Proopiomelanocortin (POMC)–β‐Endorphin System in the Rat Colon: Expression, Up Regulation by Stress, and Correlation With Stress‐Induced Visceral Analgesia

ABSTRACT

Background

The pituitary proopiomelanocortin (POMC)–β‐endorphin (β‐END) system is activated by hypothalamic corticotropin‐releasing factor (CRF) signaling and stress. We investigated whether this pathway is also expressed in the rat colon, regulated by peripheral CRF and stress, and correlated with stress‐induced visceral analgesia.

Methods

POMC and the prohormone convertases PC1/3 and PC2 transcripts were assessed by RT‐PCR, and POMC and β‐END localization was examined by immunohistochemistry in the proximal and distal colon of naïve adult male Sprague–Dawley rats. Proximal colonic POMC mRNA was quantified by real‐time quantitative PCR 1 h after intraperitoneal injection of CRF (10 μg/kg) or saline and on day 11 after assessing visceromotor responses (VMRs) to colorectal distension (CRD) using a non‐invasive method in rats subjected to repeated water avoidance stress (rWAS) (1 h/day for 10 days) or control handling. The correlation between POMC gene expression and VMRs was evaluated.

Results

POMC, PC1/3, and PC2 transcripts were detected in the proximal and distal colon. POMC‐ and β‐END‐immunoreactive cells are localized in the lamina propria and enteric plexuses. CRF increased POMC mRNA expression by 2.5‐fold. rWAS decreased VMRs to CRD in a pressure‐dependent manner, with a reduction of up to 52% at 60 mmHg, and increased POMC expression 10‐fold compared with controls; POMC expression was inversely correlated with cumulative VMRs (r = −0.655, p = 0.034).

Conclusions

POMC‐β‐END system expression in the rat colonic enteric plexus, together with CRF/stress‐induced upregulation of POMC and its correlation with analgesic responses to CRD, suggests a possible relevance in modulating visceral pain.

Key Points

• A functional POMC–β‐endorphin system was identified in the rat colon, supported by POMC, PC1/3, and PC2 gene expression, and POMC and β‐endorphin immunoreactivity localized primarily to the enteric plexus.

• Peripheral CRF injection and repeated water avoidance stress both upregulated colonic POMC mRNA expression.

• Elevated colonic POMC gene expression was associated with reduced visceral pain responses to colorectal distension.

• These findings reveal a novel enteric POMC–β‐endorphin system in the colon that responds to peripheral CRF and stress, suggesting an endogenous mechanism involved in stress‐related modulation of visceral pain.

This study identified a functional proopiomelanocortin–β‐endorphin system in the rat colon. Peripheral CRF and repeated water avoidance stress increased colonic POMC expression, which was associated with reduced visceral pain. These findings suggest that, outside the pituitary, a CRF‐ and stress‐sensitive enteric POMC–β‐endorphin system may help regulate visceral pain.

1. Introduction

Stress is increasingly recognized as a major contributor in the development and exacerbation of visceral pain disorders [1, 2], including irritable bowel syndrome (IBS) [3]. Among the neurobiological mechanisms recruited during stress, the corticotropin‐releasing factor (CRF) signaling system in the brain has emerged as a key regulator of stress‐related visceral pain responses [4, 5]. CRF and related peptides are released during stress and act through CRF receptor subtypes, namely CRF₁ and CRF₂, to coordinate endocrine, autonomic, and behavioral adaptations [6, 7]. Within the well‐established hypothalamic–pituitary axis, CRF released by stress acts through CRF₁ receptors on anterior pituitary corticotrophs inducing proopiomelanocortin (POMC) transcription and the subsequent production of multiple POMC‐derived peptides, such as β‐endorphin (β‐END), thereby linking stress signaling to endogenous opioid pathways [8, 9, 10].

In addition to its central actions, CRF signaling is widely distributed throughout the gastrointestinal (GI) tract. In rodent colon, both CRF₁ and CRF₂ receptors are expressed [11, 12, 13] and local CRF expression has been demonstrated to be upregulated by inflammatory stimuli [14] and stress exposure [15]. The activation of peripheral CRF receptors influences multiple GI functions, including motility, epithelial barrier permeability, immune activity, and visceral sensitivity [16, 17, 18]. While peripheral CRF signaling is well established as a modulator of visceral nociception [4, 18, 19], the downstream mechanisms responsible for these effects remain incompletely understood.

β‐END is an endogenous opioid peptide produced exclusively through proteolytic processing of POMC [20, 21], primarily by the prohormone convertases PC1/3 and PC2 [22, 23]. Although the POMC processing pathway is well characterized in the brain and pituitary [23, 24], earlier evidence indicates that its components are also present in the GI tract. POMC transcripts were detected by Northern blot in rat stomach, duodenum, and colon tissue extracts [25], while β‐END has been assessed by immunoreactivity in enteric neurons, enteroendocrine cells, and immune cells throughout the GI tract [26, 27, 28, 29]. PC1/3 and PC2 immunoreactivity has also been reported in enteric neuronal populations and epithelial elements of the human distal anorectal region [30]. Together, these findings suggest that the gut may contain an intrinsic POMC‐derived opioid network that locally modulates nociceptive signaling. However, the precise cellular sources of POMC within the colon are still unclear, and the interpretation of earlier immunohistochemical studies is further complicated by the extensive post‐translational processing of POMC and the potential for antibody cross‐reactivity among POMC‐derived peptides and their precursors [23, 31]. It is also unknown whether colonic POMC signaling is regulated by peripheral CRF or chronic stress.

Stress‐induced visceral analgesia (SIVA) provides a useful model for examining interactions between stress signaling and endogenous opioid pathways in the gut [32, 33]. We previously reported that repeated water avoidance stress (rWAS) reliably induces visceral analgesia in response to colorectal distention (CRD) when monitored in rodents avoiding surgery and postoperative single housing [34, 35, 36]. In particular, previous pharmacological studies have demonstrated a naloxone‐sensitive component in mediating stress‐induced antinociception [37, 38].

Therefore, in this study, we aimed to characterize the POMC–β‐END system in the rat colon in association with rWAS‐related visceral analgesia. We first examined POMC, PC1/3, and PC2 gene expression in the proximal and distal colon, as well as the cellular localization of POMC and β‐END immunostaining in full‐thickness and whole‐mount preparations. We then evaluated whether peripheral CRF signaling activation and rWAS regulate the colonic POMC gene expression and whether these changes correlate with the rWAS‐induced SIVA response.

2. Materials and Methods

2.1. Animals

Male Sprague–Dawley (SD) rats (265–297 g, Harlan Laboratory, San Diego, CA) were group housed (2–4/cages) under controlled conditions (22°C–24°C and lights on from 6:00 AM to 6:00 PM) with free access to standard rodent chow (Prolab RMH 2500, PMY Nutrition International, Brentwood, MO) and tap water. Studies were conducted under the approved protocols of the Department of Veterans Affairs (VA) Animal Component of Research, VA Greater Los Angeles Healthcare System (04012–06 and 9906–820). All experiments were performed between 8:00 AM and 1:00 PM to avoid the influence of diurnal rhythm on the hypothalamic–pituitary–adrenal axis under basal and stress conditions.

2.2. POMC, PC1/3 and PC2 mRNA Expression by Reverse Transcription Polymerase Chain Reaction (RT‐PCR) in the Colon of Naïve Rats

Three naive rats were decapitated and the proximal (1 cm from the cecum) and distal (2 cm to the anus) segments of the colon were collected. The pituitary gland, a well‐known site to express POMC, PC1/3, and PC2 [39] was also collected and used as a positive control. All colonic samples were snap‐frozen in dry ice and stored at −80°C until used. Total RNA was extracted using RNA‐Bee (TEL‐TEST, Friendswood, TX), following the manufacturer's recommended protocol as in our previous studies [40]. RNA pellets were resuspended in diethylpyrocarbonate (DEPC)‐treated water and further digested with DNase I for 60 min at 37°C (Promega, Madison, WI). The quality and amount of RNA samples were estimated based on the ratio of absorbance at 260/280 nm by UV spectrophotometer (ND‐1000, NanoDrop, Wilmington, DE). Total RNA (5 μg) was denatured at 65°C for 5 min and used to reverse‐transcribe the first‐strand cDNA in a total volume of 20 μL reaction by the ThermoScript RT‐PCR system (Invitrogen, Carbsbad, CA). One μl of RNase H was added into the reaction mixture to remove the RNA template. Subsequently, cDNA (1 μL) was amplified directly in a final volume of 30 μL using a RedTaq DNA Polymerase System (Sigma‐Aldrich, St Louis, MO). PCR was performed with 33 cycles at 92°C for 40 s, 57°C for 40 s, 72°C for 2 min, and a final extension step at 72°C for 5 min using specific primers for rat POMC, PC1, and PC2. Two pairs of primers were used to amplify POMC: one pair spanned the entire signal sequence and exons 2–3 of rat POMC, while the other pair targeted exon 3 only, which encodes the endorphin region (Figure 1A). PCR for the housekeeping gene, rat acidic ribosome protein (ARP), served as an internal control to assess RNA quality and cDNA normalization as in our previous study [40]. The sequences of primers are listed in Table 1. PCR products were separated by 1% agarose gel electrophoresis and visualized with ethidium bromide. The gel images were acquired by the Kodak EDAS 290 system. PCR products corresponding to the specific regions of cDNA detected were extracted with the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA), ligated into the pCR II vector, and transformed into Top10F’ component cells (TA Cloning kit, Invitrogen). Plasmid DNA from color‐selected colonies was prepared (QIAprep Miniprep Protocol, Invitrogen). Positive clones were identified by EcoRI restriction digestion and further confirmed by DNA sequencing using the Big Dye Terminator Cycle Sequencing System (ABI 310 DNA Sequencer; AME Bioscience, Chicago, IL).

FIGURE 1.

Expression of POMC, PC1/3, and PC2 mRNA in the rat colon. (A) Schematic representation of the rat proopiomelanocortin (POMC) gene (Pomc) structure. The Pomc is a single‐copy gene and is composed of three exons separated by two introns. Each exon contributes distinct functional elements to the POMC precursor protein. Exon 1 is entirely non‐coding. Exon 2 encodes the signal peptide and a portion of the N‐terminal region, whereas exon 3, the largest exon, encodes approximately 85% of the POMC protein, including sequences corresponding to several mature bioactive peptides, namely adrenocorticotropic hormone (ACTH), ᵧ‐lipotropin, and β‐endorphin. 5′UTR: 5′ untranslated region; 3′UTR: 3′ untranslated region. (B) Representative agarose gel electrophoresis images of RT‐PCR products generated using two primer sets targeting rat Pomc: A primer pair spanning specific for exon 3 (300 bp) and another for exons 2–3 (550 bp). (C) Representative agarose gel electrophoresis images of RT‐PCR products amplified using primer sets specifically for rat Pcsk1 (PC1/3; 225 bp) and Pcsk2 (PC2; 200 bp). (D) Representative agarose gel electrophoresis images of RT‐PCR products amplified using a primer set specifically for a housekeeping gene encoding rat acidic ribosome protein (ARP, 402 bp), which served as an internal control to assess RNA quality and cDNA normalization. Arrows indicate PCR products of the expected sizes. Samples were derived from naïve rat pituitary tissue (positive control, lane 1) and from proximal and distal colon tissues (lanes 2 and 3, respectively).

TABLE 1.

Rat oligonucleotide primers used for RT‐PCR and real‐time quantitative PCR.

cDNA	Direction	Primer (5′‐3′)	Size (bp)
for RT‐PCR
rPOMC1	Sense	AACCTGCTGGCTTGCATCC	550
	Antisense	CGTTCTTGAAGAGCGTCACC
rPOMC2	Sense	ATGGGTCACTTCCGCTGGGA	300
	Antisense	CAGGACTTG CTCCAAGCCATC
rPC1/3	Sense	AATCCTGTAGGCACCTGGAC	225
	Antisense	GGAGTTTTTGGGTACCAGGA
rPC2	Sense	GAGAGGAGACCTGAACATCA	200
	Antisense	GCAAGCCCTTCTGTGGTGCA
rARP	Sense	GTTGAACATCTCCCCCTTCTC	402
	Antisense	ATGTCCTCATCGGATTCCTCC
rPOMC2	Sense	ATGGGTCACTTCCGCTGGGA	300
	Antisense	CAGGACTTG CTCCAAGCCATC
rGAPDH	Sense	AGACAGCCGCATCTTCTTGT	142
	Antisense	TGATGGCAACAATGTCCACT

Note: rPOMC1 (spanning exon 2 and exon 3), rPOMC2 (spanning exon 3).

Abbreviation: r, rat.

2.3. POMC and β‐Endorphin Localization in the Colon of Naïve Rats

Immunohistochemistry was performed on the proximal and distal colon collected from the same three naïve rats and regions as described in Section 2.2.

2.3.1. Localization by Immunoperoxidase in Layers of Full Thickness

The full thickness of the proximal and distal colon was fixed in formalin, embedded in paraffin and sectioned at 5 μm thickness. Immunohistochemistry was performed using the avidin‐biotin‐peroxidase technique as previously detailed [41]. Sections were deparaffinized in xylene and hydrated in descending grades of ethanol. After washing 2 times (5 min each) in phosphate buffer saline (PBS), slides were placed in a plastic Coplin jar filled with 1 × Tris/EDTA buffer (pH 9.0) for POMC and 10 mM citrate buffer (pH 6.0) for β‐END immunostaining respectively, as recommended by the manufacturer, boiled for 20 min for antigen retrieval, and followed by cooling to room temperature (RT). Sections were washed twice in PBS. Endogenous peroxidase activity was blocked by incubation for 30 min with 0.3% hydrogen peroxide in PBS at RT. Slides were incubated overnight at 4°C with rabbit anti‐POMC antibody (1:1000, Cat# ab254257, Abcam Inc., Waltham, MA) or rabbit anti‐β‐END antibody (1:1000, Cat# 20063, ImmunoStar, Hudson, WI) diluted in PBS containing 0.3% Triton X‐100 (PBS‐T), followed by incubation with biotinylated donkey anti‐rabbit IgG (1:1000; Jackson ImmunoResearch, West Grove, PA) for 2 h at RT. Sections were subsequently processed for the avidin‐biotin‐peroxidase procedure using diaminobenzidine as a chromogen and then counterstained with Mayer hematoxylin (Sigma‐Aldrich, MHS32, St. Louis, MO). Immunohistochemical control was routinely performed following the same procedures, except that the primary antibodies were replaced with normal rabbit serum (Jackson ImmunoResearch).

2.3.2. Immunofluorescent Localization in Whole‐Mount Preparations of the Enteric Nervous System

Whole‐mount preparations of colonic enteric plexuses were performed as described in our previous study [11]. Briefly, the harvested proximal and distal colon were opened along the mesenteric border. Each tissue was pinned flat and fixed overnight in 0.1 M sodium phosphate buffer (PB, pH 7.4) containing 4% paraformaldehyde and 14% picric acid. After being rinsed in PBS, tissue samples were processed for longitudinal muscle/myenteric plexus (LMMP) and submucosal whole‐mount preparations. The mucosa was scraped off, the submucosa was collected and the circular muscle was carefully removed using fine forceps. LMMP whole‐mount preparation included the myenteric plexus adhering to the longitudinal muscle. To avoid regional differences, in each rat, two pieces of preparation (~0.5 cm²) of proximal and distal colon were dissected from the segment 1 cm distal from the cecum or 2 cm rostral to the anus respectively. Whole mount preparations were transferred into Corning Costar Flat Bottom 24 Well Plates (Fisher Scientific, Hampton, NH) for free‐floating immunolabeling with the samples floating in solution for antibody incubation and washing under gentle shaking (90 rpm, Corning LSE Low Speed Orbital Shaker, Fisher Scientific, Canoga Park, CA). After immersion in 10% normal donkey serum in PBS‐T for 30 min at RT to block non‐specific interactions and enhance permeabilization, samples were incubated with primary antibodies rabbit anti‐POMC antibody (1:500, Abcam) or rabbit anti‐β‐END antibody (1:500, ImmunoStar) diluted in PBS‐T, followed by Alexa Fluor 555‐conjugated anti‐rabbit IgG (1:400, Abcam) or Alexa Fluor 488‐conjugated anti‐rabbit IgG (1:400, Abcam). After three washes in PBS, samples were mounted on slides with anti‐fade mounting media (Vector Laboratory Inc., Burlingame, CA) and visualized by standard fluorescence microscopy. Images were acquired with Zeiss LSM 710 confocal microscopes (Carl Zeiss Microscopy LLC, White Plains, NY). The Alexa Fluor 555 and 488 were excited using a 561–10 nm diode‐pumped solid‐state laser and a 488 nm argon laser, respectively. Immunohistochemical controls were routinely performed following the same procedure except that the primary antibody was replaced by normal rabbit serum (Jackson ImmunoResearch).

2.4. Experimental Protocols

2.4.1. Intraperitoneal Injection of CRF

Human/rat CRF (Peptide Biology Laboratories, Salk Institute, La Jolla, CA) was stored in powder form at −80°C, prepared in saline at 1 μg/100 μL and vortexed thoroughly to ensure complete dissolution immediately before injection. Rats (6/group) received CRF at a dose of 10 μg/kg, known to induce CRF₁ receptor‐mediated activation of myenteric neurons in the proximal and distal colon [11], or saline injected intraperitoneally (0.3 mL) in the lower right quadrant of the abdomen to avoid the cecum and urinary bladder. After 60 min, rats were decapitated, and proximal colon tissue samples were collected for quantitative determination of POMC expression.

2.4.2. Repeated Water Avoidance Stress (rWAS)

The procedures for rWAS and non‐stress control were conducted in parallel (5–6 rats/group) to minimize experimental variability, as previously described [36]. For the rWAS, each rat was placed on a rectangular platform (5.8 cm × 5.8 cm × 6.0 cm; AMAC Plastic, Petaluma, CA) positioned at the center of an R20 rat cage (26.7 cm × 48.3 cm × 20.3 cm; Ancare, Bellmore, NY) for 1 h/day over 10 consecutive days between 8 and 10 am. The cage was filled with room‐temperature water (25°C) to a Level 1 cm below the top of the platform. Non‐stressed control rats remained in their home cages and were handled daily for 5 min for 10 days.

2.4.3. Visceral Motor Response (VMR) Determination

On day 11, the VMR was assessed in both groups (rWAS and controls) using a noninvasive manometric method as previously validated for rats [34, 35]. Briefly, a PE50 catheter was taped 3.5 cm caudal to the pressure sensor of a miniaturized pressure transducer catheter (SPR‐524 Mikro‐Tip; Millar Instruments, Houston, TX). A custom‐made infinitely compliant polyethylene balloon (2 × 5 cm) [42] was tied 1 cm below the pressure sensor (Henry Schein Inc., Melville, NY) using silk 4.0 sutures. Before each experiment, the balloon‐pressure sensor assembly was calibrated at 10, 20, 40, and 60 mmHg using a barostat (Distender Series II, G&J Electronics Inc., Toronto, Canada). Voltage outputs were converted to pressure values using a digital analog converter (Micro1401, Cambridge Electronic Design, UK) and Spike2 software (CED Ltd., Cambridge). On the experiment day, rats were briefly anesthetized with isoflurane (3% in O₂), and the lubricated balloon‐pressure sensor catheter was inserted into the colorectum with the distal balloon end positioned 1 cm from the anus. The catheter was secured to the tail with surgical tape (3 M Micropore). Rats were placed in Bollman cages, previously habituated for 1 h/day over 3 consecutive days, covered with a light tissue blanket, and allowed to rest for 30 min before colorectal distension (CRD). The balloon was connected to the barostat, and the pressure transducer to a preamplifier (model 600; Millar Instruments). Intracolonic pressure (ICP) signals were recorded using the CED Micro1401/SPIKE2 system.

The CRD protocol began with two 60 mmHg distensions to unfold the balloon, followed by two series of graded phasic distensions at 10, 20, 40, and 60 mmHg (20 s duration; 4 min interstimulus interval). The phasic component of ICP (pICP) was extracted using the “DC Remove” function in Spike2 (1 s time constant) to eliminate tonic smooth muscle activity, followed by the “root mean square amplitude” process (1 s time constant). The VMRs to CRD at 10, 20, 40, and 60 mmHg recorded by intraluminal colonic pressure were represented as percentage change relative to baseline [42]. Rats were euthanized by decapitation at the end of the VMR to CRD along with the control group, and the proximal colon was collected for quantitative determination of POMC expression.

2.5. Quantification of Colonic POMC mRNA Expression by Real‐Time PCR in CRF‐ and rWAS‐Treated Rats

POMC mRNA quantification was performed only in the proximal colon to avoid the potential confounding effect of repeated mechanical distension during CRD, which directly exposes the distal colon. In addition, we showed that peripheral injection of CRF and WAS activated enteric neurons throughout the colon with comparable responses in proximal and distal regions [11, 14, 43, 44], supporting the use of the proximal colon as a representative colonic segment to assess ip CRF‐ and stress‐induced modulation of POMC expression. Real‐time quantitative PCR for rat POMC was performed in duplicate on a StepOnePlus Real‐Time PCR System (Applied Biosystems) using a 25‐μl reaction volume as described before [40]. Briefly, each reaction contained 12.5 μL of SABiosciences RT2 SYBR Green ROX qPCR MasterMix (Qiagen, Valencia, CA), 0.5 μL of each oligonucleotide primer (10 μM), 1 μL of cDNA synthesized from rat proximal colon samples treated with ip CRF, rWAS, or control conditions, and 10.5 μL of H₂O. The selected forward (f) and reverse (r) primers for rat POMC are listed in Table 1. Rat glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) served as internal control (Table 1). Thermal cycling conditions were 95°C for 4 min, followed by 40 cycles of 95°C for 10 s, 57°C for 10 s, 72°C for 20 s with a final extension cycle of 10 min at 72°C. The specificity of the amplification reaction was determined by performing a melting curve analysis of the PCR fragments. POMC was normalized with GAPDH and calculated using the comparative ΔΔCt method. Results were calculated by the equation 2^‐ΔΔCt and expressed as fold change in reference to the control group.

2.6. Statistics Analysis

Data are expressed as mean ± SEM. Normality was assessed using the Shapiro–Wilk test. For comparisons between groups, Welch's t‐test was used when the data were normally distributed; otherwise, the nonparametric Mann–Whitney U test was applied. The association between POMC mRNA expression and cumulative VMR was evaluated using Spearman's rank correlation because of the small sample size and non‐normal distribution of the data. Statistical significance was defined as p < 0.05.

3. Results

3.1. mRNA Expression of POMC, PC1/3, and PC2 in the Rat Colon

Using two primer sets targeting either the signal peptide/exons 2–3 regions of rat Pomc or exon 3 alone encoding the β‐END region (Figure 1A), single bands of PCR products at their expected sizes (550 bp and 300 bp, respectively) were detected in both proximal and distal colon samples (Figure 1B). Corresponding bands were also detected in pituitary tissue, which served as a positive control (Figure 1B). Bands for Pcsk1 (PC1/3) and Pcsk2 (PC2) were also detected at their expected sizes (225 bp and 200 bp, respectively) in the proximal colon, distal colon, and pituitary tissues (Figure 1C). Amplification of the housekeeping gene rat Arp yielded bands at the expected size (402 bp) in all samples, with similar intensities across tissues (Figure 1D), confirming RNA integrity and equivalent loading. Sequencing analysis verified that the amplified PCR products corresponded precisely to the reported rat Pomc, Pcsk1, and Pcsk2 sequences.

3.2. Cellular Localization of POMC and β‐END Immunoreactivity in the Rat Colon

Immunoperoxidase staining of full‐thickness colonic sections from naïve rats demonstrated POMC immunoreactivity visualized as brown color, resulting from the diaminobenzidine colorimetric reaction, predominantly within the myenteric plexus, with little to no staining observed in the mucosa, submucosa, or muscle layers in either the proximal (Figure 2A) or distal colon (Figure 2C). In whole‐mount preparations of colonic enteric plexuses, POMC immunoreactivity detected in red fluorescence, corresponding to the Alexa 555 fluorophore, was localized to cells with neuronal morphology within both the submucosal (Figure 3A,B) and myenteric plexuses (Figure 3D,E) of the proximal (Figure 3A,D) and distal colon (Figure 3B,E). No immunoreactivity was observed in either full‐thickness sections (Figure 2B,D) or whole‐mount preparations (Figure 3C,F) when the primary POMC antibody was replaced with normal rabbit serum.

FIGURE 2.

Proopiomelanocortin (POMC) immunoperoxidase staining in full‐thickness colonic paraffin sections (5 μm) from naïve rats (n = 3). Representative images show immunoreactivity in brown color, resulting from the diaminobenzidine (DAB) colorimetric reaction (indicated by arrows), with hematoxylin counterstaining in blue‐purple. (A, C) Strong POMC immunoreactivity is evident in the myenteric plexus (MP). (B, D) No immunostaining is observed in any layer of the full‐thickness sections when the POMC antibody is replaced with normal rabbit serum. (A, B) Proximal colon. (C, D) Distal colon. M, Mucosa; SM, Submucosa; CM, Circular muscle layer; LM, Longitudinal muscle layer. Scale bar: 100 μm.

FIGURE 3.

Proopiomelanocortin (POMC) immunofluorescent labeling in whole‐mount preparations of the enteric plexuses from the colon of naïve rats (n = 3). Representative images show POMC immunoreactivity in red fluorescence, corresponding to Alexa 555 fluorophore labeling. (A, B, D, E) POMC immunoreactivity is predominantly localized in cells with neuronal morphology and in some fibers running between ganglia. (C, F) No immunolabeling is observed in the enteric plexuses when the POMC antibody is replaced with normal rabbit serum. (A–C) Submucosal plexus; (D–F) Myenteric plexus. (A, D) Proximal colon; (B, C, E, F) Distal colon. Scale bar: 100 μm.

Similar patterns were observed for β‐END immunohistochemistry. In full‐thickness colonic sections, β‐END staining was prominently localized within the submucosal and myenteric plexus (Figure 4A,C). In addition, β‐END staining was also observed in cells within the lamina propria (Figure 4A). In whole‐mount preparations, β‐END immunoreactivity was detected in cells with neuronal morphology of both the submucosal (Figure 5A,B) and myenteric plexuses (Figure 5D,E) in the proximal (Figure 5A,D) and distal colon (Figure 5B,E). No staining was observed in control sections (Figure 4B,D) or control whole‐mount preparations (Figure 5C,F) when the β‐END antibody was replaced with normal rabbit serum.

FIGURE 4.

β‐Endorphin (β‐END) immunoperoxidase staining in full‐thickness colonic paraffin sections (5 μm) from naïve rats (n = 3). Representative images show β‐END immunoreactivity in brown color, resulting from the diaminobenzidine (DAB) colorimetric reaction (indicated by arrows), with hematoxylin counterstaining in blue‐purple. (A, C) Strong β‐END immunoreactivity is observed in the lamina propria (LP), submucosal plexus (SP), and myenteric plexus (MP). (B, D) No immunostaining is detected in the corresponding regions when the β‐END antibody is replaced with normal rabbit serum. (A, B) Proximal colonic mucosa and submucosa. (C, D) Proximal colonic muscle layer, including the myenteric plexus. Scale bar: 100 μm.

FIGURE 5.

β‐Endorphin (β‐END) immunofluorescent labeling in whole‐mount preparations of the enteric plexuses from the colon of naïve rats (n = 3). Representative images show β‐END immunoreactivity in green fluorescence, corresponding to Alexa 488 fluorophore labeling. (A, B, D, E) β‐END Immunoreactivity is predominantly localized in cells with neuronal morphology. (C, F) No immunolabeling is observed in the enteric plexuses when the β‐END antibody is replaced with normal rabbit serum. (A–C) Submucosal plexus; (D–F) Myenteric plexus. (A, D) Proximal colon; (B, C, E, F) Distal colon. Scale bar: 100 μm.

3.3. | Regulation of POMC mRNA Expression by CRF and rWAS in the Rat Proximal Colon

Acute peripheral injection of CRF significantly increased POMC mRNA expression as monitored 1 h post injection, resulting in a 2.5‐fold elevation compared with vehicle‐treated controls (2.46 ± 0.39 vs. 1.00 ± 0.46, p < 0.05) (Figure 6A). Exposure to rWAS for 10 days markedly upregulated POMC mRNA levels, resulting in a10‐fold increase relative to non‐stressed controls (10.05 ± 3.14 vs. 1.00 ± 0.33, p < 0.05) (Figure 6B) as monitored on day 11 after the CRD.

FIGURE 6.

Quantitative analysis of proopiomelanocortin (POMC) gene expression in the rat proximal colon. (A) 1 h after intraperitoneal (i.p.) injection of CRF (10 μg/kg) or saline (0.3 mL), (B) On day 11 following 10 days of repeated water avoidance stress (rWAS; 1 h/day) or non‐stressed control rats (handled daily for 5 min in their home cages). POMC mRNA levels were determined by real‐time quantitative PCR, with rat glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) serving as an internal control. Melting curve analysis of the PCR fragments was performed to confirm amplification specificity. POMC expression was normalized to GAPDH and quantified using the comparative ΔΔCt method, with results expressed as fold change relative to the corresponding control group, calculated by the equation 2^‐ΔΔCt. Data are presented as mean ± SEM in bar graphs, with individual animal values overlaid as scatter points. Open and dark gray bars denote saline‐ and CRF‐treated rats in A, respectively, and non‐stressed and rWAS‐treated rats in B, respectively. Normally distributed data were compared using Welch's t‐tests. *p < 0.05 vs. the corresponding control group.

3.4. Correlation Between Colonic POMC mRNA Expression and VMR to CRD Following rWAS

In control rats, CRD at 20, 40, and 60 mmHg induced a stimulus‐intensity‐related increase in the VMR recorded by intraluminal colonic pressure (Figure 7A). rWAS reduced the VMRs to CRD in a pressure‐dependent manner, with trends toward decreased responses at 20 and 40 mmHg and a significant reduction to 52% of the response observed in non‐stressed controls at 60 mmHg (Figure 7A). This VMR reduction aligns with the development of SIVA. Correlation analysis further demonstrated a significant inverse relationship between colonic POMC mRNA expression and cumulative VMR response to CRD (r = −0.655, p = 0.034) (Figure 7B), indicating that higher levels of POMC expression were associated with lower visceral pain responses.

FIGURE 7.

Visceromotor response (VMR) to colorectal distension (CRD) following repeated water avoidance stress (rWAS) and its correlation with proopiomelanocortin (POMC) mRNA expression in the proximal colon. (A) VMR to CRD at 10, 20, 40, and 60 mmHg on day 11 following 10 days of rWAS or non‐stressed handling in rats from Figure 6B. VMR is recorded as intraluminal colonic pressure responses and represented as a percentage change relative to baseline. Data are expressed as mean ± SEM displayed as bar graphs with individual animal values overlaid as scatter points. Open and dark gray bars represent non‐stressed and rWAS‐treated rats, respectively. Between‐group comparisons were performed using Welch's t‐test for normally distributed data (10, 40, and 60 mmHg) and the Mann–Whitney U test for data that did not meet the normality assumption (20 mmHg). p < 0.05 vs. the non‐stressed control group at 60 mmHg. (B) Spearman's rank correlation analysis was used to assess the association between cumulative VMR and colonic POMC mRNA expression. Non‐stressed and rWAS‐treated animals are indicated by dark and red symbols, respectively. p < 0.05 was considered statistically significant.

4. Discussion

The current results demonstrate for the first time the presence of a functional POMC–β‐END system within the rat colon, which is dynamically regulated by the activation of peripheral CRF signaling or repeated psychological stress. Using complementary molecular, anatomical, and functional approaches, we identified the expression of POMC, PC1/3, and PC2 transcripts in the proximal and distal colon, localized POMC and β‐END immunoreactivity primarily to enteric plexuses, and showed that both peripheral CRF administration and rWAS upregulate colonic POMC gene expression. Notably, the increased POMC gene expression was inversely correlated with the VMR to CRD. Collectively, these findings support the existence of an intrinsic CRF‐responsive POMC–β‐END system in the colon that may locally modulate visceral nociception.

Our findings demonstrate that the colon contains the molecular components required for POMC processing. To our knowledge, prior evidence has been largely limited to a single Northern blot analysis that identified a POMC‐like transcript in whole rat colon extracts [25]. As depicted in Figure 1A, the rat POMC gene (pomc, NCBI Gene ID: 24664) comprises three exons separated by two introns. Exon 1 is entirely non‐coding, exon 2 encodes the signal peptide and part of the N‐terminal region, and exon 3, the largest exon, encodes approximately 85% of the POMC precursor, including sequences for several mature bioactive peptides such as β‐END [45, 46]. The detection of correctly sized amplicons with two independent primer sets targeting distinct regions of the rat POMC transcript (the exon 2–3 signal peptide region and exon 3), together with sequence verification and comparison with pituitary positive controls, provides strong evidence for authentic POMC transcription in the colon. In addition, the detection of PC1/3 and PC2 transcripts indicates that the colon contains the enzymatic machinery needed to process POMC into biologically active peptides, including β‐END. This finding extends a recent report showing the expression of PC1 and Met‐enkephalin in a subset of adult murine colonic myenteric neurons [47]. Collectively, these results strongly support the presence of the POMC–β‐END system in both the rat proximal and distal colon, suggesting that the detected transcripts are biologically relevant rather than nonspecific amplification or low‐level transcriptional background.

At the protein level, POMC immunoreactivity has previously been detected in rat GI tissue extracts, with the highest levels in the duodenum, followed by the colon and stomach [25]. However, the cellular source of POMC in the GI tract remains unclear. POMC‐derived peptides, including β‐END, have been identified in enteric neurons of the rat duodenum [48, 49, 50, 51], but reports in the colon are limited [52]. In addition, identifying POMC‐expressing cells in peripheral tissues has been challenging because of longstanding concerns about anti‐POMC antibody specificity and potential cross‐reactivity with other POMC‐derived peptides [53, 54]. To address this, we used two well‐characterized antibodies against POMC and β‐END. The rabbit monoclonal anti‐POMC antibody (Abcam, ab254257) has been validated by strong pituitary staining and lack of labeling in negative control tissues such as liver and spleen [55]. As a rabbit recombinant monoclonal antibody, it also has shown minimal lot‐to‐lot variability [55]. Likewise, the rabbit anti‐β‐END antibody (ImmunoStar 20,063) has demonstrated high specificity as pre‐adsorption with β‐END abolishes immunoreactivity, whereas related peptides, including γ‐END, α‐END, ACTH, α‐MSH, Met‐enkephalin, and dynorphin A/B, do not alter staining [56]. In our study, both antibodies produced reproducible, anatomically restricted staining patterns. Replacing the primary antibodies with normal rabbit serum completely eliminated immunoreactivity, further supporting staining specificity and excluding nonspecific secondary antibody labeling. Using complementary anatomical approaches, including immunoperoxidase staining of full‐thickness colonic sections, we mapped peptide distribution across colonic layers, while confocal imaging of whole‐mount enteric plexus preparations provided high‐resolution and three‐dimensional cellular localization. POMC immunoreactivity was concentrated mainly in the myenteric and submucosal plexuses of the proximal and distal rat colon, with little staining in the muscular or mucosal layers. Confocal imaging further indicated that POMC‐positive cells displayed neuronal morphology with large, smoothly contoured cell bodies resembling Dogiel Type II neurons [57]. β‐END showed a similar neuronal distribution, although its labeled cell bodies ranged from medium to variable in size. Because the characteristic processes used to define Dogiel neuron types [57] were not clearly visible, assigning specific Dogiel classifications to POMC‐ and β‐END‐immunoreactive neurons remains difficult. β‐END Immunoreactivity was also present in cells within the lamina propria. This broader distribution may reflect peptide transport along neuronal projections or expression by non‐neuronal cells such as immune cells. Previous studies have reported β‐END expression in lymphocytes, macrophages, macrophages/monocytes, granulocytes, and lymphocytes, as well as enteroendocrine cells, particularly under inflammatory conditions in the mouse colon, rat blood, and paw tissue [29, 58]. The presence of POMC and β‐END in the cells with neuronal morphology within enteric plexuses supports the concept of an intrinsic enteric opioid network [26, 59]. Because the enteric nervous system can independently regulate motility, secretion, immune interactions, and sensory signaling [60], opioid peptides within the enteric plexuses may modulate nociceptive signaling locally before sensory information reaches the central nervous system. Such peripheral regulation may be especially relevant during stress, when rapid adaptation of gut sensory function is required.

Our findings further show that CRF signaling dynamically regulates colonic POMC gene expression. Acute peripheral CRF administration increased POMC mRNA by 2.5‐fold within 1 h in the proximal colon, indicating the rapid activation of the enteric POMC system. In the pituitary, CRF stimulates POMC transcription through CRF₁ receptor‐dependent cAMP signaling pathways [61]. We previously showed that peripheral injection of CRF at a similar dose activates proximal and distal myenteric neurons and identified CRF₁ receptor gene expression in laser capture‐microdissected myenteric neurons in the proximal colon of naïve rat [11], suggesting that similar CRF₁‐mediated mechanisms may operate in colonic tissues to directly stimulate enteric POMC expression. The increase in colonic POMC expression after peripheral CRF administration may seem paradoxical, given the well‐established pronociceptive effects of peripheral CRF at such a dose on visceral sensitivity [4, 18]. Whether the upregulation of POMC gene expression will be translated to the activation of the endogenous enteric opioid system warrants further investigation, but it is well recognized that part of the stress response involves a compensatory opiate mechanism to limit excessive nociceptive signaling [32]. In this setting, enteric POMC‐derived β‐END may counteract CRF‐induced sensitization of visceral afferent pathways; however, this endogenous opioid response may be insufficient to overcome the strong pronociceptive effects of peripheral CRF. As a result, the overall physiological outcome remains visceral hyperalgesia despite activation of the colonic POMC system.

Likewise, rWAS increased colonic POMC gene expression by ten‐fold above control levels, providing the first evidence that repeated stress markedly upregulates colonic POMC expression and revealing a previously unrecognized stress‐responsive POMC system in the gut. The functional relevance of this upregulation is suggested by the inverse correlation with the cumulative VMR to CRD (r = −0.655, p = 0.034), indicating that animals with higher colonic POMC mRNA levels tended to exhibit lower visceral responsiveness to CRD. Notably, changes in POMC gene expression were assessed in the proximal rather than the distal colon, ruling out the possibility that the observed increase reflects a direct local effect of mechanical distention on POMC expression. Weather POMC translational activation in the colon by rWAS leads to subsequent production and activation of β‐END, which remains to be investigated to establish a causality. However, consistent with this possibility, previous pharmacological studies have shown that rWAS‐induced visceral analgesic response to CRD is naloxone sensitive [36]. Collectively, these findings support the concept that the colon possesses a stress‐responsive POMC‐derived opioid system that may represent a previously unrecognized peripheral component contributing to mechanisms underlying stress‐related visceral analgesia.

Some limitations of this study warrant consideration regarding the cellular localization of POMC and β‐END in the colon. Although POMC and β‐END immunoreactivity was observed in cells exhibiting typical enteric neuronal morphology within the enteric plexuses, double‐labeling with a pan‐neuronal marker, such as HuC/D, would provide more definitive confirmation of their neuronal identity. Furthermore, identification of the specific enteric neuronal subtypes expressing POMC and β‐END will require co‐localization with appropriate neuronal subtype markers, which could determine whether POMC and β‐END are preferentially expressed in sensory, secretomotor, interneuronal, or other enteric neuronal populations. Such analyses are currently hampered by the lack of suitable antibodies validated for reliable double‐labeling. Our findings demonstrate CRF/stress‐associated activation of the POMC at the transcriptional level; however, whether this leads to increased β‐END production or secretion needs to be further assessed using complementary biochemical approaches, including Western blotting with processing‐specific antibodies, peptide quantification by specific ELISA, or mass spectrometry. Additionally, although the inverse correlation between Pomc expression and VMRs is compelling, causality remains to be established. Selective inhibition of POMC processing or blockade of downstream β‐END signaling would be needed to determine whether activation of this pathway is contributing to stress‐induced visceral analgesia. Finally, only male rats were studied. Given the pronounced sex differences in IBS prevalence [62] and stress responsiveness [36], future studies should evaluate whether similar mechanisms operate in females.

In conclusion, this study identified a previously unrecognized CRF‐ and stress‐responsive POMC–β‐END system in the rat colon. Molecular, anatomical, and functional findings demonstrate the colonic expression of POMC and the processing enzymes PC1/3 and PC2, together with the cellular localization of POMC and β‐END mainly restricted to myenteric and submucosal plexuses, supporting the presence of an intrinsic enteric POMC‐opioid processing pathway. The upregulation in colonic POMC expression triggered by CRF and repeated stress, coupled with its inverse relationship with visceral pain responses to CRD, suggests that this system may play a role in modulating visceral nociception.

Author Contributions

Design the study: P.‐Q.Y., Y.T. Perform the experiments: P.‐Q.Y. and M.L. Acquire and interpret data: P.‐Q.Y., M.L., V.W.; Write the manuscript: P.‐Q.Y.; Provide critical inputs: Y.T., M.L., and V.W. All authors listed gave final approval for publication.

Funding

This work was supported by HIDDK, DK‐57238. VA Career Scientist Award and Merit Award.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.