis factor (TNF)-α-induced chemokine gene expression in canine progenitor epidermal keratinocyte (CPEK) cells. CPEK cells were incubated with phosphate-buffered saline or 10 ng/mL TNF-α for 6 h (for CCL22) or 24 h (for all other chemokines) in the presence or absence of 10 ng/mL IFN-γ or 50 ng/mL IL-13. The relative mRNA expression levels of CCL2 (a), CCL5 (b), CCL17 (c), CCL20 (d), CCL22 (e), CCL27 (f), CCL28 (g), and CXCL8 (h) were quantified by real-time PCR. Data represent the mean ± standard deviation from five independent experiments. Data from the six groups were compared using the Kruskal–Wallis test, followed by the Steel test with the TNF-α-treated group as the control. Significance: *P < 0.05.

Fig. 3.

Fig. 3

Open in a new tab

Effects of interleukin (IL)-4 on tumor necrosis factor (TNF)-α-induced chemokine gene expression in canine progenitor epidermal keratinocyte (CPEK) cells. CPEK cells were incubated with phosphate-buffered saline or 10 ng/mL TNF-α for 24 h in the presence or absence of 10 ng/mL IL-4. The relative mRNA expression levels of CCL17 (a), CCL20 (b), and CCL27 (c) were quantified by real-time PCR. Data represent the mean ± standard deviation from five independent experiments. Data from the four groups were compared using the Kruskal–Wallis test, followed by the Steel test with the TNF-α-treated group as the control. Significance: *P < 0.05.

Table 2.

Summary of the effects of interferon (IFN)-γ and interleukin (IL)-13 on tumor necrosis factor (TNF)-α-induced chemokine gene expression in canine progenitor epidermal keratinocyte (CPEK) cells.

graphic file with name fx1.gif
Open in a new tab

Colors indicate relative changes in chemokine gene expression compared to that of the TNF-α alone group in CPEK cells. Red, upregulation; blue, downregulation; no color, no change.

3.3. Cell viability

Cell viability was not significantly affected by any of the cytokine treatments, confirming that the cytokine concentrations used in this study did not compromise cell integrity over the 24 h incubation period (Supplementary Fig. 1).

4. Discussion

In the present study, we demonstrated that TNF-α induced the mRNA expression of various chemokines, including CCL2, CCL5, CCL17, CCL20, CCL22, CCL27, CCL28, and CXCL8, in CPEK cells. Notably, this is the first report to show TNF-α-mediated induction of CCL20, CCL22, and CCL27 mRNAs in canine keratinocytes. Furthermore, IFN-γ increased TNF-α-induced mRNA expression of CCL5 and CXCL8, but reduced TNF-α-induced mRNA expression of CCL17, CCL20, CCL27, and CCL28. In contrast, IL-13 and IL-4 enhanced TNF-α-induced mRNA expression of CCL17, while they suppressed TNF-α-induced mRNA expression of CCL20 and CCL27. Taken together, these findings indicate that IFN-γ, IL-13, and IL-4 modulate TNF-α-induced chemokine gene expression in a chemokine-specific manner, resulting in both enhancement and suppression rather than a uniform synergistic response. Because these observations were obtained exclusively at the mRNA level in cytokine-stimulated CPEK cells, their relevance to the pathogenesis of cAD and to the distinct phases of the disease should be regarded as a hypothesis that requires further validation in vivo.

CCL17 is a ligand for CCR4 selectively expressed on Th2 cells (Imai et al., 1997, 1999). Previous studies have demonstrated increased expression of CCL17 in the lesional skin of dogs with spontaneous AD (Maeda et al., 2002, 2005). Additionally, serum levels of CCL17 were found to be elevated in dogs with spontaneous AD compared to healthy controls and were correlated with disease severity (Asahina et al., 2020). These data support the involvement of CCL17 in driving the Th2-type inflammatory response in cAD through the recruitment of Th2 cells to lesional skin. As confirmed in this study, TNF-α has been reported to induce CCL17 mRNA expression in CPEK cells (Shibata et al., 2010). However, the regulatory factors that modulate TNF-α-mediated CCL17 expression in keratinocytes have not been fully elucidated. In this study, we demonstrated that IL-13 and IL-4 enhanced TNF-α-induced CCL17 mRNA expression, whereas IFN-γ suppressed it in CPEK cells. Although these observations were obtained in vitro at the mRNA level, they raise the hypothesis that IL-13 and IL-4 promote Th2-type immunity during the acute phase of cAD, at least in part, by inducing CCL17 expression in keratinocytes, and that IFN-γ limits Th2-type responses during the chronic phase, when Th1-type immunity is also activated, by downregulating TNF-α-induced CCL17 expression in canine keratinocytes. Further studies are warranted to elucidate these regulatory mechanisms and their relevance to the pathogenesis of cAD. In addition, further in vivo studies are needed to confirm these observations.

We previously reported that IFN-γ enhanced TNF-α-induced CCL5 production in CPEK cells (Takahashi et al., 2024). In the present study, we confirmed this enhancing effect at the mRNA level. We further revealed that IFN-γ also augmented TNF-α-induced CXCL8 mRNA expression in CPEK cells. CCL5 is known to recruit various immune cells, including Th1 and Th2 lymphocytes, eosinophils, mast cells, monocytes, and dendritic cells, to the skin (Appay & Rowland-Jones, 2001; Onuffer & Horuk, 2002; Sallusto et al., 1998), and its expression has been shown to be elevated in the lesional skin of dogs with both experimental and spontaneous AD (Olivry et al., 2016; Pucheu-Haston et al., 2006; Sparling et al., 2022). Similarly, CXCL8, which primarily attracts neutrophils, has also been found to be upregulated in the skin of dogs with experimental AD (Olivry et al., 2016). Taken together, these observations indicate that IFN-γ enhances TNF-α-induced CCL5 and CXCL8 gene expression in canine keratinocytes. Whether this enhancement contributes to the inflammatory response in cAD remains to be determined in vivo.

This study revealed that IFN-γ, IL-13, and IL-4 suppressed TNF-α-induced mRNA expression of CCL20 and CCL27 in CPEK cells. CCL20 is known to attract CCR6-expressing T cells and dendritic cells (Homey et al., 2000). A previous study reported that CCL20 mRNA expression levels did not differ significantly between the lesional and non-lesional skin of dogs with spontaneous AD (Maeda et al., 2008). In contrast, CCL27 is essential for the homing of CCR10-expressing skin-resident lymphocytes (Davila et al., 2022). Its expression has been reported to be lower in the lesional skin compared to the non-lesional skin of dogs with spontaneous AD, showing a non-significant trend in one study (Santoro et al., 2022), and a statistically significant decrease in another (Maeda et al., 2008). IFN-γ, IL-13, and IL-4 are known to be upregulated in the lesional skin of cAD. Therefore, our in vitro findings raise the possibility that these Th1- and Th2-type cytokines contribute to the reduced expression of CCL20 and CCL27 observed in the lesional skin of dogs with AD, although this hypothesis requires direct verification in lesional skin.

CCL28 is a chemokine involved in the recruitment of CCR3- or CCR10-expressing cells, including T and B lymphocytes, and plays a role in mucosal and cutaneous immune responses (Mohan et al., 2017). CCL28 also shows a broad spectrum of antimicrobial activity against bacteria and fungi (Mohan et al., 2017). Previous studies reported that CCL28 mRNA expression levels were significantly elevated in the lesional skin of dogs with spontaneous AD, compared to either the non-lesional skin (Maeda et al., 2008) or the skin of healthy dogs (Santoro et al., 2022). In the present study, we found that IFN-γ, but not IL-13, inhibited TNF-α-induced mRNA expression of CCL28 in CPEK cells. These findings point to TNF-α as a factor potentially linked to the increased expression of CCL28 in the lesional skin of dogs with AD. However, the relevance of IFN-γ-mediated downregulation of TNF-α-induced CCL28 expression in canine keratinocytes to the pathogenesis of cAD remains unclear and warrants further investigation.

In this study, TNF-α-induced mRNA expression of CCL2 and CCL22 was not affected by co-stimulation with IFN-γ or IL-13. CCL2 is a key chemokine regulating migration of CCR2-expressing monocytes and macrophages (Deshmane et al., 2009), whereas CCL22, similar to CCL17, is a functional ligand for CCR4, which is selectively expressed on Th2 cells (Imai et al., 1998). A rapid increase in CCL2 mRNA expression has been reported in the skin following anti-IgE injection in a canine model of cutaneous late-phase reactions (Pucheu-Haston et al., 2006). Likewise, CCL22 mRNA expression was significantly elevated in the skin of dogs with experimental AD (Olivry et al., 2016), as well as in both lesional and non-lesional skin of dogs with spontaneous AD compared to healthy controls (Santoro et al., 2022). These observations indicate that CCL2 and CCL22 are inducible by TNF-α in canine keratinocytes without apparent modulation by IFN-γ or IL-13. Whether their expression in the skin of dogs with AD is similarly independent of a Th1- or Th2-skewed local immune environment remains to be determined.

A recent study reported that the combination of TNF-α and IFN-γ suppressed TNF-α-induced CXCL8 protein production in CPEK cells, while enhancing TNF-α-induced CCL2 protein production (Jung et al., 2025). In the present study, we demonstrated that this cytokine combination increased TNF-α-induced CXCL8 mRNA expression but had no significant effect on CCL2 mRNA expression in CPEK cells. Although we did not investigate the mechanisms underlying the discrepancies between our mRNA data and the previously reported protein levels, these differences may be attributable to post-transcriptional regulatory processes. In the case of CXCL8, such mechanisms may involve alterations in mRNA stability, translational efficiency, or protein degradation. Regarding CCL2, the absence of mRNA changes despite reported increases in protein levels may likewise reflect post-transcriptional regulation. This regulation may involve increased mRNA stability, enhanced translational efficiency, or reduced microRNA-mediated suppression, leading to elevated protein production without corresponding changes in mRNA expression. Additionally, differences in experimental conditions between the two studies, such as the confluence of CPEK cells at the time of stimulation or the precise timing of cytokine treatment, may have contributed to these divergent observations. These potential mechanisms should be clarified in future studies.

The findings of the present study are partially consistent with those reported in human keratinocytes. In humans, TNF-α and IFN-γ have been shown to synergistically enhance CCL5 and CXCL8 expression in human epidermal and oral keratinocytes (Barker et al., 1990; Li et al., 1996), consistent with the findings of the present study in canine keratinocytes. In contrast, several notable differences were observed between species regarding CCL17 and CCL22 regulation. In human keratinocytes, TNF-α and IFN-γ synergistically enhanced CCL17 expression (Kakinuma et al., 2002; Yu et al., 2002), whereas IFN-γ suppressed TNF-α-induced CCL17 mRNA expression in canine keratinocytes in the present study. Furthermore, in human keratinocytes, IL-4 suppressed TNF-α and IFN-γ-induced CCL17 expression, and both IL-4 and IL-13 suppressed CCL22 expression (Kakinuma et al., 2002; Xiao et al., 2003; Fujii-Maeda et al., 2004), whereas in the present study, IL-13 and IL-4 enhanced TNF-α-induced CCL17 mRNA expression in canine keratinocytes, and IL-13 did not affect CCL22 mRNA expression. These discrepancies may reflect species-specific differences in the regulatory mechanisms of chemokine expression in keratinocytes and warrant further investigation. Regarding CCL20, CCL27, and CCL28, to the best of our knowledge, the effects of IFN-γ or IL-4/IL-13 on TNF-α-induced expression of these chemokines in human keratinocytes have not been reported, and thus direct comparisons with the present findings cannot be made.

This study has several limitations. First, we used the CPEK cell line rather than primary canine keratinocytes. Although primary canine keratinocyte cultures have been established, this approach is technically demanding and requires skin biopsies, which impose practical constraints. Confirmation of the key findings using primary canine keratinocytes remains an important direction for future research. Second, all data in this study were obtained at the mRNA level, and the absence of protein-level validation is an important limitation of the present study. Whether the observed changes in chemokine mRNA expression are translated into corresponding changes at the protein level remains to be confirmed in future studies. Third, the chemokines analyzed in this study were selected based on their previously reported or suggested roles in the pathogenesis of cAD; however, an untargeted RNA-seq analysis could identify additional cytokine-regulated genes in canine keratinocytes that may be relevant to the pathogenesis of cAD. Fourth, cytokine-stimulated CPEK cells in a two-dimensional culture system do not reproduce the complex inflammatory microenvironment of cAD, in which keratinocytes interact with infiltrating immune cells, other resident skin cells, and cutaneous microorganisms. Caution should therefore be exercised when extrapolating the present findings to the pathophysiology and the disease phases of cAD. Future studies using more disease-relevant in vitro models, including co-culture systems incorporating immune cells or relevant microbial components, would be valuable for evaluating cytokine interactions and chemokine responses under conditions that more closely resemble cAD.

5. Conclusions

The present study demonstrated that TNF-α induces the mRNA expression of multiple chemokines in canine keratinocytes and that IFN-γ, IL-13, and IL-4 modulate TNF-α-induced chemokine gene expression in a chemokine-specific manner, producing both enhancement and suppression. These conclusions are limited to cytokine-mediated regulation of chemokine gene expression in cytokine-stimulated CPEK cells. Whether these in vitro findings are relevant to the development, progression, or distinct phases of cAD remains a hypothesis that requires validation in further in vivo studies.

Declaration of generative AI and AI-assisted technologies in the manuscript preparation process

During the preparation of this work, the author(s) used Claude (Anthropic) to improve the English language and readability of the manuscript. After using this tool, the author(s) reviewed and edited the content as needed and take full responsibility for the content of the published article.

CRediT authorship contribution statement

Takehiro Hasegawa: Writing – original draft, Visualization, Methodology, Investigation, Formal analysis, Data curation. Yuzuki Kaida: Writing – review & editing, Methodology, Investigation, Data curation. Kaho Takahashi: Writing – review & editing, Methodology, Investigation, Data curation. Rina Yoshimatsu: Writing – review & editing, Methodology, Investigation, Data curation. Miori Ando: Writing – review & editing, Methodology, Investigation, Data curation. Keitaro Ohmori: Writing – review & editing, Validation, Supervision, Project administration, Formal analysis, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.vas.2026.100876.

Appendix. Supplementary materials

mmc1.pdf (411.7KB, pdf)

References

  1. Appay V., Rowland-Jones S.L. RANTES: A versatile and controversial chemokine. Trends in Immunology. 2001;22:83–87. doi: 10.1016/S1471-4906(00)01812-3. [DOI] [PubMed] [Google Scholar]
  2. Asahina R., Maeda S. A review of the roles of keratinocyte-derived cytokines and chemokines in the pathogenesis of atopic dermatitis in humans and dogs. Veterinary Dermatology. 2017;28 doi: 10.1111/vde.12351. [DOI] [PubMed] [Google Scholar]
  3. Asahina R., Ueda K., Oshima Y., Kanei T., Kato M., Furue M., Tsukui T., Nagata M., Maeda S. Serum canine thymus and activation-regulated chemokine (TARC/CCL17) concentrations correlate with disease severity and therapeutic responses in dogs with atopic dermatitis. Veterinary Dermatology. 2020;31:446–455. doi: 10.1111/vde.12894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barker J.N., Sarma V., Mitra R.S., Dixit V.M., Nickoloff B.J. Marked synergism between tumor necrosis factor-alpha and interferon-gamma in regulation of keratinocyte-derived adhesion molecules and chemotactic factors. The Journal of Clinical Investigation. 1990;85:674–681. doi: 10.1172/JCI114491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Blubaugh A., Hoover K., Kim S.J., Fogle J.E., Sow F.B., Banovic F. Characterization of the pro-inflammatory and pruritogenic transcriptome in skin lesions of the experimental canine atopic acute IgE-mediated late phase reactions model and correlation to acute skin lesions of human atopic dermatitis. Veterinary Sciences. 2024;11:109. doi: 10.3390/vetsci11030109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chieosilapatham P., Kiatsurayanon C., Umehara Y., Trujillo-Paez J.V., Peng G., Yue H., Nguyen L.T.H., Niyonsaba F. Keratinocytes: Innate immune cells in atopic dermatitis. Clinical and Experimental Immunology. 2021;204:296–309. doi: 10.1111/cei.13575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chimura N., Kondo N., Shibata S., Kimura T., Mori T., Hoshino Y., Murayama N., Nagata M., Ide K., Nishifuji K., Kamishina H., Maeda S. Gene transcription analysis in lesional skin of canine epitheliotropic cutaneous lymphoma using quantitative real-time RT-PCR. Veterinary Immunology and Immunopathology. 2011;144:329–336. doi: 10.1016/j.vetimm.2011.08.012. [DOI] [PubMed] [Google Scholar]
  8. Davila M.L., Xu M., Huang C., Gaddes E.R., Winter L., Cantorna M.T., Wang Y., Xiong N. CCL27 is a crucial regulator of immune homeostasis of the skin and mucosal tissues. iScience. 2022;25 doi: 10.1016/j.isci.2022.104426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Deshmane S.L., Kremlev S., Amini S., Sawaya B.E. Monocyte chemoattractant protein-1 (MCP-1): An overview. Journal of Interferon and Cytokine Research. 2009;29:313–326. doi: 10.1089/jir.2008.0027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fujii-Maeda S., Kajiwara K., Ikizawa K., Shinazawa M., Yu B., Koga T., Furue M., Yanagihara Y. Reciprocal regulation of thymus and activation-regulated chemokine/macrophage-derived chemokine production by interleukin (IL)-4/IL-13 and interferon-γ in HaCaT keratinocytes is mediated by alternations in E-cadherin distribution. The Journal of Investigative Dermatology. 2004;122:20–28. doi: 10.1046/j.0022-202X.2003.22103.x. [DOI] [PubMed] [Google Scholar]
  11. Homey B., Dieu-Nosjean M.-C., Wiesenborn A., Massacrier C., Pin J.-J., Oldham E., Catron D., Buchanan M.E., Müller A., de Waal Malefyt R., Deng G., Orozco R., Ruzicka T., Lehmann P., Lebecque S., Caux C., Zlotnik A. Up-regulation of macrophage inflammatory protein-3 alpha/CCL20 and CC chemokine receptor 6 in psoriasis. The Journal of Immunology. 2000;164:6621–6632. doi: 10.4049/jimmunol.164.12.6621. [DOI] [PubMed] [Google Scholar]
  12. Imai T., Baba M., Nishimura M., Kakizaki M., Takagi S., Yoshie O. The T cell-directed CC chemokine TARC is a highly specific biological ligand for CC chemokine receptor 4. Journal of Biological Chemistry. 1997;272:15036–15042. doi: 10.1074/jbc.272.23.15036. [DOI] [PubMed] [Google Scholar]
  13. Imai T., Chantry D., Raport C.J., Wood C.L., Nishimura M., Godiska R., Yoshie O., Gray P.W. Macrophage-derived chemokine is a functional ligand for the CC chemokine receptor 4. Journal of Biological Chemistry. 1998;273:1764–1768. doi: 10.1074/jbc.273.3.1764. [DOI] [PubMed] [Google Scholar]
  14. Imai T., Nagira M., Takagi S., Kakizaki M., Nishimura M., Wang J., Gray P.W., Matsushima K., Yoshie O. Selective recruitment of CCR4-bearing Th2 cells toward antigen-presenting cells by the CC chemokines thymus and activation-regulated chemokine and macrophage-derived chemokine. International Immunology. 1999;11:81–88. doi: 10.1093/intimm/11.1.81. [DOI] [PubMed] [Google Scholar]
  15. Jung K., Ku J.Y., Kwon J.S., Won G., Yoon H., Oh S.I., Kim M.H., Kim C., Yoon J.S. IFN-γ/TNF-α synergism induces pro-inflammatory cytokine and chemokine production by in vitro canine keratinocytes. Veterinary Sciences. 2025;12:55. doi: 10.3390/vetsci12010055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kakinuma T., Nakamura K., Wakugawa M., Yano S., Saeki H., Torii H., Komine M., Asahina A., Tamaki K. IL-4, but not IL-13, modulates TARC (thymus and activation-regulated chemokine)/CCL17 and IP-10 (interferon-induced protein of 10 kDa)/CXCL10 release by TNF-α and IFN-γ in HaCaT cell line. Cytokine. 2002;20:1–6. doi: 10.1006/cyto.2002.1965. [DOI] [PubMed] [Google Scholar]
  17. Li J., Ireland G.W., Farthing P.M., Thornhill M.H. Epidermal and oral keratinocytes are induced to produce RANTES and IL-8 by cytokine stimulation. The Journal of Investigative Dermatology. 1996;106:661–666. doi: 10.1111/1523-1747.ep12345459. [DOI] [PubMed] [Google Scholar]
  18. Maeda S., Fujiwara S., Omori K., Kawano K., Kurata K., Masuda K., Ohno K., Tsujimoto H. Lesional expression of thymus and activation-regulated chemokine in canine atopic dermatitis. Veterinary Immunology and Immunopathology. 2002;88:79–87. doi: 10.1016/S0165-2427(02)00140-X. [DOI] [PubMed] [Google Scholar]
  19. Maeda S., Tsukui T., Saze K.I., Masuda K., Ohno K., Tsujimoto H., Iwabuchi S. Production of a monoclonal antibody to canine thymus and activation-regulated chemokine (TARC) and detection of TARC in lesional skin from dogs with atopic dermatitis. Veterinary Immunology and Immunopathology. 2005;103:83–92. doi: 10.1016/j.vetimm.2004.08.021. [DOI] [PubMed] [Google Scholar]
  20. Maeda S., Tsuchida H., Shibata S., Kawakami T., Tsukui T., Ohba Y., Fukata T., Kitagawa H. Expression analysis of CCL27 and CCL28 mRNA in lesional and non-lesional skin of dogs with atopic dermatitis. Journal of Veterinary Medical Science. 2008;70:51–55. doi: 10.1292/jvms.70.51. [DOI] [PubMed] [Google Scholar]
  21. Maeda S., Maeda S., Ohno K., Kaji N., Hori M., Fujino Y., Tsujimoto H. Protease-activated receptor-2 induces proinflammatory cytokine and chemokine gene expression in canine keratinocytes. Veterinary Immunology and Immunopathology. 2013;153:17–25. doi: 10.1016/j.vetimm.2013.01.018. [DOI] [PubMed] [Google Scholar]
  22. Maeda S., Ohno K., Uchida K., Igarashi H., Goto-Koshino Y., Fujino Y., Tsujimoto H. Intestinal protease-activated receptor-2 and fecal serine protease activity are increased in canine inflammatory bowel disease and may contribute to intestinal cytokine expression. Journal of Veterinary Medical Science. 2014;76:1119–1127. doi: 10.1292/jvms.14-0060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Marsella R. Advances in our understanding of canine atopic dermatitis. Veterinary Dermatology. 2021;32 doi: 10.1111/vde.12965. [DOI] [PubMed] [Google Scholar]
  24. Mohan T., Deng L., Wang B.Z. CCL28 chemokine: An anchoring point bridging innate and adaptive immunity. International Immunopharmacology. 2017;51:165–170. doi: 10.1016/j.intimp.2017.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nishifuji K., Yoon J.S. The stratum corneum: The rampart of the mammalian body. Veterinary Dermatology. 2013;24:60–72. doi: 10.1111/j.1365-3164.2012.01090.x. e15–e16. [DOI] [PubMed] [Google Scholar]
  26. Nuttall T.J., Knight P.A., McAleese S.M., Lamb J.R., Hill P.B. Expression of Th1, Th2 and immunosuppressive cytokine gene transcripts in canine atopic dermatitis. Clinical and Experimental Allergy. 2002;32:789–795. doi: 10.1046/j.1365-2222.2002.01356.x. [DOI] [PubMed] [Google Scholar]
  27. Olivry T., Naydan D.K., Moore P.F. Characterization of the cutaneous inflammatory infiltrate in canine atopic dermatitis. The American Journal of Dermatopathology. 1997;19:477–486. doi: 10.1097/00000372-199710000-00008. [DOI] [PubMed] [Google Scholar]
  28. Olivry T., Mayhew D., Paps J.S., Linder K.E., Peredo C., Rajpal D., Hofland H., Cote-Sierra J. Early activation of Th2/Th22 inflammatory and pruritogenic pathways in acute canine atopic dermatitis skin lesions. Journal of Investigative Dermatology. 2016;136:1961–1969. doi: 10.1016/j.jid.2016.05.117. [DOI] [PubMed] [Google Scholar]
  29. Onuffer J.J., Horuk R. Chemokines, chemokine receptors and small-molecule antagonists: Recent developments. Trends in Pharmacological Sciences. 2002;23:459–467. doi: 10.1016/S0165-6147(02)02064-3. [DOI] [PubMed] [Google Scholar]
  30. Pucheu-Haston C.M., Shuster D., Olivry T., Brianceau P., Lockwood P., McClanahan T., De Waal Malefyt R., Mattson J.D., Hammerberg B. A canine model of cutaneous late-phase reactions: Prednisolone inhibition of cellular and cytokine responses. Immunology. 2006;117:177–187. doi: 10.1111/j.1365-2567.2005.02276.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sallusto F., Lenig D., Mackay C.R., Lanzavecchia A. Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. The Journal of Experimental Medicine. 1998;187:875–883. doi: 10.1084/JEM.187.6.875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Santoro D., Archer L., Chong E. Evaluation of cutaneous and circulating (serum and exosomes) levels of chemokines (CCL17, CCL22, CCL27 and CCL28) in atopic dogs and their correlation with severity of the disease. Veterinary Dermatology. 2022;33:195–e56. doi: 10.1111/vde.13061. [DOI] [PubMed] [Google Scholar]
  33. Schlotter Y.M., Rutten V.P.M.G., Riemers F.M., Knol E.F., Willemse T. Lesional skin in atopic dogs shows a mixed Type-1 and Type-2 immune responsiveness. Veterinary Immunology and Immunopathology. 2011;143:20–26. doi: 10.1016/j.vetimm.2011.05.025. [DOI] [PubMed] [Google Scholar]
  34. Shibata S., Maeda S., Maeda S., Chimura N., Kondo N., Fukata T. Augmentation of CCL17 and CCL28 gene expression by TNF-alpha, IL-1beta, or IFN-gamma in cultured canine keratinocytes. Research in Veterinary Science. 2010;88:422–426. doi: 10.1016/j.rvsc.2009.11.011. [DOI] [PubMed] [Google Scholar]
  35. Sparling B.A., Moss N., Kaur G., Clark D., Hawkins R.D., Drechsler Y. Unique cell subpopulations and disease progression markers in canines with atopic dermatitis. The Journal of Immunology. 2022;209:1379–1388. doi: 10.4049/jimmunol.2200304. [DOI] [PubMed] [Google Scholar]
  36. Takahashi K., Yanuma N., Hirokawa M., Miyajima M., Ogawa M., Osada H., Sugita K., Kondo H., Ohmori K. Presence of the house dust mite allergen in the gastrointestinal tract of dogs with chronic enteropathy: A potential inducer of interleukin-1β. Veterinary Immunology and Immunopathology. 2020;230 doi: 10.1016/j.vetimm.2020.110150. [DOI] [PubMed] [Google Scholar]
  37. Takahashi K., Okazawa T., Shingaki T., Furuya K., Kimura J., Ohmori K. Tumour necrosis factor-α induces C-C motif chemokine ligand 5 production in canine keratinocytes. Veterinary Dermatology. 2024;35:219–225. doi: 10.1111/vde.13227. [DOI] [PubMed] [Google Scholar]
  38. Takahashi K., Yoshimatsu R., Kaida Y., Hasegawa T., Ohmori K. Toll-like receptor 2 activation induces C-C motif chemokine ligand 5 production in canine keratinocytes. Veterinary Dermatology. 2025;36:117–126. doi: 10.1111/vde.13330. [DOI] [PubMed] [Google Scholar]
  39. Tamamoto-Mochizuki C., Santoro D., Saridomikelakis M.N., Eisenschenk M.N.C., Hensel P., Pucheu-Haston C. Update on the role of cytokines and chemokines in canine atopic dermatitis. Veterinary Dermatology. 2024;35:25–39. doi: 10.1111/vde.13192. [DOI] [PubMed] [Google Scholar]
  40. Xiao T., Kagami S., Saeki H., Sugaya M., Kakinuma T., Fujita H., Yano S., Mitsui H., Torii H., Komine M., Asahina A., Nakamura K., Tamaki K. Both IL-4 and IL-13 inhibit the TNF-α and IFN-γ enhanced MDC production in a human keratinocyte cell line, HaCaT cells. Journal of Dermatological Science. 2003;31:111–117. doi: 10.1016/S0923-1811(02)00149-4. [DOI] [PubMed] [Google Scholar]
  41. Yu B., Koga T., Urabe K., Moroi Y., Maeda S., Yanagihara Y., Furue M. Differential regulation of thymus- and activation-regulated chemokine induced by IL-4, IL-13, TNF-α and IFN-γ in human keratinocyte and fibroblast. Journal of Dermatological Science. 2002;30:29–36. doi: 10.1016/S0923-1811(02)00046-4. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.pdf (411.7KB, pdf)

Articles from Veterinary and Animal Science are provided here courtesy of Elsevier

RESOURCES