Abstract
African swine fever (ASFV) leads a highly contagious and lethal hemorrhagic disease, causing a huge economic loss to the global pig industry. Recently, lethal genotype I/II recombinants were isolated and characterized in China and Vietnam. To differentiate the three genotypes (I, II and I/II recombinants) of ASFV in China, a triplex quantitative PCR (qPCR) assay was developed by targeting B646L, A151R and MGF360-14L genes. The detection limitation for the A151R, MGF360-14L, and B646L genes were 10 copies/μl, demonstrating a high sensitivity. Meanwhile, no cross-reactivity was observed with nucleic acids from ASFV genotype I and II or other swine viruses, confirming a high specificity for this assay. The coefficient of assay variation was below 2%, indicating an excellent repeatability. Importantly, when piglets were challenged with ASFV genotype I/II recombinant virus, the method could be used to detect the virus shedding as early as 3 dpi. In summary, a highly sensitive and specific detection method was established, which holds significant potential for rapid diagnosis and early warning of ASFV genotype I/II recombinant infection.
Keywords: African swine fever virus, Genotype I, Genotype II, Genotype I/II recombinant, real-time quantitative PCR
Introduction
African swine fever (ASF) is a highly contagious and acute disease caused by the African swine fever virus (ASFV), classified as a reportable animal disease by the World Organization for Animal Health [1]. ASFV is an icosahedral enveloped DNA virus with a total length of 170–190 kb for its genome, containing 151–167 open reading frames [2]. Based on the variations in C-terminus of the B646L gene (encoding p72 capsid protein), ASFV in Africa is classified into at least 24 genotypes [3, 4].
In 2018, ASF was firstly reported in China, which was caused by a high virulent genotype II Georgia07-like strain [5]. In 2021, an attenuated genotype I ASFV strain was isolated that exhibited a high transmission efficiency and a propensity for asymptomatic infections [6]. Subsequently, three natural recombinant strains derived from genotypes I and II ASFV were identified, exhibiting increased virulence, elevated lethality rates, and accelerated transmission kinetics [7]. The recombinant virus integrates genetic characteristics of both genotype I and genotype II. Pigs infected with this recombinant strain exhibit accelerated disease progression, with an average incubation period of only 3 days. High fever occurs as early as 2.6 days post infection, and all infected animals die within 5–7 days [8]. Notably, attenuated vaccines derived from genotype II parental strains fail to provide effective protection against virulent genotype I/II recombinant ASFV strains [9]. Therefore, accurate identification of emerging ASFV variants and clarification of pathobiological features in pigs infected with genotype I/II recombinants are crucial for targeted prevention and comprehensive epidemic control.
China's current control strategy of ASFV relies predominantly on real-time quantitative PCR (qPCR) for early detection and culling of infected individual from herds to prevent further spreading [10]. Although qPCR targeting the B646L gene is the main method for ASFV detection, its utility in ASFV genotype differentiation is severely constrained by the exceptionally high sequence conservation (> 98%) of this gene across diverse viral isolates [11, 12]. To date, for the detection of genotypes I and II ASFV in the field, several multiplex qPCR based on the E296R, B646L, and/or E183L genes have been reported [13–15]. Moreover, triplex qPCR methods based on B646L/F1055L/E183L or X64R/MGF360-14L/B646L genes were developed for detection and rapid differentiation [15, 16]. Although the highly virulent genotype II ASFV is still the dominant strain in China, the prevalence of highly virulent genotype I/II recombinant ASFV is gradually increasing, which highlights significant limitations for current diagnostic approaches [7]. Given the escalating genetic diversity observed in field, it highlights the urgent need to develop molecular assays capable for rapid and accurate strain identification of genotype I/II.
In this study, we developed a triplex quantitative PCR (qPCR) assay for detection and genotyping of ASFV simultaneously. The assay integrates CAHEC-recommended B646L primers and probes, genotype II-specific targets amplifying conserved regions of MGF360-14L gene and genotype I-discriminatory probes targeting unique sequences of A151R gene. This method enables differentiation of genotype I, genotype II, and genotype I/II recombinants through distinct fluorescent channels, providing a powerful tool for rapid diagnosis and epidemiological surveillance of ASFV.
Materials and methods
Viruses and Viral nucleic acids
Genotype II strain GZ201801 (ASFV-GZ) and Genotype I/II recombinant strain ASFV-HN10005 (ASFV-HN) were isolated and provided by the National African Swine Fever Regional Laboratory at South China Agricultural University. The viruses were permitted and transferred to Spirit Jinyu Biopharmaceutical Co., Ltd. ASFV-GZ, ASFV-HN and ASFV-A29 (the low-virulence genotype I strain) were propagated in primary bone marrow-derived macrophages (BMDMs) for virus amplification. Viral titers (TCID50 and HAD50) were subsequently determined using primary porcine alveolar macrophages (PAMs) and calculated according to the Reed-Muench method [17]. The genomic DNA of genotype I attenuated NH/P68-like strain ACDC-29 (ASFV-A29) was provided by China Animal Disease Control Centre. Porcine reproductive and respiratory syndrome virus (PRRSV), Classical swine fever virus (CSFV), Japanese encephalitis virus (JEV), Porcine pseudorabies virus (PRV), Porcine adenovirus serotype 4 (PADV-4) and Porcine epidemic diarrhea virus (PEDV) positive samples were preserved by the Shanghai Veterinary Research Institute, the Chinese Academy of Agricultural Sciences.
Design of primers and probes
Genome sequence analysis revealed that there were differences for A151R gene between ASFV genotype I, ASFV genotype II or ASFV genotype I/II recombinants via SnapGene 6.0.2. The location of the primers and probes were indicated in Fig. 1A. On the basis of comparison result of A151R gene of ASFV genotype I, genotype II and I/II recombinant viruses, MGF360-14L gene (which from genotype II and I/II recombinant), primers and probes were designed via PrimerQuest Tool shown in Fig. 1B. For B646L gene, primers and probes were recommended by China Animal Health and Epidemiology Center (CAHEC). The three probes for the A151R, MGF360-14L and B646L genes were labeled with ROX, CY5 and FAM, respectively. All primers and probes were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
Fig. 1.
The location of the primers and probes designed for the triplex PCR. The nucleotide sequence alignments of A151R gene (A), the partial MGF360-14L gene (B) of ASFV and B646L gene (C) show the location of the primers and probes. F, P and R indicate the forward primer, TaqMan probe, and reverse primer, respectively
Construction of the standard plasmids
A151R gene from ASFV genotype I attenuated NH/P68 strain was synthesized and subcloned into pUC57 plasmid named as pUC-A151R by GenScript Biotechnology Co., LTD. MGF360-14L and B646L genes from ASFV genotype II virulent strain GZ201801 were subcloned into p3 × Flag-CMV-7.1 plasmid, designated respectively as pFlag-14L and pFlag-B646L, which were preserved by our lab. The standard plasmid constructs were double-confirmed by Sanger sequence analysis.
Development and optimization of triplex qPCR assay
The reaction conditions, including the primers and probes concentration and cycling conditions, were optimized for triplex qPCR assay. Three primer concentration gradients (0.4, 0.5, 0.6 µM) were designed with the probe concentration fixed at 0.1 µM and the annealing temperature maintained at 60 ºC. After determining the optimal primer concentration, the probe concentration was further optimized using three gradients (0.1, 0.15, 0.2 µM). Subsequently, the annealing temperature was adjusted according to the optimal primer—probe concentration, with settings of 58 ºC, 60 ºC, and 62 ºC. The working concentration for both primers and probes was maintained at 10 µM, and each experiment was conducted in triplicate.
Standard curve generation
The standard plasmid constructs were measured using NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.) at 260 nm and 280 nm, and determined their concentrations using the formula as follows: copy number (copies/μl) = (plasmid construct concentration × 10−9 × 6.02 × 1023)/(660 Dalton/bases × DNA length). Three standard plasmid constructs of pUC-A151R, pFlag-MGF360-14L, and pFlag-B646L were mixed as templates at the concentration of 1 × 108 copies/μl for each plasmid. Real-time quantitative PCR was performed from 1 × 108 to 1 × 102 copies/μl. Three replicates were performed for each dilution, and the standard curve was generated using the logarithm of the starting template concentration and the Ct value as the horizontal and vertical coordinates.
Determination of specificity of the assay
The total nucleic acids of PRRSV, CSFV, JEV, PRV, PADV, PEDV, ASFV-A29, ASFV-GZ and ASFV-HN were extracted from positive clinical samples using Blood/cell/tissue genomic DNA extraction kit and viral genomic DNA/RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., LTD.) according to the manufacturer's constructions, and stored at −80 °C until use. The DNA/cDNA of PRRSV, CSFV, JEV, PRV, PADV, PEDV and ASFV was used as templates to analyze the specificity of the assay.
Determination of sensitivity of the assay
To evaluate the sensitivity of the method, the plasmids of pUC-A151R, pFlag-MGF360-14L, and pFlag-B646L were mixed and then tenfold serially diluted from 1 × 108 to 1 × 100 copies/μl as templates. To access the limit of detection (LOD), the genomic DNAs of ASFV-A29 (genotype I), ASFV-GZ (genotype II), ASFV-HN (genotype I/II recombinant) were extracted and used as templates. Serial dilutions were performed at the following dilutions with 10, 100, 1000, 10 000, 100 000 and 1000 000-fold.
To evaluate the detection sensitivity of the established assay for ASFV in different sample matrices, the base matric of anal swabs and blood confirmed to be ASFV-negative was added with gradient-diluted ASFV-HN virus. Serial dilutions were performed, and the final titer were 104, 103, 102, 101, 10–1 and 10–2 TCID50/ml. After DNA extraction and amplification, the optimized triplex qPCR system established in this study was utilized to determine the limit of detection (LOD).
Determination of repeatability of the assay
To assess the repeatability of the triplex qPCR assay, the mixtures of three plasmid pUC-A151R, pFlag-MGF360-14L and pFlag-B646L at the concentrations from 1.0 × 108 to 1.0 × 103 copies/μl were used as templates. For intra-assay variation, each dilution was tested in triplicate, and the coefficients of variation (CVs) were determined.
Detection of virus shedding in piglets
Six piglets (body weight 15–20 kg) were employed for the viral inoculation study. These animals were procured from a local commercial farm adhering to high biosecurity standards with valid production and operation licenses, and subsequently housed in Animal Biosafety Level 3 (ABSL-3) facilities at Spirit Jinyu Biopharmaceutical Co., Ltd.
The established triplex qPCR assay was used to detect virus shedding in piglets challenged with ASFV genotype I/II recombinants. The clinical samples were collected from the piglets challenged intramuscularly with 103.0 HAD50 of ASFV-HN, including heparin-anticoagulated whole blood, oral swabs, nasal swabs, and anal swabs at 0, 3, 5, 7, 10, and 14 days post-infection (dpi). When the piglets became moribund at 14 dpi, they were anesthetized by Xylazine hydrochloride injection (5 mL each) intramuscularly, followed by blood collection. All piglets subsequently died at 14 dpi with classical ASFV symptoms. The swabs were resuspended in 1 ml PBS containing 1% Penicillin and Streptomycin and centrifuged at 8000 × g and 4 °C for 4 min. Blood was collected with EDTA as an anticoagulant and mixed thoroughly. The DNA of each sample was extracted via the TIANamp virus DNA/RNA kit and TIANamp Genomic DNA kit (Blood/Cell/Tissue Genomic DNA) and tested by the triplex qPCR assay. Results were analyzed using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA).
Statistical analysis
Statistical analysis was performed using GraphPad Prism 10 software. A value of P < 0.05 was considered statistically significant. Intergroup comparisons were performed using an unpaired two-tailed Student's t-test, with significance levels denoted as *P < 0.05 and ** P < 0.01.
Results
Design of primers and probes for the triplex qPCR assay
According to the genetic variation in A151R gene from different genotypes, the primer and probe were designed at the unique region of genotype I and I/II recombinants, which was shown in Fig. 1A. The MGF360-14L gene is present exclusively in ASFV genotype II or genotype I/II recombinant, whereas is absent in ASFV genotype I. The specific primers and probe were chosen to target the conserved regions of MGF360-14L gene. For the B646L gene, the primers and probes were the same as those specified as previous studies (Table 1). The three probes for the A151R, B646L and MGF360-14L genes were labeled with ROX, FAM and CY5 fluorophores, respectively.
Table 1.
The designed primers and probes
| Name | Sequence (5' → 3') | Product (bp) |
|---|---|---|
| A151R-24F | AAAGCTTATAGAGTGCATCGAA | 117 |
| A151R-46P | ROX-AATGAGGTGCTTAGCGGTGGTACA-BHQ2 | |
| A151R-140R | CAGATCATGATTGGCATTAAAGG | |
| M14L-453F | CCCGCCAATAGAGGTGATTT | 89 |
| M14L-516P | CY5-TTTGGTTTGCCCTGGCATTACGAC-BHQ2 | |
| M14L-541R | GCGCACCACCTATTAACAAAG | |
| B646L-1520F | GCTTTCAGGATAGAGATACAGCTCT | 181 |
| B646L-1622P | FAM-CCGTAACTGCTCATGGTATCAATCTTATCG-BHQ1 | |
| B646L-1677R | CCGTAGTGGAAGGGTATGTAAGAG |
Optimization of the triple qPCR system
The concentrations of the three standard plasmid constructs named pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L were determined to be 0.63 × 109, 2.88 × 109, and 1.24 × 1010 copies/μl (original concentration), respectively. The three standard plasmid constructs were diluted to 1 × 108,1 × 109 and 1 × 109 copies/μl, and stored at − 80 °C until used.
To optimize the amplification conditions, three different concentrations of plasmid mixture (1 × 105, 1 × 106 and 1 × 107 copies/μl) were used as templates to evaluate the optimal primer concentration, probe concentration, and annealing temperature.
Three primer concentration gradients (0.4, 0.5, 0.6 µM) were designed with the probe concentration fixed at 0.1 µM and the annealing temperature maintained at 60℃. After determining the optimal primer concentration, the probe concentration was further optimized using three gradients (0.1, 0.15, 0.2 µM).
Subsequently, the annealing temperature was adjusted according to the optimal primer–probe concentration, with settings of 58℃, 60℃, and 62℃.The working concentration for both primers and probes was maintained at 10 µM, and each experiment was conducted in triplicate.
As shown in Table 2, the most suitable concentrations for the primers and probes were determined to be 0.25 µM and 0.2 µM, respectively. The optimal annealing temperature was identified as 60℃.
Table 2.
Results the optimization of the reaction system conditions
| Project | Parameter | Ct average value | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 105 copies/μL | 106 copies/μL | 107 copies/μL | ||||||||
| B646L | A151R | M14L | B646L | A151R | M14L | B646L | A151R | M14L | ||
| Primer concentration | 0.2 µM | 23.109 | 21.765 | 21.494 | 19.456 | 18.393 | 18.117 | 15.587 | 14.176 | 14.003 |
| 0.25 µM | 23.063 | 21.732 | 20.682 | 19.292 | 18.634 | 16.087 | 15.783 | 14.229 | 13.499 | |
| 0.3 µM | 23.139 | 21.669 | 21.668 | 19.495 | 18.399 | 17.290 | 15.660 | 14.268 | 13.917 | |
| Probe concentration | 0.1 µM | 25.895 | 25.033 | 26.677 | 21.772 | 21.285 | 22.633 | 18.639 | 17.958 | 19.481 |
| 0.15 µM | 24.813 | 24.520 | 26.012 | 21.514 | 21.256 | 22.515 | 18.460 | 17.896 | 19.234 | |
| 0.2 µM | 24.644 | 24.112 | 25.619 | 20.958 | 20.740 | 21.819 | 18.033 | 17.460 | 18.735 | |
| Annealing temperatue | 58℃ | 25.045 | 24.506 | 25.713 | 21.504 | 21.086 | 22.202 | 18.022 | 17.907 | 18.854 |
| 60℃ | 24.853 | 24.277 | 25.577 | 21.071 | 20.909 | 22.022 | 18.057 | 17.806 | 18.710 | |
| 62℃ | 25.137 | 24.638 | 26.053 | 21.270 | 21.101 | 22.372 | 18.040 | 17.715 | 18.967 | |
The dilutions of 105 copies/μl, 106 copies/μl, and 107 copies/μl were the concentration of plasmid mixture
To maximize the assay sensitivity and specificity, the concentrations of the probes and primers were further fine-tuned under the optimized reaction conditions. The final optimized system components were as follows: the reaction system volume was 20 μl: 10 μl of TOROIVD®5G qPCR Premix with UNG (TOROIVD, China), 0.5 μl of each primer (10 μmol/l), 0.2 μl of probe B646L and A151R (10 μmol/l), and 0.3 μl of probe MGF360-14L(10 μmol/l), 2 μl of template DNA, and 4.3 μl of ddH2O. Triplex qPCR was performed with Applied Biosystems QS5 Fluorescence Quantitative PCR Instrument. The reaction conditions were below: 37 °C for 2 min, 95 °C for 3 min, followed by 45 cycles of 95 °C for 10 s and 60 °C for 30 s.
Construction of the standard control plasmids
The plasmids pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L at the concentrations from 1 × 108 to 1 × 102 copies/μl were used as templates, and singleplex qPCR was performed. Then the mixed plasmids at the concentration from 1 × 108 to 1 × 102 copies/μl were used as templates to triplex qPCR. The standard curves are shown in Fig. 2. The slopes and correlation coefficients (R2) were −3.6286 and 0.9981 for A151R gene; −3.5694 and 0.9972 for MGF360-14L gene; −3.5822 and 0.9961 for B646L gene.
Fig. 2.
Generation of the standard curves. A The amplification curves based on the standard pUC-A151R plasmid, B pFlag-B646L, C pFlag-MGF360-14L, D standard curves of the triplex qPCR method
Specificity analysis
The nucleic acids extracted from ASFV-A29 (ASFV genotypes I), ASFV-GZ (genotypes II), ASFV-HN (I/II recombinant), PRRSV, CSFV, JEV, PRV, PADV-4, PEDV and the mixed plasmids (pFlag-B646L, pUC-A151R, and pFlag-MGF360-14L) were used as templates for amplification. The results showed that there were positive amplification curves only for ASFV genomic DNAs and the mixed plasmids (Fig. 3A, labelled with 1a, 1b, 1c), while no amplification curve was obtained from the other porcine viruses and the negative control (Fig. 3A, labelled with 2 to 7).The positive amplifications were presented as follows: A151R and B646L for ASFV genotype I viruses (Fig. 3B), B646L and MGF360-14L for ASFV genotype II (Fig. 3C), A151R, B646L and MGF360-14L gene for ASFV genotype I/II recombinant (Fig. 3D) and the mixed plasmids (Fig. 3A).
Fig. 3.
Specificity analysis of the triplex qPCR assay. A Compared to the results of PRRSV, CSFV, JEV, PRV, PADV, PEDV genomes, the amplification curve of the mixed plasmids of pUC-A151R, pFlag-B646L and pFlag-MGF360-14L. 1a: pASFV-A151R, 1b: pASFV-MGF360-14L, 1c: pASFV-B646L, 2–7: PRRSV, CSFV, JEV, PRV, PADV, and PEDV, respectively. B Amplification curve of genotype I NH/P68-like strain ASFV-A29, C Amplification curve of genotype II strain ASFV-GZ, D Amplification curve of genotype I/II recombinant strain ASFV-HN. Note: The red amplification curves corresponding to B646L gene, the blue amplification curves representing A151R gene, the green amplification curves based on MGF360-14L gene
Sensitivity analysis
The mixed plasmids of pUC-A151R, pFlag-MGF360-14L and pFlag-B646L were used as templates and were diluted at a multiple ratio of 1 × 108 ~ 1 × 100 copies/μl. The triplex qPCR showed that the minimum detection limit of A151R, MGF360-14L was 10 copies/μl,and B646L 100 copies/μl(Fig. 4).
Fig. 4.
Sensitivity analysis of the triplex qPCR assay for standard plasmids. The concentrations of the standard plasmid constructs pUC-A151R A, pFlag-B646L B, pFlag-MGF360-14L (C), which were ranged from 1 × 108 to 1 × 100 copies/μl (from line 1 to line 9); Line 10 represents negative control
To access the LOD, the genomic DNAs were extracted from cell culture supernatants following in vitro amplification in BMDMs. By titration, the titer of genotype I ASFV-A29 virus was 106.667 TCID50/ml, and the titer of genotype II ASFV-GZ or genotype I/II recombinant strain ASFV-HN was 107 TCID50/ml. The genomic DNAs of the viruses were extracted from the culture supernatants of infected cells (BMDMs) and determined by the triplex qPCR method established in this study. The results showed that the assay could be used to differentiate the three genotypes (Fig. 5 A, B), and the LOD of ASFV-HN virus was as below as 102 TCID50/ml (Fig. 5C).
Fig. 5.
Sensitivity analysis of the triplex qPCR assay based on ASFV genotypes. A Amplification curve of genotype I NH/P68-like strain ASFV-A29; B Amplification curve of genotype II strain ASFV-GZ; C Amplification curve of genotype I/II recombinant strain ASFV-HN with a serial dilution ranging from 106 TCID50 to 10.1 TCID50
The base matrices of anal swabs and blood samples were added with gradient-diluted ASFV-HN virus, and the final titer were 104, 103, 102, 101, 100 TCID50/ml. After DNA extraction and amplification using the optimized triplex qPCR system established in this study, the results showed that the established triplex qPCR could stably detect 102 TCID50/mL of ASFV in the anal swab matrix (Fig. 6A, B, C), while 10 TCID50/mL of ASFV in the whole blood matrix (Fig. 6 D,E,F), which was higher than the detection sensitivity in the anal swab matrix. This indicated that the established triplex qPCR method maintained good detection performance in common ASFV clinical sample matrices, and would not cause significant sensitivity degradation due to the complex background of whole blood, meeting the requirements for clinical sample detection.
Fig. 6.
Sensitivity analysis of the triplex qPCR assay in different sample matrices (anal swab and blood) (A-C) Amplification curve of recombinant ASFV-HN (genotype I/II) in anal swab samples, with viral loads ranging from 104 TCID50/ml to 100 TCID50/ml. (D-F) Amplification curve of recombinant ASFV-HN (genotype I/II) in blood samples, with viral loads ranging from 104 TCID50/ml to 100 TCID50/ml
Repeatability analysis
The mixed plasmids with a dilution ratio of 1.0 × 108 ~ 1.0 × 103 copies/μl were used as the template for repeatability test. The coefficient of variation was calculated according to the Ct values of qPCR with different concentrations. The inter-assay CVs ranged from 0.152% to 0.666% for the A151R gene (ROX), 0.231%−1.969% for the B646L gene, 0.454%−1.226% for the MGF360-14L gene (CY5). These results showed the CVs of the triplex was 0.152% ~ 1.969% (Table 3), which was less than 2%. It was proved that the method demonstrated high repeatability.
Table 3.
Repeatability analysis of triplex qPCR
|
Concentration (copies/μl) |
Gene | Ct value | SD | CV (%) | |||
|---|---|---|---|---|---|---|---|
| Ct1 | Ct2 | Ct3 | Mean Ct | ||||
| 1.0 × 103 | A151R | 30.917 | 30.795 | 30.965 | 30.892 | 0.072 | 0.231 |
| B646L | 31.946 | 31.773 | 31.438 | 31.719 | 0.211 | 0.666 | |
| MGF360-14L | 33.406 | 32.580 | 33.064 | 33.017 | 0.339 | 1.026 | |
| 1.0 × 104 | A151R | 28.511 | 28.261 | 28.062 | 28.278 | 0.184 | 0.649 |
| B646L | 28.675 | 28.721 | 28.434 | 28.610 | 0.126 | 0.440 | |
| MGF360-14L | 30.535 | 30.277 | 29.972 | 30.261 | 0.230 | 0.760 | |
| 1.0 × 105 | A151R | 23.412 | 22.917 | 23.322 | 23.217 | 0.215 | 0.927 |
| B646L | 23.624 | 23.674 | 23.711 | 23.669 | 0.036 | 0.152 | |
| MGF360-14L | 24.875 | 24.512 | 24.727 | 24.705 | 0.149 | 0.603 | |
| 1.0 × 106 | A151R | 20.012 | 19.807 | 19.963 | 19.927 | 0.087 | 0.438 |
| B646L | 20.469 | 20.467 | 20.589 | 20.509 | 0.057 | 0.278 | |
| MGF360-14L | 21.538 | 21.370 | 21.668 | 21.525 | 0.122 | 0.567 | |
| 1.0 × 107 | A151R | 16.736 | 16.588 | 16.888 | 16.737 | 0.122 | 0.731 |
| B646L | 17.174 | 17.172 | 17.333 | 17.226 | 0.076 | 0.440 | |
| MGF360-14L | 18.254 | 18.137 | 18.339 | 18.243 | 0.083 | 0.454 | |
| 1.0 × 108 | A151R | 13.744 | 13.458 | 14.120 | 13.774 | 0.271 | 1.969 |
| B646L | 14.077 | 13.957 | 14.059 | 14.031 | 0.053 | 0.377 | |
| MGF360-14L | 15.393 | 14.977 | 15.350 | 15.240 | 0.187 | 1.226 | |
Detection of virus shedding using the triplex qPCR assay
The established triplex qPCR was used to test the blood, oral swabs, nasal swabs, and anal swabs from experimental piglets inoculated intramuscularly with 103.0 HAD50 of ASFV-HN virus. All the piglets died in 14 dpi with classical symptoms of ASFV. samples were serially collected and tested by the triplex qPCR assay. The results showed viral nucleic acids were first detected in blood at 3 dpi as low as 10.42 copies/μl (for A151R), 225.94 copies/μl (for MGF360-14L) and 13.09 copies/μl (for B646L). At 5 dpi, the viremia increased 780.07 folds (A151R), 230.68 folds (MGF360-14L) and 835.72 folds (B646L) compared to those at 3 dpi (p < 0.01). At 10 dpi, the viremia increased up to 105.76 copies/μl (A151R), 106.61 copies/μl, (MGF360-14L), and 105.85 (B646L) copies/μl. Comparison of the sensitivity of different samples, taking A151R gene as example, the positive detection from blood samples were 3 dpi, but the oral, nasal and anal swab specimens were positive at 7dpi later. The virus copies from the oral swab samples were 18,390 folds less than those in blood samples (P < 0.01). Compared with MGF360-14L and B646L genes, it showed that no detectable values of A151R genes were found from the oral/nasal/anal swab specimens at 5dpi. After that, it showed that the infection with ASFV-HN resulted in persistent viral shedding, with viral load progressively increasing over the course of infection (Fig. 7).
Fig. 7.
Detection of virus shedding by the triplex qPCR assay. Virus copies of blood, oral, nasal, and anal samples were calculated at 3, 5, 7, 10 and 14 dpi based on B646L gene (A), MGF360-14L gene (B) and A151R gene (C)
Discussion
Since the initial outbreak of ASF in China in 2018, it has severely undermined the development of the nation's swine industry [18–20]. Currently, there are still no commercially available vaccines and antiviral drugs for clinical application [21, 22]. The prevention and control of ASFV primarily depend on the rapid detection and culling of infected pigs and those in contact with the virus, which exerts a substantial influence on China's swine industry [10, 23]. With the emergence of genotype I and genotype I/II recombinants, the complexity of diagnosis has been further exacerbated [7]. There is an urgent need for a detection method capable of rapidly identifying genotype I, genotype II, and genotype I/II recombinant viruses to facilitate the early detection of ASF and achieve precise prevention and control of ASFV.
Several multiplex qPCR assays have been established to differentiate ASFV genotype I and II viruses [13–16, 24, 25]. The previous assay was used the primers and probes based on the X64R/MGF360-14L/B646L gene clusters with a sensitivity of 10 copies/reaction [16]. However, X64R gene seems be located in regions with very high genetic diversity, which was associated with antigenic drift [26, 27]. Additionally, E296R gene was also chosen for differentiation of genotypes I and II ASFV with a sensitivity of 10 copies/μl [14]. Another differentiation method based on B646L gene of genotypes I and II, or the E183L gene of genotype I ASFV, demonstrated a the sensitivity of about 1.07 × 102 and 3.13 × 104 copies/μl for genotype I and genotype II, respectively [25]. Especially, in another assay based on B646L/F1055L/E183L targets, the result showed that this assay had a sensitivity of 5.120, 4.218, 4.588 copies/reaction for B646L, F1055L, and E183L gene [15]. Therefore, an assay with improved sensitivity for accurate differentiation of genotype I and genotype II ASFV as well as genotype I/II recombinants was required.
In this study, specific primers and probes were designed based on the unique region of the genotype I A151R gene and genotype II MGF360-14L gene of ASFV. These were combined with the B646L primers and probe recommended by China Animal Health and Epidemiology Center, establishing a TaqMan probe triplex real-time quantitative PCR method. Compared to X64R, A151R, a non-structural protein of ASFV, is stable expressed during both early and late phases of viral infection and is implicated in critical stages of viral replication and assembly [28]. MGF360-14L, a member of the multifunctional multigene family (MGF360), has been demonstrated to play significant role in viral replication dynamics, immune evasion strategies, and pathogenic manifestations of ASFV [29, 30]. The B646L gene, encoding the structurally essential capsid protein p72, exhibits high sequence conservation across ASFV genotypes and has been designated by WOAH as the primary target for molecular diagnostics of ASFV [31]. The minimum detection limits for the A151R, B646L and MGF360-14L genes were 10 copies indicating a high sensitivity for detecting ASFV. The method specifically amplifies ASFV, does not cross-react with PRRSV, CSFV, JEV, PRV, PADV-4, or PEDV, demonstrating good specificity; the coefficient of variation was less than 2%, and repeatability was good. Positive nucleic acid samples can be effectively identified. Our assay resulted in similar sensitivity to the assays established previously. Importantly, when the piglets were challenged with ASFV genotype I/II recombinant virus, the method could be used to detect the virus shedding as early as 3 dpi.
In conclusion, a triplex quantitative PCR method established in this study was highly specific, sensitive, reproducible, which can assist in the rapid differential diagnosis and early detection of ASFV genotype I/II recombinant virus infection in the future. A limitation of this marker-dependent assay is its inability to detect 'marker-shed' recombinants that retain genotype I-specific A151R but lose the MGF360-14L region. In regions with documented recombinant circulation, atypical genotype I detections—particularly those associated with unusual virulence or epidemiological patterns inconsistent with classical genotype I behavior—should prompt confirmatory whole-genome sequencing to exclude cryptic recombination or genomic deletions.
Acknowledgements
We especially thank Mr. Chongyu Zhang, Dr. Li Jie, Dr. Dongdong Di and Ms. Jing Zhang for their kind assistance.
Authors’ contributions
WC, HC and SZ conceived and designed the experiments. SZ, GJ, and L. Yao performed the experiments and analyzed the data. L. Ying, ST and NY contributed reagents/materials/analysis tools. SZ, LJ, WC, and HC wrote the paper. All authors contributed to the article and approved the submitted version.
Funding
This study was supported by the National Natural Science Foundation of China (32570161, 32400124), the National Key Research and Development Program of China (2023YFD1802600, 2022YFD1800500, 2021YFD1800100), and the Chinese Universities Scientific Fund (1051-15055008, 1051-15055010, 1051-00115331).
Data availability
All data generated or analyzed during this study are included in this published article.
Declarations
Ethics approval and consent to participate
The animal experiments were approved by the Animal Ethics Committee of Spirit Jinyu Company(ethics number:JY/ABSL3/IV/A/416/A24010710). Piglets about 15 − 20 kg were purchased from a local farm with high biosecurity standard and hygiene,which possessing a production and operation license.
Animal experiments and ASFV infection were performed at the Animal Biosafety Level 3 (ABSL-3) facilities of Spirit Jinyu Biological Pharmaceutical Co., Ltd. In addition to the China National Accreditation Service for Conformity Assessment (CNAS) (license number: CNAS-BL0101), these experiments have also been recognized by the Ministry of Agriculture and Rural Affairs.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Hongjun Chen, Email: vetchj@cau.edu.cn.
Chunyan Wu, Email: chunyanwu@nwsuaf.edu.cn.
References
- 1.https://www.woah.org/en/?s=&_search=ASF
- 2.Galindo I, Alonso C. African Swine Fever Virus: a review. Viruses. 2017;9(5):103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Qu H, Ge S, Zhang Y, Wu X, Wang Z. A systematic review of genotypes and serogroups of African Swine Fever Virus. Virus Genes. 2022;58:77–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.O’Donnell V, Spinard E, Xu L, Berninger A, Barrette RW, Gladue DP, et al. Full-length ASFV B646L gene sequencing by Nanopore offers a simple and rapid approach for identifying ASFV genotypes. Viruses. 2024;16(10):1522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zhao D, Liu R, Zhang X, Li F, Wang J, Zhang J, et al. Replication and virulence in pigs of the first African Swine Fever Virus isolated in China. Emerg Microbes Infect. 2019;8(1):438–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Sun E, Zhang Z, Wang Z, He X, Zhang X, Wang L, et al. Emergence and prevalence of naturally occurring lower virulent African Swine Fever Viruses in domestic pigs in China in 2020. Sci China Life Sci. 2021;64(5):752–65. [DOI] [PubMed] [Google Scholar]
- 7.Zhao D, Sun E, Huang L, Ding L, Zhu Y, Zhang J, et al. Highly lethal genotype I and II recombinant African Swine Fever Viruses detected in pigs. Nat Commun. 2023;14(1):3096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hu Suk Lee, Byungkwan Oh , Vuong Nghia Bui c, Duy Tung Dao, Ngoc Anh Bui, Su-Beom Chae, Minh Duc Nguyen Do, Mai Trang Tran, Quy Duy Nguyen , Young-Sik Kim,et al: Pathogenicity and pathobiological characterization of a recombinant genotype I/II African swine fever virus in pigs.Virulence. 2025,16(1):2580123. [DOI] [PMC free article] [PubMed]
- 9.Yao Li, Yingnan Liu, Zhuyun Sun , Zhenhua Xie , Chuanwen Tian, Rongrong Wang, Jun Gao, Maomao Wang , Jingyi Liu ,Heng Wang et al:The deletion of the EP402R and MGF505/360 genes attenuates a genotype I/II recombinant ASFV but fails to confer complete protection against homologous or genotype II challenge in pigs.Emerging Microbes & Infections. 2026;15:2608396. [DOI] [PMC free article] [PubMed]
- 10.Du X, Liu Y, Duan L, Tsai S-Y, Yaros JP, Wu F. Elimination of ASFV via precise culling in a large-scale breeding herd in China: a field experience. Animals. 2025;15(17):2521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.M.Yu CJM, Westbury HA: Strong sequence conservation of African swine fever virus p72 protein provides the molecular basis for its antigenic stability. Arch Virol. 1996;141:1795–1802. [DOI] [PubMed]
- 12.Wang Y, Kang W, Yang W, Zhang J, Li D, Zheng H. Structure of African Swine Fever Virus and associated molecular mechanisms underlying infection and immunosuppression: a review. Front Immunol. 2021;12:715582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Hu Z, Lai R, Tian X, Guan R, Li X. A duplex fluorescent quantitative PCR assay to distinguish the genotype I, II and I/II recombinant strains of African Swine Fever Virus in China. Front Vet Sci. 2024;11:1422757. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Li X, Hu Y, Liu P, Zhu Z, Liu P, Chen C, et al. Development and application of a duplex real-time PCR assay for differentiation of genotypes I and II African Swine Fever Viruses. Transbound Emerg Dis. 2022;69(5):9. [DOI] [PubMed] [Google Scholar]
- 15.Shi K, Qian X, Shi Y, Wei H, Pan Y, Long F, et al. A triplex crystal digital PCR for the detection of genotypes I and II African Swine Fever Virus. Front Vet Sci. 2024;11:1351596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ding L, Ren T, Bing G, Wang Z, Wang B, Ni J, et al. Establishment of a triplex qPCR assay for differentiating highly virulent genotype I recombinant virus from low‐virulence genotype I and genotype II African Swine Fever Viruses circulating in China. Transbound Emerg Dis. 2024;2024(1):6206857. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.L.J.Reed, Muench. H: A simple method of estimating fifty percent endpoints. Am J Hygiene. 1938;27(3):5.
- 18.You S, Liu T, Zhang M, Zhao X, Dong Y, Wu B, et al. African Swine Fever outbreaks in China led to gross domestic product and economic losses. Nat Food. 2021;2(10):802–8. [DOI] [PubMed] [Google Scholar]
- 19.Zhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, et al. Emergence of African Swine Fever in China, 2018. Transbound Emerg Dis. 2018;65(6):1482–4. [DOI] [PubMed] [Google Scholar]
- 20.Salling M. Assessing the price effects of African Swine Fever in the China market. Explor Foods Foodomics. 2025;2025(3):101064. [Google Scholar]
- 21.Sun AJ, Wang R, Zhu XJ, Meng ZK, Liu SY, Zhang S, et al. Review on African Swine Fever⁃associated detection and pig farm biosecurity control measurement development. Chin J Vet Sci. 2021;41(5):1023–30. [Google Scholar]
- 22.Urbano AC, Ferreira F. African Swine Fever control and prevention: an update on vaccine development. Emerg Microbes Infect. 2022;11(1):2021–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Danzetta ML, Marenzoni ML, Iannetti S, Tizzani P, Calistri P, Feliziani F. African Swine Fever: lessons to learn from past eradication experiences. A systematic review. Front Vet Sci. 2020;7:296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hwang HJ, Choi YS, Song K, Frant M, Kim JH. Development and validation of a fast quantitative real-time PCR assay for the detection of African Swine Fever Virus. Front Vet Sci. 2022;9:1037728. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gao Q, Feng Y, Yang Y, Luo Y, Gong T, Wang H, et al. Establishment of a dual real-time PCR assay for the identification of African Swine Fever Virus genotypes I and II in China. Front Vet Sci. 2022;9:882824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ge S, Zuo Y, Han N, Lü Y, Qu H, Lu H, et al. Advances in researches on African Swine Fever Virus genotyping and serogrouping. China Anim Health Insp. 2022;39(9):97–104. [Google Scholar]
- 27.Phadphon P, Sonthirod C, Thaweerattanasinp T, Shearman JR, S UT, Saenboonrueng J, et al. Hairpin loop to hairpin loop: a full-length assembly of the ASFV genome using Oxford Nanopore long-read sequencing. Front Microbiol. 2025;16:1615977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Huang J-W, Niu D, Liu K, Wang Q, Ma L, Chen C-C, et al. Structure basis of non-structural protein pA151R from African Swine Fever Virus. Biochem Biophys Res Commun. 2020;532(1):108–13. [DOI] [PubMed] [Google Scholar]
- 29.Liu Y, Xie Z, Li Y, Song Y, Di D, Liu J, et al. Evaluation of an I177L gene-based five-gene-deleted African Swine Fever Virus as a live attenuated vaccine in pigs. Emerg Microbes Infect. 2022;12(1):e2148560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Wang Y, Cui S, Xin T, Wang X, Yu H, Chen S, et al. African Swine Fever Virus MGF360-14L negatively regulates Type I Interferon signaling by targeting IRF3. Front Cell Infect Microbiol. 2022;11:818969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Aguero M, Fernandez J, Romero L, Sanchez Mascaraque C, Arias M, Sanchez-Vizcaino JM. Highly sensitive PCR assay for routine diagnosis of African Swine Fever Virus in clinical samples. J Clin Microbiol. 2003;41(9):4431–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this published article.