Bioinformatics analysis of the sodium-dependent neurotransmitter transporter family in Bursaphelenchus xylophilus

Abstract

Pine wilt disease (PWD), caused by Bursaphelenchus xylophilus, poses a significant threat to global pine forests. The sodium-dependent neurotransmitter transporter (SNF) plays a critical role in the reuptake of neurotransmitters from the synaptic cleft, thereby terminating neural signal transmission and maintaining nervous system homeostasis. This study aimed to comprehensively identify all members of the SNF in B. xylophilus and elucidated their roles in nematode development and nervous system function. Through genome-wide data analysis, we identified 18 SNFs in B. xylophilus and thoroughly characterized their physicochemical properties, conserved motifs, protein structures, and gene expression profiles across different developmental stages. Phylogenetic analysis revealed evolutionary relationships with SNF homologs from other nematodes, suggesting lineage-specific functional adaptations. Chromosomal localization revealed that the SNF genes are distributed across five chromosomes with numbers ranging from 1 to 18. Expression analysis showed that Bx-snf-2, Bx-snf-6, Bx-snf-7, Bx-snf-9, Bx-snf-10 were highly expressed in adult males, while Bx-snf-1 and Bx-snf-4 were enriched during the egg stage. Additionally, Bx-snf-12 and Bx-snf-18 exhibited peak expression in fourth-stage larvae (L4). Notably, the upregulation of specific Bx-snfs during the dauer stage indicates potential roles in mediating stress adaptation and survival under adverse conditions. This study provides the first systematic characterization of the BxSNFs, revealing unique gene structures and specialized expression profiles. These findings offer potential molecular targets for developing novel control strategies against pine wilt disease by interfering with neurotransmitter reuptake.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12864-026-13150-7.

Introduction

Pine wilt disease (PWD), caused by Bursaphelenchus xylophilus, is one of the most destructive diseases to pine forest ecosystems globally [1]. Currently, PWD has been reported in 620 counties across 18 provinces in China, resulting in direct economic losses and incalculable losses of ecological services [2]. Its spread mainly relies on Monochamus spp. When the beetles lay eggs on pine trees, the nematodes attach to their body walls or invade their tracheal systems and are subsequently carried to healthy trees [3]. After entering the pine, B. xylophilus multiplies rapidly in the resin canals and xylem, disrupting water and nutrient transport and ultimately leading to pine death [4]. Due to its parasitic lifestyle, B. xylophilus has evolved characteristics such as strong adaptability, rapid reproduction, and high stress resistance. Under the influence of global trade and climate change, the spread range of B. xylophilus continues to expand, and the threat to pine forests is likewise intensifying [5]. The severity of the spread and damage caused by PWD is closely related to the biological characteristics of the pathogenic nematode itself. Therefore, investigating the biological characteristics of B. xylophilus is necessary to reveal the mechanisms underlying its spread and pathogenesis. In-depth research on the biological characteristics, neurophysiological mechanisms, and molecular mechanisms of B. xylophilus is of great significance for understanding its pathogenicity and for formulating prevention and control strategies.

Sodium-dependent neurotransmitter transporters (SNFs) are membrane proteins that utilize the sodium ion gradient to reuptake neurotransmitters, including dopamine, serotonin, and γ-aminobutyric acid (GABA) from the synaptic cleft, thereby terminating neural signals and maintaining homeostasis [6]. SNFs play crucial roles in regulating neuronal excitability, synaptic plasticity, and behavior. These transporters are responsible for clearing neurotransmitters, including serotonin, dopamine, and norepinephrine from the synaptic cleft and serve as key targets for various neuropharmacological drugs [7]. The SLC6 family, to which SNFs belong, has been extensively studied in animals and plays a central role in synaptic transmission by mediating the reuptake of additional neurotransmitters, including GABA [8]. In mammals, SNFs are closely associated with diseases including depression and addiction, with serotonin and dopamine transporters serving as important therapeutic targets [9]. In nematodes, SNFs are involved not only in neural signal transduction but also in development, metabolism, and parasitic adaptation, suggesting functional diversification [10]. Although numerous studies have investigated neurotransmitter transporters in model and parasitic nematodes, research on BxSNFs remains entirely lacking. As an important invasive species that causes PWD, B. xylophilus relies on neurotransmitter transporters to regulate neurotransmitter concentrations in the synaptic cleft, thereby maintaining neuronal excitability and mediating behavioral plasticity [11]. However, the specific composition, expression patterns, and physiological functions of these transporters in this species remain unclear. A systematic study of these proteins will help elucidate the neuromolecular mechanisms underlying the parasitic adaptation of B. xylophilus and identify potential species‑specific drug targets, thereby providing a theoretical basis for developing novel, environmentally friendly strategies for the prevention and control of PWD. Therefore, systematically elucidating the functions of BxSNFs holds significant scientific and practical value.

B. xylophilus is an obligate parasitic nematode, and its nervous system plays a crucial role in its survival and reproduction [12]. The nervous system is not only involved in regulating the movement, foraging, and reproductive behaviors of B. xylophilus, but also plays a key role in its interaction with the host pine and vector insects [13]. In humans, the prevalence of mutations in genes encoding subunits of the SWI/SNF chromatin remodeling complex is very high, with nearly 25% of cancers having aberrations in one or more of these genes [14]. In Caenorhabditis elegans, SNF have been confirmed to participate in cell cycle regulation, prevent abnormal division, and monitor the development process to ensure normal larval growth [15]. In C. elegans, snf−1 played an important role in energy metabolism and stress response, while snf−2 was related to chromatin remodeling and affects gene expression [16]. The protein encoded by snf−11 in C. elegans was involved in chromatin remodeling and gene expression regulation, and played a key role in embryonic development and cell differentiation [17]. Mutants of snf−11 in C. elegans showed embryonic lethality or abnormal development, indicating that this gene has a core function in embryonic development and cell differentiation. Functional analysis further showed that this family occupies a central position in gene expression regulation and cell development [18]. The expression of snf−21 was up-regulated under oxidative stress conditions, helping nematodes resist oxidative damage and playing an important role in the stress response and metabolic regulation of C. elegans [19]. These results indicated that SNFs played a key role in the survival and adaptation of C. elegans. SNFs responded to environmental changes and physiological needs by regulating gene expression and cell metabolism [20]. The functions of the SNF family are equally important in B. xylophilus, particularly for its survival and reproduction within the host. B. xylophilus must complete its development from larvae to adults within pine trees, and BxSNFs regulate the expression of relevant genes during this process, thereby ensuring normal nematode development. Meanwhile, B. xylophilus encounters various environmental stresses within host pine trees, including host defense mechanisms and chemical stress [21]. BxSNFs likely play a similar role, helping the nematode adapt to these stresses and thereby enhancing its survival within the host.

In this study, it provides the first comprehensive characterization of the sodium-dependent neurotransmitter transporter (BxSNF) family in B. xylophilus, offering valuable insights into their potential roles in the nematode's development, stress adaptation, and parasitic survival. By employing bioinformatics tools, we identified 18 BxSNF family members and examined their physicochemical properties, evolutionary relationships, and expression profiles across different developmental stages. Our findings reveal stage-specific gene expression patterns, with certain BxSNFs showing distinct upregulation during stress-adaptive stages, which may help the nematode cope with adverse environmental conditions. Given the crucial role of these transporters in regulating neurotransmitter reuptake and maintaining nervous system homeostasis, the BxSNFs serve as promising molecular targets for novel, environmentally sustainable strategies to control pine wilt disease. Future research exploring the tissue-specific localization and functional validation of these transporters will further deepen our understanding of their precise roles in the physiology of B. xylophilus and its interaction with the host, contributing to more effective pest management strategies [22].

Materials and methods

Identification and analysis of physicochemical properties of BxSNFs

In this study, the whole-genome data of B. xylophilus (accession number SAMEA7282713) were obtained from the WormBase database (https://parasite.wormbase.org). Subsequently, relevant sequence information for Aphelenchoides avenae, A. besseyi, Acanthocheilonema viteae, A. bicaudatus, A. fujianensis, Brugia pahangi, Caenorhabditis elegans, C. strongyloides, C. remanei, Dictyocaulus viviparus, Dirofilaria immitis, Ditylenchus destructor, Haemonchus contortus, and Pristionchus pacificus was retrieved from the NCBI Gene database (https://www.ncbi.nlm.nih.gov/gene). To identify candidate BxSNF protein sequences, BLASTX was used to align known SNF sequences against the B. xylophilus protein database [23]. To further verify the presence of conserved domains, the Pfam database (https://pfam.xfam.org/) was accessed, and HMMER3.0 was used to search for corresponding sequences in the B. xylophilus protein dataset [24]. To eliminate redundant or mis-annotated sequences, candidate sequences were further analyzed by integrating the NCBI Conserved Domains (https://www.ncbi.nlm.nih.gov/Structure/cdd) and the InterPro platform (https://www.ebi.ac.uk/interpro), ultimately establishing a reliable set of BxSNF sequences [25]. The Expasy ProtParam tool (https://web.expasy.org/protparam) was used to analyze the physicochemical properties of these proteins [26]. Cross-validation screening across multiple databases was employed to ensure the reliability of BxSNF functional predictions.

Phylogenetic analysis and conserved motif analysis of BxSNFs

To evaluate the phylogenetic relationships among the 18 BxSNF protein sequences, phylogenetic analysis and conserved domain analysis was conducted. MEGA12 was used to perform multiple sequence alignment of the BxSNF sequences to determine the best model for constructing the maximum‑likelihood phylogenetic tree [27]. Subsequently, the maximum‑likelihood method was employed to construct the phylogenetic tree, with 1,000 bootstrap replicates to evaluate branch support values. The iTOL online tool (https://itol.embl.de/tree/) was used to visualize the phylogenetic tree, enhancing the clarity and readability of the topological structure [28]. Gene structure information was derived from the annotation files of BxSNFs, and exon–intron structure analysis was performed using the GSDS 2.0 server (http://gsds.gao-lab.org/) [29]. In addition, to reveal the distribution of functional modules within the proteins, MEME Suite 5.56 (https://meme-suite.org/meme/) was used under default parameters to identify up to eight conserved motifs in BxSNFs [30]. Notably, a single analytical method often fails to comprehensively capture the evolutionary patterns of genes. Therefore, the motif distribution map generated by MEME was integrated with the maximum‑likelihood tree to construct an annotated composite map of gene structure and motifs. This integration strategy not only improves the interpretability of the results but also helps infer trends of functional differentiation among different members from a structural variation perspective. Highly conserved motifs typically correspond to key functional regions, and changes in their arrangement imply adaptive functional adjustments.

Chromosomal distribution and protein structure analysis of BxSNFs

TBtools was used to extract gene density information from the genomic annotation file of B. xylophilus, and the density file was integrated with the GFF file to draw the distribution map of BxSNF on chromosomes [31]. The secondary structure of the protein was predicted online using Prabi (https://doua.prabi.fr/software/cap3) [32], NetPhos3.1 (https://services.healthtech.dtu.dk/services/NetPhos-3.1/) [33], and Protter1.0 (http://wlab.ethz.ch/protter/start/) [34]. The tertiary structure was modeled using Swiss—Model (https://swissmodel.expasy.org/interactive).

Cultivation of B. xylophilus at different developmental stages

To obtain synchronized eggs of B. xylophilus, nematodes of mixed ages were placed in a Petri dish and cultured at 25 °C in the dark for 10 min. During this process, the eggs adhered to the substrate via surface glycoproteins [35]. Subsequently, the supernatant containing free-moving nematodes was removed, and the synchronized eggs were collected. These eggs were incubated under non-nutrient, light-protected conditions at 25 °C and developed into second-instar larvae (L2). The synchronized L2 larvae were transferred to PDA plates inoculated with Botrytis cinerea for cultivation, and samples were collected at 24, 48, and 72 h to obtain third-instar larvae (L3), fourth-instar larvae (L4), and adults. In addition, third-instar dauer larvae (D3) were isolated from infected pine tissues. Fourth-instar dauer larvae (D4) were also collected from Monochamus alternatus that had reached the pre-emergence stage. For this purpose, beetles were dissected from naturally infected pine logs, and any nematodes they carried were isolated using the Baermann funnel technique. Based on their morphological features, these isolated individuals were confirmed as D4 larvae [36]. Male and female adults were manually separated using a fine needle under a stereoscopic microscope.

Differential expression analysis of Bx-snfs across developmental stages of B. xylophilus

The total RNA extraction using the Trizol (Invitrogen, USA) method [37, 38]. RNA was then converted to complementary DNA (cDNA) using the PrimeScript TM RT Reagent Kit with gDNA Eraser (RR047A, Takara Biotechnology). Rt-qPCR was performed using the Bx-28S gene as an internal control. The experiment was conducted with three independent biological replicates, each including three technical replicates. Primer 6.0 software was used to design the primers, which were designed by Sangon Biotech (Shanghai, China) (Table 1). QuantStudio 1 Plus (Thermo Fisher Scientific, Waltham, MA, USA) was used, and the protocol provided by the One Step Prime-Script™ RT-PCR Kit (RR064A; Beijing, China) [22] was compared via the threshold cycle (2^−ΔΔCt) method of gene expression.

Table 1.

The primers of Bx-snfs for RT-qPCR

Gene name	Forward primer (5’−3’)	Reverse primer (5’−3’)
Bx-snf-1	GCTATGGCGAGGTTTTGGTG	CAGCGTAAAACAGCCCACAA
Bx-snf-2	GTCCGTTTTGTTGTCCACGG	AGGAAGGTCAGAGGGCAGAT
Bx-snf-3	GCGCATCCAAAGGAATCACC	TCAATGCCAACAAGACCCCA
Bx-snf-4	TACTCGCGGCTGAACTACTG	GCACTCCGCACCATTGTTTT
Bx-snf-5	GTCTGAGCGGGGTATCCTTG	GGTTTGGGCCGCTTCAATTT
Bx-snf-6	TTGTGCAAGATGGGACTGCT	CCACGGCTTCGATAAGACCA
Bx-snf-7	TTGTCTCCCGGATTTGGTGG	AGCAAGGCGTCCCTATACAC
Bx-snf-8	AACGCTGTGCTGACGAAAAC	ATCCCATCCTCCGCTCCATA
Bx-snf-9	CACACAGACAACGAATGGCG	GCAGGCAAAACAACGGGATT
Bx-snf-10	TGACTTTGGACGGGTCTTGG	GGCGTCCTTCCACAAGGTTA
Bx-snf-11	CTTGGCCTACCCTGAAGTGG	CTTCCAGGGCAGTGAAGAGG
Bx-snf-12	CCCTTACGTTGTACTCGGCA	GCCAAACTGCGGGTTCTTTT
Bx-snf-13	CGCTCTCGGATCTCACAACA	TACTTGTGCCCCCATTCACA
Bx-snf-14	ATCGGTCAGTAATGGCTGGG	CTCAATCCAGGCAGAGGGTT
Bx-snf-15	CTGGTATCATGGTCGGCTGT	TCTAATGAGCCGGGGAGAGT
Bx-snf-16	ACTCCTGATCTGACCCGTCT	CGATCAGACCACCAAACCCA
Bx-snf-17	ATGTCTGGCGTTTCCCCTAC	CCGCAAAGCAACAGGGAAAT
Bx-snf-18	AGAATCGGCTCTTTTCGGCT	TCAACGTAAACACAAGCGGC
Bx-28S [39]	AACCGAACACGCGACAATAG	GTGCGTATTCAGCCTTCTGG

Results

Identification and analysis of physicochemical properties of BxSNFs

Members of the BxSNF family were systematically identified using BLASTX on the WormBase platform, combined with conserved domain verification (Fig. S1 and S2). According to their genomic arrangement order, they were named BxSNF1 through BxSNF18 (Table 2). Physicochemical property analysis showed that BxSNFs are composed of an average of 735.44 amino acids, with an average molecular weight of 82.91 kDa. The smallest protein is BxSNF1 (68.48 kDa), and the largest is BxSNF7 (154.80 kDa). The theoretical isoelectric points (pI) of BxSNFs range from 5.32 to 9.22, indicating that their stability and activity may vary under different pH environments. Seventeen BxSNFs are hydrophilic proteins, whereas BxSNF3, BxSNF5, BxSNF6, BxSNF7, and BxSNF18 are unstable (Table 3). These physicochemical properties not only provide important clues for understanding the structural and functional characteristics of BxSNFs but also lay the foundation for subsequent functional studies and the development of potential drug targets.

Table 2.

Comparison of BxSNFs with homologous proteins in other nematodes

Protein ID of B. xylophilus	Protein name	Sequence ID in NCBI	Protein name in other nematodes	Other nematodes name	Scores of BlastP	Similarity E-value
BXYJ5.010024300	BxSNF1	KAH7727597.1	Aphelenchoides avenae	Cre-snf-5	803	0
BXYJ5.010054300	BxSNF2	XP_050039269.1	Dermacentor anderson	SLC6A9-like	81	0
BXYJ5.010103700	BxSNF3	KAI6182344.1	Aphelenchoides bicaudatus	SLC6A4	920	0
BXYJ5.010136800	BxSNF4	KAI6216681.1	Aphelenchoides besseyi	SLC6A1	811	0
BXYJ5.010202500	BxSNF5	KAI6171581.1	Aphelenchoides bicaudatus	SLC6A5	1060	0
BXYJ5.010210700	BxSNF6	KAI1722524.1	Ditylenchus destructor	SLC6 domain-containing protein	599	0
BXYJ5.010210900	BxSNF7	KAI1722524.1	Ditylenchus destructor	SLC6 domain-containing protein	1224	0
BXYJ5.010259700	BxSNF8	KAI6183239.1	Aphelenchoides bicaudatus	SNF-9	901	0
BXYJ5.010269300	BxSNF9	KAI1712787.1	Ditylenchus destructor	SLC6 domain-containing protein	638	0
BXYJ5.020052100	BxSNF10	KAI6220317.1	Aphelenchoides besseyi	SLC6A8	719	0
BXYJ5.020097400	BxSNF11	KAI6221563.1	Aphelenchoides besseyi	CrT1	1014	0
BXYJ5.030111600	BxSNF12	KAI6214832.1	Aphelenchoides besseyi	Transporter	971	0
BXYJ5.030151500	BxSNF13	KAI1713067.1	Ditylenchus destructor	SLC6 domain-containing protein	897	0
BXYJ5.030166200	BxSNF14	XP_013385449.1	Lingula anatina	SLC6A9	259	4 × 10–72
BXYJ5.030188900	BxSNF15	KAI6235034.1	Aphelenchoides besseyi	Transporter	1028	0
BXYJ5.030207400	BxSNF16	KAI6201587.1	Aphelenchoides besseyi	Transporter	1203	0
BXYJ5.040047200	BxSNF17	KAI6177779.1	Aphelenchoides bicaudatus	SLC6A8	1038	0
BXYJ5.060007300	BxSNF18	XP_048740168.2	Ostrea edulis	SLC6A7-like	113	3 × 10–21

Table 3.

Physicochemical properties analysis of BxSNFs

Protein name	Number of amino acids	Molecular weight/kDa	Isoelectric point	Aliphatic index	Hydrophilicity	Number of atoms	Instability index	Stability
BxSNF1	611	68.48	8.74	103.57	0.520	9689	31.22	Stable
BxSNF2	721	81.44	6.48	105.56	0.288	11576	27.23	Stable
BxSNF3	652	72.96	8.17	98.21	0.408	10270	42.08	Unstable
BxSNF4	645	72.87	6.27	121.09	0.603	10392	34.54	Stable
BxSNF5	1062	119.74	7.77	90.83	−0.068	16852	45.93	Unstable
BxSNF6	659	74.33	7.82	92.00	0.301	10465	45.27	Unstable
BxSNF7	1376	154.80	6.95	87.87	0.194	21706	44.56	Unstable
BxSNF8	674	76.19	7.02	93.06	0.229	10710	39.19	Stable
BxSNF9	665	74.32	9.10	91.77	0.207	10486	39.29	Stable
BxSNF10	742	83.46	6.40	90.50	0.171	11679	38.25	Stable
BxSNF11	624	70.31	7.07	94.84	0.362	9891	29.84	Stable
BxSNF12	643	72.65	5.97	96.44	0.301	10208	34.95	Stable
BxSNF13	621	69.85	7.76	95.01	0.366	9893	32.23	Stable
BxSNF14	710	80.16	8.25	108.01	0.405	11379	34.05	Stable
BxSNF15	684	78.11	5.32	103.39	0.448	11006	38.26	Stable
BxSNF16	731	81.88	5.76	90.70	0.255	11452	35.36	Stable
BxSNF17	617	70.13	6.12	97.62	0.477	9893	28.35	Stable
BxSNF18	801	90.70	9.22	95.78	0.278	12808	45.73	Unstable

Phylogenetic and conserved motif analysis of the SNF family in B. xylophilus

For phylogenetic tree construction, the LG + G model was selected as the optimal evolutionary model. This model performed well in statistical evaluation, yielding a BIC score of 22,286.973 and an AICc score of 21,967.740, indicating strong goodness of fit and robust statistical support for describing the evolutionary relationships among BxSNFs. The phylogenetic tree constructed using the maximum-likelihood method clearly showed the evolutionary relationships between BxSNFs and homologous proteins from other nematodes, providing important evolutionary context for understanding the functional evolution of these transporters in the life cycle of B. xylophilus. Through detailed analysis of the phylogenetic tree of B. xylophilus (Fig. 1), the intron–exon composition of the Bx-snfs was determined. The results showed that the number of exons among the 18 Bx-snfs varied significantly, ranging from 1 to 18. Among them, Bx-snf-13 and Bx-snf-18 had the fewest exons (only one each), whereas Bx-snf-7 had the most, with 18 exons. This diversity in exon number may be closely related to the complexity of gene function and regulatory mechanisms. In addition, gene structure analysis revealed the presence and distribution patterns of introns. Intron insertion and splicing play key roles in regulating gene expression and may affect the structure and function of the resulting protein.

Fig. 1.

Phylogenetic tree of SNFs in Bursaphelenchus xylophilus and other nematodes. Note: Aa represents Aphelenchoides avenae, Abi represents A. bicaudatus, Abe represents A. besseyi, Ac represents Ancylostoma caninum, Afu represents A. fujianensis, Ce represents C. elegans, Cbr represents C. briggsae, Dd represents Ditylenchus destructor, Sra represents Strongyloides ratti, Tc represents Trichostrongylus colubriformis

In-depth analysis of the exon–intron structure contributes to a better understanding of the transcriptional and translational regulatory mechanisms of Bx-snfs. Analysis of conserved domains further indicated that BxSNFs possess similar conserved motifs (Fig. 2). These motifs are highly conserved evolutionarily, suggesting their crucial role in protein function. The conservation of these motifs reflects structural similarity and functional retention, as verified by analysis of the conserved motif structure within BxSNFs.

Fig. 2.

Comparison of the structure motifs distribution of BxSNFs

Chromosomal distribution of SNF family genes in B. xylophilus

Chromosomal localization analysis was conducted to determine the distribution of Bx-snfs on the chromosomes of B. xylophilus. The results showed that these genes are distributed across five chromosomes. This distribution pattern may be associated with gene expression regulation, functional diversification, and the evolutionary history of the species. Specifically, Bx-snf-1 through Bx-snf-9 are located on chromosome 1, occupying the second half of the chromosome; Bx-snf-10 and Bx-snf-11 are located in the middle region of chromosome 2; Bx-snf-12 through Bx-snf-16 are on chromosome 3, with Bx-snf-12 and Bx-snf-13 at the front end and Bx-snf-14 through Bx-snf-16 in the second half; Bx-snf-17 and Bx-snf-18 are located at the front regions of chromosomes 4 and 5, respectively (Fig. 3). This spatial arrangement likely reflects gene duplication and divergence events during evolution, potentially promoting both functional stability and diversity of the Bx-snfs.

Fig. 3.

Chromosomal position of BxSNFs

Protein structure analysis of BxSNFs

Analysis of the secondary structures of BxSNFs revealed that they share several hallmark features typical of SLC6 transporters. For instance, the α-helical content was notably high, ranging from 32.19% to 39.45% across the family, which is essential for forming the transmembrane domains that move neurotransmitters across the cell membrane. Furthermore, both β-sheet (12.05%–18.51%) and β-turn (3.39%–6.57%) contents contribute to structural stability while still allowing the conformational flexibility needed for substrate binding and release during transport (Table S1). Notably, some members also contain a relatively high proportion of random coils (36.39%–51.32%). This structural feature likely provides the dynamic flexibility required for the large-scale conformational changes between outward-facing and inward-facing states, a defining characteristic of the alternating access mechanism in SLC6 transporters (Fig. 4). Tertiary structure prediction further indicated quantitative variation among BxSNFs (Fig. 5). This structural conservation implies strong selective pressure during evolution, potentially associated with their central role in neurotransmitter reuptake. Additionally, structural similarity influences subcellular localization and molecular interactions. Transmembrane segments determine their anchoring positions on the cell membrane, whereas extracellular loops may mediate the recognition and binding of other molecules. The structural features of BxSNFs are likely closely related to their diverse biological functions within cells.

Fig. 4.

Topological structure prediction of BxSNFs

Fig. 5.

Three-dimensional structure prediction of BxSNFs

Expression profiles of Bx-snfs at different developmental stages

The reproductive phase of B. xylophilus is characterized by continuous larval development through successive molts (L1, L2, L3, L4 to adult). Following host tree mortality, L2 larvae molt into D3, initiating a developmental trajectory that comprises two sequential, facultative dauer stages (L2, D3, D4 to adult) that facilitate vector transmission and host colonization (Fig. 6). Gene expression data from B. xylophilus at different developmental stages were analyzed to determine the expression levels of multiple Bx-snfs under various conditions. Heatmap analysis showed significant differences in the expression of Bx-snfs across developmental stages. Notably, Bx-snf-2, Bx-snf-6, Bx-snf-7, Bx-snf-9, and Bx-snf-10 were highly expressed in adult males, suggesting that they may be involved in sex differentiation or male-specific physiological processes. Bx-snf-4 and Bx-snf-15 were significantly expressed during the egg stage, implying important functions in early embryonic development. Additionally, Bx-snf-12 and Bx-snf-18 were most highly expressed in fourth-instar larvae (L4), whereas Bx-snf-5 and Bx-snf-8 displayed elevated expression in dauer stages (D3 and D4), indicating possible involvement in stress adaptation and dispersal. Conversely, Bx-snf-3, Bx-snf-11, and Bx-snf-16 maintained relatively low expression across all developmental stages (Fig. 7). These findings provide valuable clues for further elucidating the functional differentiation of Bx-snfs and their roles in the developmental regulatory network.

Fig. 6.

Life cycle of B. xylophilus. Note: Egg, egg stage of B. xylophilus; male, male adult; female, female adult; L2, second‑instar larva; L3, third‑instar larva; L4, fourth‑instar larva; D3, third‑instar dauer larva; D4, fourth‑instar dauer larva

Fig. 7.

Gene expression pattern of Bx-snfs in different ages of B. xylophilus. Note: Egg, egg stage of B. xylophilus; male, male adult; female, female adult; L2, second‑instar larva; L3, third‑instar larva; L4, fourth‑instar larva; D3, third‑instar dauer larva; D4, fourth‑instar dauer larva

Discussion

For B. xylophilus, a highly specialized plant-parasitic nematode, the role of its nervous system in adapting to parasitic life and causing harm is far more complex than previously understood. Traditionally, research has focused primarily on its secreted proteins, effector molecules, and immune escape mechanisms, whereas a systematic understanding of the functions of its neural regulatory network in parasitic adaptation has long been lacking [40]. BxSNFs are crucial for the reuptake of neurotransmitters and for signal termination, thereby maintaining neuronal excitability and homeostasis. Additionally, they may be involved in environmental perception and stress responses. Therefore, elucidating the gene structure and function of the SNF family in B. xylophilus is crucial.

Compared with SNF family members reported in C. elegans, BxSNFs exhibited greater diversity in gene structure, with exon numbers ranging from 1 to 18. This structural variation reflected functional differentiation during the adaptation of B. xylophilus to a parasitic lifestyle [41]. Notably, BxSNF7 was the largest member of the family (154.80 kDa), containing 18 exons, whereas BxSNF13 and BxSNF18 contained only a single exon each. This extreme variation in exon numbers suggested distinct evolutionary origins and transcriptional regulatory mechanisms [42]. Single-exon genes may arise through retro transposition events, which are relatively common in the genomic evolution of parasitic nematodes and facilitate the rapid generation of novel functional genes [43]. In contrast, multi-exon genes may retain more complex regulatory networks, producing multiple transcript isoforms through alternative splicing to respond to diverse physiological signals and environmental stimuli [44]. In the human genome, SLC6 family members typically contain 12–15 exons, making the 18-exon structure of BxSNF7 particularly unusual, potentially related to the specific parasitic adaptability requirements of B. xylophilus [45]. Furthermore, analysis of theoretical isoelectric points revealed that BxSNFs have pI values ranging from 5.32 to 9.22. This broad pI distribution suggested that different family members may localize to distinct subcellular microenvironments or function under different pH conditions. The five proteins BxSNF3, BxSNF5, BxSNF6, BxSNF7, and BxSNF18 were unstable. These unstable proteins typically have short half-lives and are subject to strict post-translational regulation, enabling them to respond rapidly to environmental changes and physiological demands [46]. During host invasion or oxidative stress responses in plant-parasitic nematodes, these unstable SNF proteins may be rapidly degraded or resynthesized via the ubiquitin–proteasome pathway, thereby adjusting neurotransmitter reuptake efficiency and optimizing neural signal transmission within a relatively short timeframe [47]. This dynamic regulatory mechanism is crucial for B. xylophilus to maintain nervous system homeostasis under stressful conditions, such as within pine resin canals and xylem tissues.

Phylogenetic analysis revealed that BxSNFs share the closest evolutionary relationships with homologous proteins from other plant-parasitic nematodes while exhibiting more distant relationships with animal-parasitic and free-living nematodes. This evolutionary pattern suggests lineage-specific functional adaptations of the SNF family in plant-parasitic nematodes, closely related to their unique ecological niches and lifestyles. Free-living nematodes such as C. elegans primarily inhabit soil humus and feed on bacteria, with their nervous systems mainly regulating foraging, predator avoidance, and chemotaxis behaviors [48]. In contrast, plant-parasitic nematodes must perceive and respond to various secondary metabolites, signaling molecules, and defense substances released by host plants while also overcoming plant immune responses [49]. Therefore, BxSNFs may play important roles in chemosensation-related neural signal processing specific to plant-parasitic nematodes, particularly in recognizing and responding to characteristic chemical signals released by pine trees, including terpenoids, resin acids, and phenolic compounds [50]. BxSNFs may represent ideal targets for developing species-specific nematicides, enabling selective control of B. xylophilus by interfering with its unique neurotransmitter reuptake mechanisms while minimizing impacts on non-target organisms.

Chromosomal localization revealed that Bx-snfs are unevenly distributed across five chromosomes, with most located on chromosomes 1 and 3. This distribution pattern may reflect tandem duplication events that facilitated functional divergence [51]. Notably, no Bx-snfs were identified on chromosome 6; Bx-snf-18 was located at the front region of chromosome 5, suggesting that the SNF family in B. xylophilus has undergone lineage-specific expansion or contraction. Protein structure analysis of BxSNFs revealed a high proportion of α-helical transmembrane domains and random coils, consistent with the typical 12-transmembrane domain characteristics of SLC6 family members [52]. The α-helical transmembrane domains play critical roles in forming substrate transport channels and ion binding sites, whereas random coil regions may participate in protein–protein interactions and signal transduction processes [53]. Phosphorylation site prediction results indicated that all BxSNFs contain multiple potential phosphorylation sites, with BxSNF5 containing the most, suggesting that it may be subject to complex regulation by kinase signaling networks. Serine and threonine phosphorylation primarily participate in regulating protein conformational changes and transport activity, whereas tyrosine phosphorylation is more involved in cellular signal transduction and protein complex assembly [54]. Furthermore, glycosylation site prediction results showed that BxSNFs contain 1–8 N-glycosylation sites each, typically located in extracellular loop regions, potentially participating in proper protein folding, membrane localization, and ligand recognition.

The stage-specific expression patterns of BxSNFs are of great significance for understanding the neural regulatory requirements of the B. xylophilus at different life stages. Five genes (Bx-snf-2, Bx-snf-6, Bx-snf-7, Bx-snf-9, and Bx-snf-10) are highly expressed in male adults. This male-biased expression pattern implies that these transporters may be involved in male-specific neural circuits or reproductive behaviors [55]. In C. elegans, SNFs have been implicated in sex-specific behaviors such as chemotaxis, mating, and ejaculation [56]. Given that B. xylophilus reproduction relies on successful mating within pine xylem, these transporters may represent potential targets for disrupting population growth. Bx-snf-4 and Bx-snf-15 are highly expressed in the egg stage, indicating their critical roles in embryogenesis. Therefore, Bx-snf-4 and Bx-snf-15 may regulate neurotransmitter levels during early neurogenesis, ensuring proper formation of the nervous system. Bx-snf-12 and Bx-snf-18 are most highly expressed in fourth-stage larvae (L4), a critical period for neural circuit remodeling and sexual differentiation. In C. elegans, the L4 stage is characterized by extensive synaptic reorganization, and SNF transporters are required for proper GABAergic and glutamatergic signaling [57]. Thus, Bx-snf-12 and Bx-snf-18 may facilitate the behavioral maturation required for host invasion and reproduction. Interestingly, several Bx-snfs show elevated expression during the D3 and D4, which are specialized for survival under adverse conditions such as desiccation, low temperature, or food scarcity [58]. Dauer formation in B. xylophilus is a key adaptation for long-term survival in infected pine wood or during vector transmission [59]. The upregulation of Bx-snfs in dauer larvae suggests that neurotransmitter reuptake may be modulated to alter neural activity, promoting stress resistance and behavioral quiescence. Therefore, Bx-snfs may serve as molecular valves that couple neural signaling with metabolic adaptation under stress.

The stage-specific expression patterns of BxSNFs are of great significance for understanding the neural regulatory requirements of B. xylophilus at different life stages. Currently, the management of PWD relies heavily on chemical nematicides, which face challenges such as resistance development and environmental contamination [60]. Targeting specific BxSNFs with small-molecule inhibitors could provide a more sustainable alternative. Selective inhibition of male-biased BxSNFs might impair mating success without affecting non-target organisms. Furthermore, RNA interference (RNAi) targeting stage-specific Bx-snfs could be developed as a species-specific biocontrol strategy.

Conclusion

In summary, this study systematically characterizes 18 SNF family members in B. xylophilus. These genes exhibit remarkable structural diversity, uneven chromosomal distribution, and lineage-specific evolutionary relationships with other plant-parasitic nematodes. Stage-specific expression profiles reveal their involvement in embryogenesis, male reproduction, larval development, and dauer-stage stress adaptation. The high divergence of BxSNFs from host and non-target organisms, together with their central roles in neurotransmission, positions them as promising targets for species-specific, environmentally friendly control strategies using small-molecule inhibitors or RNA interference. Collectively, these findings advance our understanding of neural regulation in parasitic adaptation and provide a theoretical basis for sustainable management of pine wilt disease.

Authors’ contributions

Conceptualization, X.H. and J.C.; methodology, N.P.; software, H.L. and S.W.; validation, H.L., W.L. and J.C.; formal analysis, H.L.; investigation, N.P. and S.W.; resources, J.C.; data curation, H.L and C.H.; writing—original draft preparation, H.L and C.H.; writing—review and editing, X.H. and J.C.; visualization, W.L. and J.C.; supervision, J.C. and S.W.; project administration, J.C.; funding acquisition, J.C. All authors have read and agreed to the published version of the manuscript.

Funding

The study supported by Yunnan Fundamental Research Projects (202401BD070001-115); Youth Talents Special Project of Yunnan Province; Key Laboratory of National Forestry and Grassland Administration on Prevention and Control Technology of Pine Wilt Disease (202501); Southwest Forestry University Forestry major in Yunnan Province First-Class Construction Discipline (LXXK-2023M06, LXXK-2024Z04).

Data availability

The protein and DNA sequences generated in this study have been deposited in the NCBI repository (https://www.ncbi.nlm.nih.gov/genbank/). The data are available in the GenBank accession under accession number PZ388352-PZ388369.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.