ABSTRACT
Finding bioactive substances that can promote the de novo differentiation of stem cells into thermogenic adipocytes is a promising anti-obesity strategy. Cinnamaldehyde (CM) and 18β-glycyrrhetinic acid (GA) are the main active ingredients in Chinese herbal medicine. In this study, C3H10T1/2 mesenchymal stem cells (MSCs) were used to investigate whether CM and GA could promote the differentiation of MSCs into thermogenic adipocytes and the possible molecular mechanism. The experimental results demonstrated that CM and GA could promote the mRNA expression of adipogenic transcription factors Pparγ, Cebpα and Cebpβ, as well as thermogenic adipocyte-specific markers Pgc1α and Ucp1. CM combined with GA further enhanced these effects. CM/GA alone or in combination could increase the expression of FNDC5 mRNA and protein. After transfection with FNDC5 siRNA, the mRNA and protein levels of FNDC5 and UCP1 were significantly decreased, while the levels of PGC1α did not change apparently. After the combination of CM and GA intervention, the levels of FNDC5 and UCP1 were slightly restored, but could not return to the normal level. In conclusion, CM and GA could promote the differentiation of C3H10T1/2 MSCs into thermogenic adipocytes, and their combination could enhance this effect, which may be mediated by PGC1α/FNDC5/UCP1 signalling pathway.
KEYWORDS: Cinnamaldehyde, 18β-glycyrrhetinic acid, C3H10T1/2 MSCs, FNDC5, thermogenic adipocytes
1. Introduction
Obesity has become a global epidemic, which can not only lead to cardiovascular disease, diabetes and musculoskeletal disorders, but also increase the risk of some cancers [1]. At least 2.8 million people die from overweight or obesity every year [2]. Reducing energy intake and increasing energy expenditure are the general principles in the treatment of obesity [1]. However, the development of obesity depends not only on the balance between food intake and caloric utilization, but also on the balance between white adipose tissue (WAT), which is the main site of energy storage, and brown/beige adipose tissue (BAT), which is specialized for energy expenditure [3].
Brown/beige adipose, also known as thermogenic fat, can convert the chemical energy stored in WAT into heat and dissipate it [4]. It has small multi-lipid droplet morphology, more mitochondria and high expression of the mitochondrial inner membrane uncoupling protein 1 (UCP1) [4]. The formation of thermogenic adipocytes in WAT is termed WAT browning [5]. The browning of WAT includes two classical pathways, de novo differentiation and transdiffrentiation, and the main pathway is to increase the number of newly produced thermogenic adipocytes derived from stem cells through internal or external stimulation, namely de novo differentiation [6,7]. Finding bioactive components that can promote the differentiation of stem cells into thermogenic adipocytes is a promising new strategy for the treatment of obesity and related diseases [8].
Fibronectin type III domain containing 5 (FNDC5) is one of the known motor factors and is cleaved and secreted as irisin [9]. FNDC5/Irisin is considered a molecular mimic of exercise and has been shown to have various beneficial effects, such as promoting the browning of WAT and regulating bone metabolism and nervous system function [10]. Long-term aerobic exercise and certain dietary nutrients can induce peroxisome proliferator-activated receptor γ coactivator 1α(PGC1α) upregulation in muscle cells or adipocytes. The expression of PGC1α stimulates the expression of FNDC5/Irisin, which in turn activates the expression of UCP1, up-regulates genes related to thermogenic adipocytes and promotes the browning of WAT [4].
Cinnamaldehyde (CM) and 18β-glycyrrhetinic acid (GA) are the main active ingredients in Cinnamomi Ramulus/Cinnanmomi Cortex and Liquorice, which are often combined in traditional Chinese medicine formulations and dietary spices [11–13]. CM has been widely shown to resist obesity [14,15], and GA also has a certain anti-obesity effect [16]. However, the promoting differentiation effects of CM and GA on MSCs and their relationship with PGC1α/FNDC5/UCP1 signalling pathway have not been explored. Therefore, the aim of this study is to investigate the effects of CM and GA on the directional differentiation of MSCs into thermogenic adipocytes and their correlation with PGC1α/FNDC5/UCP1 signalling pathway in vitro.
2. Materials and methods
2.1. Chemical reagents
Cinnamaldehyde (CM) was from Macklin (Shanghai, China). 18β-glycyrrhetinic acid (GA) was purchased from YuanyeBio (Shanghai, China). The composition of the adipogenic differentiation medium (ADM) includes 1 μM dexamethasone (Sigma-Aldrich, St. Louis, USA), 1 μM rosiglitazone (YuanyeBio, Shanghai, China),5 μg/ml insulin (Macklin, Shanghai, China), 0.5 mM 3-Isobutyl-1-methylxanthine (IBMX) (Sigma-Aldrich, St Louis, USA) and 0.125 mM indomethacin (YuanyeBio, Shanghai, China). The composition of the adipogenic maintenance medium (AM) includes 1 μM rosiglitazone and 5 μg/m insulin. Oil-Red-O staining solution was obtained from MeilunBio (Dalian, China). CCK-8 kit was purchased from Fudebio (Hangzhou, China). FNDC5 siRNA (siFNDC5), negative control siRNA (siNC) and RNATransMate were from Sangon Biotech (Shanghai, China). Antibodies against UCP1, FNDC5, PGC1α were purchased from Affinity Bioscience (Jiangsu, China). Antibodies against β-actin were from Prointech (Wuhan, China). Goat anti-rabbit IgG secondary antibody was purchased from FineTest (Wuhan, China).
2.2. Cell culture, differentiation and treatment
Mouse mesenchymal stem cell lines C3H10T1/2 MSCs were cultured in DMEM media supplemented with 10% FBS and 1% penicillin–streptomycin solution in a humidified 5% CO2 incubator at 37°C. The C3H10T1/2 MSCs were seeded in 12-well plates at a density of 6 × 104 cells/well and cultured in a cell incubator with culture medium until the cells grew to 100%. After 48 h of contact inhibition, the cells were induced with adipogenic differentiation medium (ADM) with or without CM/GA for 2 days, and then cultured in adipogenic maintenance medium (AM) with or without CM/GA for 6 days. The medium was changed every 2 days, and the mature cells were harvested on the 8th day (Figure 1B).
Figure 1.
Effect of CM and GA at different concentrations on the viability of C3H10T1/2 MSCs. (A) Molecular structure of cinnamaldehyde (CM) and 18β- glycyrrhetinic acid (GA). (B) Schematic diagram of cell differentiation and drug intervention. ADM: 1 μM dexamethasone, 1 μM rosiglitazone,5 μg/ml insulin, 0.5 mM IBMX, 0.125 mM indomethacin; AM: 1 μM rosiglitazone, 5 μg/m insulin. (C) The effects of CM (0–160 μM) and GA (0–80 μM) on the viability of C3H10T1/2 MSCs were investigated via CCK-8 assay. The cells were treated with CM/GA and incubated for 24 h. “0”: blank control group. Data are presented as mean ±SEM (n = 5). *p < 0.05, **p < 0.01, ***p < 0.001 compared with blank control group.
2.3. CCK-8 assay
The cell proliferation and viability were measured by a CCK-8 assay. C3H10T1/2 MSCs were dispensed at 5 × 103 cells/well in a 96-well plate. The next day, 80–90% confluent cells were incubated with different concentrations of CM (10–160 μM) or GA (5–80 μM) for 24 h. Then, 10 μL of CCK-8 solution was added to each well containing 90 μL of culture medium. After the plate was incubated for 2 h, the absorbance was measured at a wavelength of 450 nm.
2.4. Oil-Red-O staining
Oil Red-O staining working solution was prepared, placed at room temperature for 10 min and then filtered through a filter membrane for later use. After washing with PBS 2–3 times, the cells were fixed with 4% paraformaldehyde for 30 min, thoroughly rinsed, infiltrated with 60% isopropanol for 10 min, and stained with Oil-Red-O working solution for 15 min away from light. After rinsing, the cells were stained with haematoxylin staining solution for 1 min. The staining results were observed under a microscope and photographed. The average area of individual lipid droplets was calculated using ImageJ software. Oil-Red-O dye was extracted with 100% isopropanol, and lipid content was assessed by measuring the absorbance at 510 nm using a microplate reader.
Multilocular adipocytes were strictly defined as cells containing three or more distinct, small lipid droplets. For each well, 10 random, non-overlapping fields were captured under a 200× magnification microscope. The total number of cells and the number of multilocular adipocytes were counted manually by three independent investigators blinded to the experimental groups. The percentage of multilocular adipocytes was calculated using the formula: (Number of multilocular adipocytes/Total number of cells) × 100%.
Furthermore, the average area of individual lipid droplets was calculated using ImageJ software. Colour Deconvolution was used to separate the red channel, followed by threshold segmentation to isolate lipid droplets. Finally, the Analyse Particles module was employed to quantify the number and diameter of lipid droplets. Oil-Red-O dye was extracted with 100% isopropanol, and lipid content was assessed by measuring the absorbance at 510 nm using a microplate reader. The absorbance values were normalized to the total cellular protein content determined by a BCA assay.
2.5. Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA from C3H10T1/2 adipocytes was extracted using the EZ-press RNA Purification Kit (EZBioscience, USA) following the operation instructions, and cDNA was synthesized from 1 μg of total RNA using the 4×EZscript Reverse Transcription Mix II (EZBioscience, USA). qRT-PCR was performed on a CFX96™ Real-time PCR (Bio-Rad, Singapore) with 2×SYBR Green qPCR Master Mix (EZBioscience, USA). Sequences of the primer sets used in this study are listed in Supplementary Table 1. The RT-PCR program proceeded as follows: 95°C for 5 min, 40 cycles of 60°C for 20 s and 95°C for 15 s.
Table 1.
The primer sequence used for real-time quantitative PCR.
| Gene | Forward | Reverse |
|---|---|---|
| β-actin | CATTGCTGACAGGATGCAGA | CTGCTGGAAGGTGGACAGTGA |
| Pgc1α | TATGGAGTGACATAGAGTGTGCT | GTCGCTACACCACTTCAATCC |
| Ucp1 | CGTCCCCTGCCATTTACTGT | GACCCGAGTCGCAGAAAAGA |
| FNDC5 | CACGCGAGGCTGAAAAGATG | GAGCTATAACACCTGCCCACA |
| Prdm16 | CCACCAGCGAGGACTTCAC | GGAGGACTCTCGTAGCTCGAA |
| Cd137 | CGTGCAGAACTCCTGTGATAAC | GTCCACCTATGCTGGAGAAGG |
| Elovl3 | TTCTCACGCGGGTTAAAAATGG | TCTCGAAGTCATAGGGTTGCAT |
| Dio2 | CAGTGTGGTGCACGTCTCCAATC | TGAACCCCCGTTGACCACCAG |
| Cited1 | GCGGTAAAAGATCGCAAGGC | TTGTAGAAGGGGTGGCAGTA |
2.6. Western blot analysis
The total protein of adipocytes was extracted using a cell lysis buffer for Western and IP (Beyotime, Shanghai, China) containing protease and phosphatase inhibitors (100:1:1). The supernatant was centrifuged (14,000 rpm for 20 min) and collected in a 1.5 mL tube. The total protein concentration was measured using the BCA protein quantification kit (WanleiBio, Shenyang, China). After adding Dual Color SDS-PAGE Protein Sample Loading Buffer (Beyotime, Shanghai, China) with 25% supernatant solution, it was incubated in boiling water for 10 min. Protein samples (20 µg) were separated using a 12% PAGE Gel Quick Preparation Kit (GBCBIO, Guangzhou, China) (120 V, 30 min, Bio‑Rad) and then transferred electrophoretically onto PVDF membranes (400 mA,25 min). The membrane was blocked for 2 h with 5% skimmed milk diluted with TBST buffer. After washing three times for 8 min with TBST buffer, the membrane was incubated overnight at 4 °C with primary antibodies against UCP1 (1:2000), PGC1α (1:3000), FNDC5 (1:5000) and β-actin (1:10000), respectively. After washing the membrane in the same manner, it was incubated with the secondary antibody for 1 h. After washing, immunodetection was carried out using the enhanced chemiluminescence (ECL) system (GBCBIO, Guangzhou, China). Immunoreactive bands were quantified and analysed using ImageJ software.
2.7. FNDC5 small interfering RNA (siRNA) transfection
SiRNA transfection was performed according to the manufacturer’s instructions. Transfection was performed when C3H10T1/2 MSCs had a confluence of 70–80%. FNDC5 siRNA (siFNDC5) or negative control siRNA (siNC) was diluted in high-glucose DMEM medium individually, and then the RNA Trans Mate reagent was diluted in the same medium. The two diluted solutions were mixed at a 1:1 ratio and incubated for 20 min at room temperature. C3H10T1/2 MSCs were treated with the transfection mixture for 6 h, and then replaced with DMEM medium containing 10% FBS but without 1% penicillin–streptomycin solution. Further, C3H10T1/2 MSCs were harvested through the differentiation procedure.
2.8. Statistical analysis
All the data are expressed as the mean ± standard error of the mean (SEM). The experimental variables were confirmed with at least triplicate biological samples. Statistical analysis was conducted using one-way ANOVA followed by Least Significant Difference or Tukey’s test. Statistical significance was considered at p< 0.05.
3. Result
3.1. Effects of cinnamaldehyde (CM) and 18β-glycyrrhetinic acid (GA) at different concentrations on cell viability in C3H10T1/2 MSCs
The chemical structures of CM and GA are shown in Figure 1A, and the experimental timeline – including cell seeding, contact inhibition, 2-day adipogenic induction, 6-day maintenance and day 8 harvest – is illustrated in Figure 1B. As shown in Figure 1C, CCK-8 assay results showed that CM at concentrations of 10–160 μM for 24 h and GA at concentrations of 5–40 μM for 24 h had no effect on the viability of C3H10T1/2 MSCs. Further, CM treatments with 20–80 μM and GA treatment with 10–40 μM could significantly promote the proliferation of C3H10T1/2 MSCs. Therefore, 20–80 μM CM and 10–40 μM GA were confirmed to be used for the subsequent experiment.
3.2. Effects of CM and GA on the formation of small multi-lipid droplet adipocytes
Different concentrations of CM and GA were used to interfere with adipogenic differentiation of C3H10T1/2 MSCs. Oil-Red-O staining results showed that, compared with the control group, the 20, 40 μM CM and 10, 20 μM GA intervention groups had more cells with small multi-lipid droplets (Figure 2A,B). In addition, the average area of a single lipid droplet was reduced (Figure 2C), and lipid accumulation was decreased (Figure 2D).
Figure 2.
Effects of CM and GA on the formation of small multi-lipid droplet adipocytes. (A) Representative images of Oil-Red-O staining taken at 200×magnification. (B) Cell counting of multilocular adipocytes. Counts were made under a 200× magnification microscope and counted independently by three researchers. (C) The mean lipid droplet area was measured by ImageJ software. (D) Lipid accumulation was quantified by using a microplate reader at the wavelength of 510 nm. “C”: differentiation control group. Data are presented as mean± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 compared with control.
3.3. Effects of CM and GA on mRNA expression of adipogenic transcription factors and thermogenic adipocyte-specific markers
qRT-PCR showed that the relative mRNA expression levels of the adipogenic transcription factors Pparγ, Cebpα and Cebpβ (Figure 3A) and the thermogenic adipocyte-specific markers Pgc1α and Ucp1(Figure 3B) were significantly increased after treatment with CM and GA. In particular, treatment with CM at 20, 40 μM and GA at 10, 20 μM significantly promoted C3H10T1/2 MSCs differentiation and thermogenic adipocyte formation.
Figure 3.
Effects of CM and GA on mRNA expression of adipogenic transcription factors and thermogenic adipocyte-specific markers. Relative mRNA expression of adipogenic transcription factors Pparγ, Cebpα, Cebpβ (A) and thermogenic adipocyte-specific markers Pgc1α, Ucp1 (B) were measured by q RT-PCR. “C”: differentiation control group. Data are presented as mean± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 compared with control.
3.4. Effects of different concentration combinations of CM and GA on adipogenic transcription factors and thermogenic adipocyte-specific markers
In order to find the best combination of CM and GA, we used different concentration combinations of CM (20, 40 μM) and GA (10, 20 μM) to interfere with C3H10T1/2 MSCs adipogenic differentiation according to the above experimental results. The combination of 20 μM CM and 20 μM GA (CM20+GA20) significantly promoted the relative mRNA expression of adipogenic transcription factors Pparγ, Cebpα and Cebpβ (Figure 4A), and thermogenic adipocyte-specific markers Pgc1α and Ucp1(Figure 4B). At the same time, the protein levels of PGC1α and UCP1 were also significantly increased (Figure 4C).
Figure 4.
Effects of different concentration combinations of CM and GA on adipogenic transcription factors and thermogenic adipocyte-specific markers. (A) Relative mRNA expression of adipogenic transcription factors Pparγ, Cebpα, Cebpβ. Relative mRNA (B) and protein (C) expression of thermogenic adipocyte-specific markers PGC1α and UCP1. Control: differentiation control group. CM40+GA10: CM 40 μM+ GA 10 μM, CM40+GA20: CM 40 μM+ GA 20 μM, CM20+GA10: CM 20 μM+ GA 10 μM, CM20+GA20: CM 20 μM+ GA 20 μM. Data are presented as mean± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 compared with control.
3.5. Effects of CM combined with GA on the formation of adipocytes with small multi-lipid droplets
To explore the combined effect of CM and GA, we used 20 μM CM, 20 μM GA and 20 μM CM combined with 20 μM GA to interfere with adipogenic differentiation of C3H10T1/2 MSCs. As shown in Figure 5A-D, Oil-Red-O staining showed that, compared with the single drug groups (CM/GA), the combination of CM and GA (CM+GA) could further reduce the average area of single lipid droplets, reduce cellular lipid accumulation and promote the formation of small multi-lipid droplet cells.
Figure 5.
Effects of CM combined with GA on the formation of adipocytes with small multi-lipid droplets. (A) Representative images of Oil-Red-O staining taken at 200× magnification. (B) Cell counting of multilocular adipocytes. Counts were made under a 200× magnification microscope and counted independently by three researchers. (C) The mean lipid droplet area was measured using ImageJ software. (D) Lipid accumulation was quantified by using a microplate reader at the wavelength of 510 nm. Data are presented as mean± SEM (n = 3). *p < 0.05, **p < 0.01 and ***p < 0.001 compared with control. #p < 0.05, ##p < 0.01, ###p < 0.001 compared with CM+GA.
3.6. Effects of CM combined with GA on mRNA and protein expression related to thermogenesis
qRT-PCR showed that the relative mRNA expression of thermogenic adipocyte-specific markers Pgc1α and Ucp1 (Figure 6A) in the combination group (CM+GA) was significantly higher than those in the single drug group (CM/GA). At the same time, Western blot also showed that the relative protein levels of PGC1α and UCP1 in the drug combination group were significantly higher than those in the single drug group (Figure 6B). In addition, qRT- PCR was used to detect the mRNA levels of Prdm16, Cd137, Tbx1, Elovl3, Dio2 and Cited1, which are closely related to thermogenic adipose tissue (Figure 6C). The results showed that the mRNA expression of thermogenic genes was increased to varying degrees in the drug combination group.
Figure 6.
Effects of CM combined with GA on mRNA and protein expression related to thermogenesis. Relative mRNA (A) and protein (B) expression of thermogenic adipocyte-specific markers PGC1α and UCP1. (C) Relative mRNA expression of other thermogenic genes Prdm16, Tbx1, Cd137, Elovl3, Dio2 and Cited1. β-actin was used as a housekeeping gene. Data are presented as mean± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 compared with the control. #p < 0.05, ##p < 0.01, ###p < 0.001 compared with CM+GA.
3.7. Effects of CM combined with GA on PGC1α/FNDC5/UCP1 signalling pathway
In this study, we found that CM and GA could promote the expression of PGC1α and UCP1 in adipocytes derived from C3H10T1/2 MSCs. However, the effect of CM and GA on FNDC5 is unknown. The results of qRT-PCR experiments showed that CM and GA, either alone or in combination, significantly upregulated the expression of FNDC5 mRNA (Figure 7A). Western blot also showed that FNDC5 protein expression was significantly up-regulated after combined application of CM and GA (Figure 7B).
Figure 7.
Effects of CM combined with GA on PGC1α/FNDC5/UCP1 signalling pathway. (A) The effects of different concentrations of CM and GA on FNDC5 mRNA, and the effects of CM (20 μM) + GA (20 μM) on Pgc1α and FNDC5 mRNA expression. (B) Effect of CM and GA on PGC1α and FNDC5 protein expression. (C) FNDC5 mRNA expression after negative control siRNA (siNC) and FNDC5 siRna (sifndc5) transfection. Relative expression of Pgc1α (D), FNDC5 (E), Ucp1 (F) mRNA in NC or FNDC5 siRNA-transfected C3H10T1/2 adipocytes treated with CM+GA. (G) Relative levels of PGC1α, FNDC5 and UCP1 protein in each group. Control: differentiation control group. Data are presented as mean± SEM (n = 3). * p < 0.05, **p < 0.01, ***p < 0.001 compared with control. #p < 0.05, ##p < 0.01, ###p < 0.001 compared with CM+GA. ▲p < 0.05, ▲▲p < 0.01 compared with siFNDC5.
To determine whether FNDC5 silencing itself affects thermogenic marker expression, we compared the control group with the siFNDC5 group (without drug treatment). Transfection of C3H10T1/2 MSCs with FNDC5 siRNA significantly reduced Fndc5 mRNA expression (relative expression: 0.357 ± 0.093 vs. 1.001 ± 0.058 in the control group, p < 0.001, Figure 7C), indicating an efficient and specific knockdown. FNDC5 silencing alone did not affect Pgc1α mRNA expression (0.965 ± 0.228 vs. 1.019 ± 0.230 in Control, p = 0.842, Figure 7D), consistent with PGC1α acting upstream of FNDC5. In contrast, Ucp1 mRNA showed a moderate reduction after FNDC5 silencing alone (0.671 ± 0.052 vs. 1.002 ± 0.075 in Control), although this did not reach statistical significance (p = 0.067, Figure 7F), suggesting that FNDC5 contributes to basal UCP1 expression but the effect is modest under unstimulated conditions.
After the administration of the pharmacological intervention (siFNDC5-CM+GA), the decline of FNDC5 mRNA was reversed, but it could not return to normal levels (Figure 7E). CM+GA treatment restored FNDC5 mRNA to 0.820 ± 0.191, representing a certain degree of increasing trend compared to the siFNDC5 group (p < 0.05). Although this rescued level was not significantly different from the Control group (p = 0.135), it remained significantly lower than the CM+GA group (1.352 ± 0.150, p < 0.001). Meanwhile, Pgc1α mRNA remained significantly elevated after CM+GA intervention even in the presence of FNDC5 knockdown (siFNDC5+CM+GA vs. CM+GA: 2.247 ± 0.547 vs. 1.916 ± 0.134, p = 0.248, Figure 7D), which is consistent with PGC1α being upstream of FNDC5 and not dependent on FNDC5 expression. After siFNDC5 transfection, the effect of CM and GA on increasing Ucp1 mRNA expression was lost (Figure 7F). Similar results were observed for PGC1α, FNDC5 and UCP1 protein levels (Figure 7G). These suggest that CM and GA act through the PGC1α/FNDC5/UCP1 signalling pathway, and that FNDC5 plays a critical role.
4. Discussion
Cinnamon is a food flavour enhancer widely used in cookies, bread, coffee and tea beverages. Liquorice is also a product derived from both medicine and food. CM and GA are respectively the main bioactive components in cinnamon and liquorice. In addition, CM and GA are usually found together in traditional Chinese medicine formulae.
CM and GA are essential components in the clinically effective anti-obesity auxiliary prescription—Lingguizhugan Decoction [17]. They have good oral bioavailability (the bioavailability of CM and GA is 31.99% and 22.05%, respectively) [18]. Previous studies have shown that CM can resist obesity by inhibiting food intake and activity [19], reducing fat inflammation [20], promoting lipolysis [21] and promoting thermogenesis in WAT [15,22]. Park M [21] found that GA inhibited adipogenic differentiation of 3T3-L1 cells, and supplementation with GA significantly reduced body weight, fat mass and lipid levels in obese animals. Although the anti-obesity effects of CM and GA have been confirmed, the combined effects of CM and GA on the de novo differentiation of stem cells into thermogenic adipocytes and the underlying mechanisms have not been explored. The present study addresses this gap.
The synergistic effects of CM and GA were first supported by pharmacokinetic evidence. Wang S [23] compared the pharmacokinetics of glycyrrhetinic acid in the plasma of rats after oral administration of Ramulus Cinnamomi (RC)-Radix Glycyrrhizae (RG) (Guizhigancao decoction and Lingguizhugan decoction) and single herb (RC or RG) water extract, and found that the pharmacokinetic parameters of the herb pair groups showed higher peak concentration, slower elimination rate and greater exposure compared with the single herb group. This indicated that the combination of RC and RG could exert synergistic effects. Our study also found that CM and GA exhibited synergistic effects at the monomer level. Oil-Red-O staining showed that CM combined with GA could promote the formation of small multi-lipid droplets in C3H10T1/2 MSCs. PGC1α is a key regulator of mitochondrial biogenesis and also has an impact on mitochondrial functions beyond biogenesis [21]. UCP1 is located in the inner mitochondrial membrane, which eliminates the difference in transmembrane proton concentration between the two sides of the mitochondrial inner membrane by inducing proton leakage, uncoupling ATP synthesis and oxidative phosphorolysis and releasing energy in the form of heat, which is the classical pathway of adipose tissue thermogenesis [24,25]. In our study, CM and GA, alone or in combination, significantly increased the mRNA and protein expression of PGC1α and UCP1, with the combination (20 μM CM +20 μM GA) producing the most pronounced effects, suggesting that the mitochondrial function and thermogenesis of stem cell-derived adipocytes were enhanced.
FNDC5/Irisin was found to promote the browning of WAT in 2012, representing a beneficial effect of exercise [4]. Moreover, FNDC5/Irisin is abundantly expressed in heart, brain, skeletal muscle, brown adipose tissue, etc. [26]. It also plays an important health benefit in glucose and lipid metabolism, bone metabolism, cardiovascular system, nervous system and some cancers [27]. Studies have shown that some traditional Chinese medicine ingredients, such as icariin, the main active component of Epimrdii Herba [28], ginsenoside Rb1, the main active component of Panax Ginseng C. A. Mey [29], and ligustrazine, the main active component of Chuanxiong Rhizoma [30], can promote the increase of FNDC5/Irisin levels. FNDC5/Irisin is a well-characterized exercise-induced myokine that promotes white adipose tissue browning through a defined signalling cascade: PGC1α upregulates FNDC5 expression, and the FNDC5 cleavage product irisin acts on white adipocytes to stimulate UCP1 expression and thermogenesis [9]. Importantly, AMPK and PPARγ are established upstream regulators of PGC1α–AMPK activation phosphorylates and activates PGC1α [28], while PPARγ forms transcriptional complexes with PGC1α to co-regulate downstream gene expression [31]. Previous studies have demonstrated that CM modulates both AMPK and PPARγ signalling pathways [24,32], and GA has been shown to inhibit adipogenesis through downregulation of PPARγ and its target genes [26]. Thus, the known effects of CM and GA on AMPK/PPARγ pathways place them upstream of the PGC1α/FNDC5/UCP1 thermogenic axis. We therefore reasoned that their combination might exert synergistic effects on this hierarchical cascade – a hypothesis further supported by pharmacokinetic evidence showing that the Guizhi-Gancao herb pair combination enhances systemic exposure of its active components compared to single-herb administration [27].
In this study, we found that CM, the main active ingredients of Cinnamomi Ramulus/Cinnanmomi Cortex, and GA, the main active ingredients of liquorice, could promote the expression of FNDC5, alone or in combination, and promote the differentiation of MSCs into thermogenic adipocytes through the FNDC5 pathway. To further dissect the pathway, we employed FNDC5 siRNA-mediated knockdown. Transfection with siFNDC5 significantly reduced the mRNA expression of FNDC5 (Figure 7C). Following knockdown, Pgc1α expression remained unchanged, consistent with PGC1α acting upstream of FNDC5. In contrast, Ucp1 mRNA and protein levels showed a decreasing trend, although the reduction did not reach statistical significance, suggesting that FNDC5 contributes to UCP1 regulation but may not be the sole determinant. Importantly, the CM+GA-induced upregulation of UCP1 was significantly blunted upon FNDC5 silencing, indicating that the pro-thermogenic effects of CM and GA are largely mediated through FNDC5. However, the observation that CM+GA could partially restore FNDC5 expression after knockdown (Figure 7E), yet failed to fully restore UCP1 to normal stimulated levels, implies that additional FNDC5-independent pathways or downstream effectors may also participate in the thermogenic response. These findings collectively position FNDC5 as a critical nodal point within the PGC1α/FNDC5/UCP1 axis, while acknowledging the inherent complexity of the regulatory network.
Notably, increased mRNA expression of adipogenic transcription factors Pparγ, Cebpα and Cebpβ was found in the present study, suggesting that the combination of CM and GA promoted adipogenesis. However, this is inconsistent with some other conclusions [32–34]. After careful comparison of the processes and results of these studies, there are two possible reasons for the different results. Firstly, the cell object selection was different. Hoi JK [33], Huang B [32] and Moon MH [34] used 3T3-L1 preadipocytes as the research object, which is a cell line with directional differentiation into mature white adipocytes. In this study, C3H10T1/2 mesenchymal stem cell line was selected as the research object. C3H10T1/2 MSCs have multipotent differentiation potential and can differentiate into osteoblasts, chondrocytes, adipocytes and so on [35]. Different cell lines may lead to different differentiation characteristics. Secondly, the adipogenic cocktail is different. The former used a cocktail including insulin, IBMX and dexamethasone to induce the preadipocytes into white adipocytes [36], while the adipogenic cocktail in this study included the PPARγ agonist rosiglitazone, an induction composition that induces the differentiation of stem cells into thermogenic adipocytes [31,37]. Different adipogenic cocktails may also exhibit different gene expression abundance. In conclusion, previous researchers used 3T3-L1 preadipocytes to investigate the inhibitory effect of CM or GA on white adipocytes. In this study, C3H10T1/2 MSCs were used to investigate the effect of CM combined with GA on promoting the differentiation of MSCs into thermogenic adipocytes. These are completely different studies. Taken together with our results, CM and GA may promote brown/beige adipocytes generation while inhibiting white adipocytes generation.
Several limitations of this study should be acknowledged. The in vitro concentrations of CM and GA (20 μM each) were selected based on CCK-8 assays and fall within the range commonly used in comparable studies. Pharmacokinetic data confirm that oral administration of CM and GA achieves micromolar plasma concentrations (bioavailability: 31.99% and 22.05%, respectively [21]), and the herb pair combination further enhances systemic exposure [27], supporting the translational relevance of these doses. However, direct extrapolation from in vitro to in vivo dosing requires caution. In addition, while we focused on the PGC1α/FNDC5/UCP1 axis, we did not measure irisin secretion or perform mitochondrial respiration assays (e.g. Seahorse), which could not be completed within the revision timeframe; these experiments are planned as high-priority follow-up studies. Furthermore, the use of a murine cell line (C3H10T1/2), although well-characterized and experimentally tractable, cannot fully recapitulate human adipose tissue biology; validation in human adipocyte models is therefore necessary to confirm translational potential.
Despite these limitations, our findings provide clear mechanistic evidence that CM+GA promotes thermogenic differentiation of MSCs through the PGC1α/FNDC5/UCP1 pathway. Future studies could first employ diet-induced obese mouse models to evaluate the whole-body metabolic effects, pharmacokinetics and therapeutic efficacy of this combination. These in vivo investigations, combined with metabolomic and transcriptomic profiling, will establish the foundation for subsequent validation in human adipocyte models and ultimately support clinical development.
5. Conclusion
Natural active ingredients CM and GA could promote the differentiation of MSCs into thermogenic adipocytes, and their combination could enhance the differentiation and thermogenic function of MSCs-derived adipocytes. This process may be related to the PGC1α/FNDC5/UCP1 signalling pathway.
Supplementary Material
Funding Statement
Guangdong Basic and Applied Basic Research Foundation [2023A1515011071] to Jin Zhang. Key projects of Yunnan Provincial Clinical MedicalCentre [2024YNLCYXZX0295] to Jun Zhang. Key Projects of Clinical Medicine at Nantong University [2024LZ019] to Yongjin Yan.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Data availability statement
All data generated or analysed during this study are included in this published article and its supplementary information files.
Supplementary Information
Supplemental data for this article can be accessed online at https://doi.org/10.1080/21623945.2026.2719272
References
- [1].Blüher M. Obesity: global epidemiology and pathogenesis. Nat Rev Endocrinol. 2019;15(5):288–14. doi: 10.1038/s41574-019-0176-8 [DOI] [PubMed] [Google Scholar]
- [2].cited 2024 January 18]. Available from: https://www.who.int/news-room/facts-in-pictures/detail/6-facts-on-obesity
- [3].Gesta S, Tseng YH, Kahn CR. Developmental origin of fat: tracking obesity to its source [published correction appears in cell. Cell. 2007;131(2):242–256. doi: 10.1016/j.cell.2007.10.004 [DOI] [PubMed] [Google Scholar]
- [4].Wu J, Boström P, Sparks LM, et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell. 2012;150(2):366–376. doi: 10.1016/j.cell.2012.05.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [5].Bartelt A, Heeren J. Adipose tissue browning and metabolic health. Nat Rev Endocrinol. 2014;10(1):24–36. doi: 10.1038/nrendo.2013.204 [DOI] [PubMed] [Google Scholar]
- [6].Wang QA, Tao C, Gupta RK, et al. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat Med. 2013;19(10):1338–1344. doi: 10.1038/nm.3324 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Sidossis L, Kajimura S. Brown and beige fat in humans: thermogenic adipocytes that control energy and glucose homeostasis. J Clin Invest. 2015;125(2):478–486. doi: 10.1172/JCI78362 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Harms M, Seale P. Brown and beige fat: development, function and therapeutic potential. Nat Med. 2013;19(10):1252–1263. doi: 10.1038/nm.3361 [DOI] [PubMed] [Google Scholar]
- [9].Boström P, Wu J, Jedrychowski MP, et al. A PGC1-α-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature. 2012;481(7382):463–468. doi: 10.1038/nature10777 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Waseem R, Shamsi A, Mohammad T, et al. FNDC5/Irisin: physiology and pathophysiology. Molecules. 2022;27(3):1118. doi: 10.3390/molecules27031118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Sun S, Xun G, Zhang J, et al. An integrated approach for investigating pharmacodynamic material basis of Lingguizhugan decoction in the treatment of heart failure. J Ethnopharmacol. 2022;295:115366. doi: 10.1016/j.jep.2022.115366 [DOI] [PubMed] [Google Scholar]
- [12].Ji B, Zhuo L, Yang B, et al. Development and validation of a sensitive and fast UPLC-MS/MS method for simultaneous determination of seven bioactive compounds in rat plasma after oral administration of Guizhi-gancao decoction. J Pharm Biomed Anal. 2017;137:23–32. [DOI] [PubMed] [Google Scholar]
- [13].Hu Y, Liu L, Wang Z, et al. Network pharmacology, molecular docking and in vivo and in vitro experiments to explore the molecular mechanism of licorice green tea beverage to scavenge oxygen free radicals. J Food Biochem. 2022;46(10):e14315. doi: 10.1111/jfbc.14315 [DOI] [PubMed] [Google Scholar]
- [14].Neto JGO, Boechat SK, Romão JS, et al. Treatment with cinnamaldehyde reduces the visceral adiposity and regulates lipid metabolism, autophagy and endoplasmic reticulum stress in the liver of a rat model of early obesity. J Nutr Biochem. 2020;77:108321. doi: 10.1016/j.jnutbio.2019.108321 [DOI] [PubMed] [Google Scholar]
- [15].Zuo J, Zhao D, Yu N, et al. Cinnamaldehyde ameliorates diet-induced obesity in mice by inducing Browning of white adipose tissue. Cell Physiol Biochem. 2017;42(4):1514–1525. doi: 10.1159/000479268 [DOI] [PubMed] [Google Scholar]
- [16].Park M, Lee JH, Choi JK, et al. 18β-glycyrrhetinic acid attenuates anandamide-induced adiposity and high-fat diet induced obesity. Mol Nutr Food Res. 2014;58(7):1436–1446. doi: 10.1002/mnfr.201300763 [DOI] [PubMed] [Google Scholar]
- [17].Huang J, Zhao L, Sun J, et al. Clinical evidence and potential mechanisms of complementary treatment of Ling Gui Zhu Gan Formula for the management of serum lipids and obesity. Evid Based Complement Alternat Med. 2022;2022:1–20. doi: 10.1155/2022/7714034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18].Ru J, Li P, Wang J, et al. TCMSP: a database of systems pharmacology for drug discovery from herbal medicines. J Cheminf. 2014;6(1):13. doi: 10.1186/1758-2946-6-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [19].Camacho S, Michlig S, de Senarclens-Bezençon, C, et al. Anti-obesity and anti-hyperglycemic effects of cinnamaldehyde via altered ghrelin secretion and functional impact on food intake and gastric emptying. Sci Rep. 2015;5(1):7919. doi: 10.1038/srep07919 PMID: 25605129; PMCID: PMC4300502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20].Khare P, Jagtap S, Jain Y, et al. Cinnamaldehyde supplementation prevents fasting-induced hyperphagia, lipid accumulation, and inflammation in high-fat diet-fed mice. Biofactors. 2016;42(2):201–211. doi: 10.1002/biof.1265 Epub 2016 Feb 19. PMID: 26893251. [DOI] [PubMed] [Google Scholar]
- [21].Halling JF, Pilegaard H. PGC-1α-mediated regulation of mitochondrial function and physiological implications. Appl Physiol Nutr Metab. 2020;45(9):927–936. doi: 10.1139/apnm-2020-0005 Takahashi S, Okaze H, Kawamoto S. Falcarindiol promotes beige adipocyte-related gene expression and mitochondrial respiration in human preadipocyte-derived adipocytes. Cytotechnology. 2025;77(4):125. do i: 10. 1007/s10616-025–00790-y [DOI] [PubMed] [Google Scholar]
- [22].Jiang J, Emont MP, Jun H, et al. Cinnamaldehyde induces fat cell-autonomous thermogenesis and metabolic reprogramming. Metabolism. 2017;77:58–64. doi: 10.1016/j.metabol.2017.08.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [23].Wang S, Sun L, Gu L, et al. The comparative pharmacokinetics of four bioactive ingredients after administration of Ramulus Cinnamomi-radix Glycyrrhizae herb pair extract, Ramulus Cinnamomi extract and radix Glycyrrhizae extract. Biomed Chromatogr. 2016;30(8):1270–1277. [DOI] [PubMed] [Google Scholar]
- [24].Chouchani ET, Kazak L, Spiegelman BM. New advances in adaptive thermogenesis: UCP1 and beyond. Cell Metab. 2019;29(1):27–37. doi: 10.1016/j.cmet.2018.11.002 [DOI] [PubMed] [Google Scholar]
- [25].Bertholet AM, Natale AM, Bisignano P, et al. Mitochondrial uncouplers induce proton leak by activating AAC and UCP1. Nature. 2022;606(7912):180–187. doi: 10.1038/s41586-022-04747-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [26].Flori L, Testai L, Calderone V. The “irisin system”: from biological roles to pharmacological and nutraceutical perspectives. Life Sci. 2021;267:118954. doi: 10.1016/j.lfs.2020.118954 [DOI] [PubMed] [Google Scholar]
- [27].Zhang H, Wu X, Liang J, et al. Irisin, an exercise-induced bioactive peptide beneficial for health promotion during aging process. Ageing Res Rev. 2022;80:101680. doi: 10.1016/j.arr.2022.101680 [DOI] [PubMed] [Google Scholar]
- [28].Chen SQ, Ding LN, Zeng NX, et al. Icariin induces irisin/FNDC5 expression in C2C12 cells via the AMPK pathway. Biomed Pharmacother. 2019;115:108930. doi: 10.1016/j.biopha.2019.108930 [DOI] [PubMed] [Google Scholar]
- [29].Li HS, Kuang JY, Liu GJ, et al. Myostain is involved in ginsenoside Rb1-mediated anti-obesity. Pharm Biol. 2022;60(1):1106–1115. doi: 10.1080/13880209.2022.2074056 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Yixin F, Zhanhui H, Zhishu L, et al. Effect of tetramethylpyrazine on acute myocardial ischemia in mice by FNDC5 [J/OL]. Tradit Chin Med Mater. 2023;8:2044–2050. doi: 10.13863/j.issn1001-4454.2023.08.034 [DOI] [Google Scholar]
- [31].Lee MJ, Jash S, Jones JEC, et al. Rosiglitazone remodels the lipid droplet and britens human visceral and subcutaneous adipocytes ex vivo. J Lipid Res. 2019;60(4):856–868. doi: 10.1194/jlr.M091173 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Huang B, Yuan HD, Kim DY, et al. Cinnamaldehyde prevents adipocyte differentiation and adipogenesis via regulation of peroxisome proliferator-activated receptor-γ (PPARγ) and AMP-activated protein kinase (AMPK) pathways. J Agric Food Chem. 2011;59(8):3666–3673. doi: 10.1021/jf104814t [DOI] [PubMed] [Google Scholar]
- [33].Hoi JK, Lieder B, Liebisch B, et al. TRPA1 agonist Cinnamaldehyde decreases adipogenesis in 3T3-L1 cells more potently than the non-agonist structural analog cinnamyl isobutyrate. ACS Omega. 2020;5(51):33305–33313. doi: 10.1021/acsomega.0c05083 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].Moon MH, Jeong JK, Lee YJ, et al. 18β-glycyrrhetinic acid inhibits adipogenic differentiation and stimulates lipolysis. Biochem Biophys Res Commun. 2012;420(4):805–810. doi: 10.1016/j.bbrc.2012.03.078 [DOI] [PubMed] [Google Scholar]
- [35].Huang W, Wu X, Xiang S, et al. Regulatory of miRnas in tri-lineage differentiation of C3H10T1/2. STEM Cell Res Ther. 2022;13(1):521. doi: 10.1186/s13287-022-03205-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36].Rocha AL, Guerra BA, Boucher J, et al. A method to induce brown/beige adipocyte differentiation from murine preadipocytes. Bio Protoc. 2021;11(24):e4265. doi: 10.21769/BioProtoc.4265 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [37].Li Y, Wang D, Ping X, et al. Local hyperthermia therapy induces browning of white fat and treats obesity. Cell. 2022;185(6):949–966.e19. doi: 10.1016/j.cell.2022.02.004 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data generated or analysed during this study are included in this published article and its supplementary information files.