High prevalence of Plasmodium ovalewallikeri in co-infections with Plasmodium falciparum in symptomatic than asymptomatic Plasmodium parasite infections in Kisumu, Kenya

Jackline A Juma; Oliver J Watson; Dennis W Juma; Benjamin H Opot; Gladys Chemwor; Mary Mutahi; Raphael Okoth; Edwin W Mwakio; Redemptah Yeda; Charles O Okello; Agnes Cheruiyot; Duke Omariba; Liliana Dayo; Hellen A Ogola; Gladys Biwott; Charles Adega; Fredrick Oluoch; Vincent Omondi; George Otieno; Edwin Kamau; Ben Andagalu; Peter Sifuna; Amanda Roth; Sammy Khagayi; Eric C Garges; Bernhards Ogutu; Hoseah M Akala

doi:10.1371/journal.pone.0334188

. 2026 Oct 7;21(10):e0334188. doi: 10.1371/journal.pone.0334188

High prevalence of Plasmodium ovalewallikeri in co-infections with Plasmodium falciparum in symptomatic than asymptomatic Plasmodium parasite infections in Kisumu, Kenya

Jackline A Juma ¹, Oliver J Watson ², Dennis W Juma ¹, Benjamin H Opot ¹, Gladys Chemwor ¹, Mary Mutahi ³, Raphael Okoth ¹, Edwin W Mwakio ¹, Redemptah Yeda ¹, Charles O Okello ¹, Agnes Cheruiyot ¹, Duke Omariba ¹, Liliana Dayo ⁴, Hellen A Ogola ⁴, Gladys Biwott ¹, Charles Adega ¹, Fredrick Oluoch ⁴, Vincent Omondi ⁴, George Otieno ⁴, Edwin Kamau ⁵, Ben Andagalu ¹, Peter Sifuna ¹, Amanda Roth ⁶, Sammy Khagayi ⁷, Eric C Garges ⁸, Bernhards Ogutu ⁹, Hoseah M Akala ^1,^*

Editor: Kristan Alexander Schneider¹⁰

¹ Department of Emerging and Infectious Diseases, Walter Reed Army Institute of Research-Africa/Centre for Clinical Research, Kenya Medical Research Institute, Kisumu, Kenya

² Department of Infectious Disease Epidemiology, Medical Research Council, Centre for Global Infectious Disease Analysis, Imperial College London, London, England

³ The Kenya Medical Research Institute (KEMRI) / Wellcome Trust Research Programme, Centre for Geographic Medicine Research-Coast, Kilifi, Kenya

⁴ Department of Health County Government of Kisumu, Ministry of Health, Nairobi, Kenya

⁵ Department of Pathology and Laboratory Medicine, Tripler Amy Medical Center, Honolulu, Hawaii, United States of America

⁶ Medical Communications for Combat Casualty Care, Fort Detrick, Maryland, United States of America

⁷ Centre for Global Health Research, Kenya Medical Research Institute, Kisumu, Kenya

⁸ Walter Reed Army Institute of Research-Africa, Nairobi, Kenya

⁹ Centre for Clinical Research, Kenya Medical Research Institute, Nairobi, Kenya

¹⁰The University of New Mexico, UNITED STATES OF AMERICA

Competing Interests: The authors have declared that no competing interests exist.

^✉

* E-mail: Hoseaakala@yahoo.com, Hosea.akala@usamru-k.org

Roles

Jackline A Juma: Conceptualization, Data curation, Formal analysis, Methodology, Writing – original draft, Writing – review & editing

Oliver J Watson: Formal analysis, Software, Writing – original draft, Writing – review & editing

Dennis W Juma: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Writing – original draft, Writing – review & editing

Benjamin H Opot: Data curation, Formal analysis, Methodology, Supervision, Writing – original draft, Writing – review & editing

Gladys Chemwor: Formal analysis, Methodology, Writing – original draft, Writing – review & editing

Mary Mutahi: Formal analysis

Raphael Okoth: Methodology, Writing – original draft, Writing – review & editing

Edwin W Mwakio: Methodology, Writing – original draft, Writing – review & editing

Redemptah Yeda: Methodology, Writing – original draft, Writing – review & editing

Charles O Okello: Methodology, Writing – original draft

Agnes Cheruiyot: Methodology, Writing – original draft, Writing – review & editing

Duke Omariba: Project administration, Writing – original draft

Liliana Dayo: Writing – original draft, Methodology

Hellen A Ogola: Writing – original draft, Methodology

Gladys Biwott: Methodology, Writing – review & editing

Charles Adega: Methodology, Writing – original draft

Fredrick Oluoch: Writing – original draft

Vincent Omondi: Writing – original draft, Methodology

George Otieno: Writing – original draft

Edwin Kamau: Investigation, Writing – original draft, Writing – review & editing, Conceptualization

Ben Andagalu: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Project administration, Resources, Writing – original draft, Writing – review & editing

Peter Sifuna: Formal analysis, Writing – original draft, Writing – review & editing

Amanda Roth: Writing – review & editing, Writing – original draft

Sammy Khagayi: Formal analysis, Writing – original draft, Writing – review & editing, Conceptualization

Eric C Garges: Writing – review & editing, Writing – original draft

Bernhards Ogutu: Writing – original draft, Writing – review & editing, Conceptualization

Hoseah M Akala: Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

Kristan Alexander Schneider: Editor

PMCID: PMC13645224 PMID: 42842695

Abstract

Plasmodium falciparum (Pf), Plasmodium ovalewallikeri (Pow), Plasmodium ovalecurtisi (Poc), and Plasmodium malariae (Pm) coexists in Kenya sympatrically. Some infections progress to classical symptoms of malaria prompting hospital visits, while others remain asymptomatic. There is limited information on whether the species composition status of infections in endemic areas influences progression to either asymptomatic or symptomatic infection. This cross-sectional study determined the composition of Plasmodium species among symptomatic versus asymptomatic participants in Kombewa, Kenya. Between 2015 and 2016, samples from 741 individuals, comprising of 437 from symptomatic participants at Kombewa Subcounty hospital and 304 from asymptomatic participants from within Kombewa Subcounty hospital’s catchment area were analyzed for Plasmodium species composition using real-time qPCR assay targeting the small subunit ribosomal RNA (ssrRNA) gene. R Studio was used to describe Plasmodium species prevalence, and the odds of occurring within a given infection presentation. Co-infection analysis revealed 741 samples predominantly contained Pf 655/741 (88.3%) followed by Pow 153/741 (20.6%), Pm 70/741 (9.4%) and Poc 64/741 (8.6%); 12/741 (1.62%) samples did not amplify any species. A total of 535/741 (72.2%) samples contained single species, and 194/741 (26.18%) samples contained multiple species. Species distribution differed significantly, with Pf and Pow more prevalent in symptomatic cases, while Pm and Poc were more common in asymptomatic individuals (p = 0.000). Pm and Poc single-species infections occurred among asymptomatic infections only. There were significantly higher odds of multiple species occurrence for infections containing Pf/Pow 92 (95.8%) among symptomatic than asymptomatic infections (OR 1.5, 95% CI [1.36–1.65], p = 0.000). Overall, mixed-species infections involving Pf and Pow were significantly more common in symptomatic individuals, posing a risk of false diagnosis by Pf-Histidine-Rich Protein 2 test. This underscores the need for deployment of interventions that target all Plasmodium species. These findings on the burden across symptomatic vs asymptomatic infections suggest a need for determination of the role of species composition in disease progression.

Introduction

Human malaria infection is attributed to six Plasmodium species namely, P. falciparum, P. ovalecurtisi, P. ovalewallikeri, P. malariae, P.vivax and P. knowlesi [1–4]. P. ovalewallikeri and P. ovalecurtisi are now considered two morphologically identical but distinct species and the names P. ovalewallikeri and P. ovalecurtisi are preferred over the classical trinominal names. The burden of these species in natural infections varies globally [5, 6], along with their key vectors [7].

P. falciparum is responsible for the most severe form of disease and is the most prevalent in Sub-Saharan Africa [8] where it causes the highest number of fatalities globally [8]. Plasmodium vivax is the second most dominant species that causes recurring malaria, with the highest burden in Asia and South America, and in Africa it is mainly in Ethiopia and Sudan [9]. The less prevalent species, P. ovalewallikeri and P. ovalecurtisi, occur primarily in Africa [10, 11]. P. malariae is predominantly found in South America, Asia, and Africa, and occurs mainly as mixed infections with P. falciparum at a lower frequency [12]. Consequently, the burden and severity of disease caused by non-falciparum species, which are generally presumed to be milder than those associated with P. falciparum, remain poorly characterized in endemic human populations [13–15].

The World Health Organization recommends that all suspected malaria cases receive an accurate parasitological test to confirm infection before antimalarial treatment is administered [16–22]. However, the parasitological diagnosis methods [23, 24], are less accurate in the diagnosis of low parasitemia [25] and distinguishing infecting species [26] in asymptomatic individuals [27] and therefore likely to underestimate the burden and complexity of infection in the population [28, 29]. These methods, therefore, have limited utility in pre-elimination settings. The innovation of molecular diagnostic methods capable of detecting subclinical and submicroscopic Plasmodium infections [30, 31], which serve as reservoirs for ongoing transmission [32], is emerging as an important surveillance tool for malaria elimination strategies [33–36].

In Kenya, P. falciparum infection occurs predominantly as a mono-infection or sympatrically with P. malariae and P. ovalewallikeri, and P. ovalecurtisi. This co-endemicity of species leads to the occurrence of blood-stage mixed Plasmodium species infections [37], which are mostly acquired from separate inoculations when a recently acquired infection of one species might supervene a chronic infection with another [38] or simultaneous inoculation of the sporozoites of two or more species from a doubly infected Anopheles mosquito [38–40]. Studies have highlighted variations in the clinical presentation of disease per species relative to the unique parasite biology of each malaria species. Evaluating the species composition of infections among symptomatic individuals seeking care at health facilities and asymptomatic individuals within households is essential for understanding and addressing the rising prevalence of non-Plasmodium falciparum species in the context of improved access to accurate diagnosis and timely treatment, which are key for transitioning regions with declining malaria to pre-elimination.

Clinical symptoms of malaria typically develop between 7 and 85 days after initial infection, depending on the infecting Plasmodium species [41–45]. Parasitemia may also persist in susceptible individuals for up to eight years before the onset of symptoms [44–47]. Initial symptoms of malaria may include a high temperature of 38°C and above, muscle pains, and generally feeling unwell, often characterized by recurrent fever and chills [44], which often trigger a treatment-seeking response [22] once parasite replication becomes synchronous. In some cases, the infection may generate malarial parasitemia in the absence of fever or other classical symptoms and signs, in otherwise healthy individuals, therefore regarded as asymptomatic Plasmodium parasite carriers [23, 48, 49]. Asymptomatic Plasmodium infections account for up to 60% of infections [50–53] in some regions. It has been suggested that infections remain asymptomatic due to sustained submicroscopic peripheral parasitemia [54, 55], older age, and therefore partial immunity of the infected individual [56, 57], and varying malaria pyrogenic threshold [58, 59]. In a 2011 study, the complex interactions between infecting Plasmodium species [58, 60], were shown to affect the disease outcome such as the occurrence of symptoms [61] and transmissibility, bringing in to focus the role of these interactions in either limiting or promoting disease progression.

In a region with natural infections comprising more than one Plasmodium species [62, 63], there is uncertainty about whether infection with multiple species reduces or promotes the incidence of symptoms in the infected individual as a means of maintaining transmissibility. Our previous study showed the prevalence of Plasmodium species co-infections changes over time, among symptomatic individuals seeking for treatment at selected hospitals across Kenya [64], but did not describe the burden among asymptomatic infections. Given the varying disease progression among Plasmodium species such as longer period of case management for relapsing species, estimating of the burden of species in the population is useful in informing choice of intervention needed to lower malaria in line with the WHO goal that targets 90% reduction of malaria by 2030. This study aimed to estimate the composition of Plasmodium parasite species among symptomatic versus asymptomatic infections in Kisumu County in western Kenya.

Materials and methods

Ethical considerations

Ethical approval was obtained from Kenya Medical Research Institute (KEMRI), Scientific and Ethics Review Unit (SERU), and Walter Reed Army Institute of Research (WRAIR) institutional review boards (protocol numbers: KEMRI 1330/WRAIR 1384 and KEMRI 2721/ WRAIR 2064. A written informed consent /assent was obtained from each of the study participants. The confidentiality of information obtained from study participants was assured by using unique identifiers.

Study site and sample collection

Kombewa Health and Demographic Surveillance System (HDSS) grew out of the Kombewa Clinical Research Centre in 2007 and has since established itself as a platform for conducting nested studies and local disease surveillance, according to a study by Sifuna and co-workers. This study was conducted within Kombewa HDSS, which forms the main catchment of the malaria cases for the Kombewa Sub-County hospital, an area that is categorized as a rural Lake Endemic Zone with perennial and intense malaria transmission as per the National Malaria Control Programme 2016 (NMCP).

This sub-study analysed Plasmodium-positive samples obtained from two studies that were conducted concurrently between 2015 and 2016. The first study was entitled “Epidemiology of malaria and drug sensitivity patterns in Kenya”, which commenced from 1^st September 2015–1^st June 2016. The second study was entitled, “Baseline Epidemiology of Malaria Gametocyte Carriage and Transmission Dynamics in a Holoendemic Transmission Setting in Kisumu County, Western Kenya”, which commenced on 18^th March 2015–1^st February 2016.

The first study enrolled symptomatic participants aged six months and above presenting at Kombewa Sub-County Hospital with symptoms consistent with uncomplicated malaria, characterized by symptomatic, laboratory-confirmed Plasmodium infection in a patient who had no clinical or laboratory evidence of severe malaria or vital organ dysfunction and able to tolerate oral antimalarial therapy. These individuals presented with clinical features including fever (≥37.5 °C) or a history of fever within the preceding 48 hours accompanied by symptoms such as Chills, rigors, sweating, Headache, Malaise, fatigue Myalgia and arthralgia, Nausea and/or vomiting [65] Participants who were clinically stable, consistent with uncomplicated malaria, and who tested positive for malaria by rapid diagnostic test (RDT) and/or microscopy were eligible for inclusion. Under this study, these individuals were referred to as symptomatic malaria participants. These individuals were enrolled into the study upon providing written informed consent/assent. Each participant provided 2–3 ml of whole blood for malaria parasite species genotyping alongside other endpoints of the main study reported elsewhere [66, 67]. All Plasmodium Plasmodium positive cases were treated with artemether-lumefantrine (AL) (Coartem®), as per the Kenya Ministry of Health’s recommended case management guidelines for uncomplicated malaria. The healthcare workers administered and observed the taking of the first dose of AL 20 mg/120 mg tablets.

The second study enrolled asymptomatic participants and sought to estimate the level of gametocyte carriage in the study population by PCR. These comprised individuals of all ages, without clinical features suggestive of malaria, such as fever (≥37.5 °C) or history of fever within the previous 48 hours, and absence of symptoms such as chills, headache, malaise, or sweating. Under this study, these individuals were referred to as asymptomatic malaria participants. Members of selected households within Kisumu West sub-County, which is the main catchment for the Kombewa sub-County hospital (Fig 1 Map of Kombewa), willing to be tested for the presence of malaria parasites were enrolled into the study upon providing written informed consent/assent. During this household visit, vital signs were measured to rule out symptoms of malaria. Based on these readouts, each of the otherwise healthy participants provided 4 ml of whole blood for the diagnosis of malaria. Each sample was tested within 24 hours, and all participants found to have Plasmodium genus infection were treated with the attending healthcare worker administering the first dose of AL 20 mg/12 mg tablets.

Fig 1 — This shows Kombewa region where Kombewa sub-County hospital is located. Map data from OpenStreetMap (https://www.openstreetmap.org/copyright). The base maps used in all three images in Figure 1 were obtained from Open AFRICA. *This map was custom generated in-house using the ArcGIS Version 10.3.1 (Environmental Systems Research Institute, Red-lands, CA, USA) software.

Molecular assay

Nucleic acids extraction.

The parasite nucleic acids were extracted from blood samples obtained from individuals enrolled in the two studies using a commercial extraction kit (QIAamp DNA Blood Mini Kit, Qiagen) as recommended by the manufacturer’s instructions.

Plasmodium genus diagnosis by molecular methods.

The extracted nucleic acids were analysed for malaria diagnosis using Plasmodium genus-specific qPCR assay as previously described [68, 69]. PCR amplified the Plasmodium genus 18S ribosomal ribonucleic acid (rRNA) gene using primers listed in Table 1. The RNase P gene, which is a human housekeeping gene, was used as an extraction and qPCR assay control.

Table 1. Primers and probes used for screening and identification of Plasmodium species.

Primers Probes	Sequence 5’-3’	Target genus/species
PLU F	GCTCTTTCTTGATTTCTTGGATG	Plasmodium spp.
PLU R	AGCAGGTTAAGATCTCGTTCG	Plasmodium spp.
PLU P	ATGGCCGTTTTTAGTTCGTG	Plasmodium spp.
RNaSP F	TGTTTGCAGATTTGGACCTGC	Human RNase p
RNaSeP R	AATAGCCAAGGTGGAGCGGCT	Human RNase p
RNaseP P	TGCGCGGACTTGTGGA	Human RNase p
FAL F	ATTGCTTTTGAGAGGTTTTGTTACTT	P. falciparum
FAL R	GCTGAGTATTCAAACACAATGAACTCAA	P. falciparum
FAL P	CATAACAGACGGGTAGTCAT	P. falciparum
MAL F	GCATGGAATTTTGTTACTTTGA	P. malariae
MAL R	ATGCCTGTAGTATTCAACACAGAAAC	P. malariae
MAL P	TGTTCAAAGCAAACAGTTAAAACA	P. malariae
OVA F	TTTTGAAGAATACATTAGGATACAATTAATG	P. ovale curtisi
OVA R	CATGCTTCCTCTAAGAAGCTTTACAAT	P. ovale
OVA-V F	TTTTGAAGAATATATTAGGATACATTATAG	P. ovale Wallikeri
OVA-V R	CATCGTTCCTCTAAGAAGCTTTACAAT	P. ovale Wallikeri
OVA P	CCTTTTCCCTATTCTACTTAATTCGCAATTCATG	P. ovale curtisi
OVA-V P	CCTTTTCCCTACTTAATTCGCTATTCATTG	P. ovale Wallikeri

Open in a new tab

Detection of species composition of infections.

All samples that were diagnosed as positive for the Plasmodium genus were further characterized for species composition as described by [68, 69], using a separate set of primers indicated in Table 1. The assays for characterization of Plasmodium falciparum and P. malariae had similar PCR reaction components and conditions as the genus-specific qPCR assay except for the primers used. Genus-specific primers were replaced respectively by the species-specific primers [30, 70], (Table 1). Each experiment included at least one reaction mixture without DNA as a negative control.

Data management and statistical analysis

Descriptive analyses were used to describe categorical data comprising age categories, gender, and qPCR species results summarized as frequencies and proportions. Continuous variables, including age in years, were first assessed for normality using the Shapiro–Wilk test and then expressed as median together with their corresponding interquartile ranges (IQR) when non-normal distributions were observed. The geometric mean was used as a measure of central tendency for parasite density.

Descriptive statistics were employed to illustrate the burden of Plasmodium species among the participants with positive infections. For inferential statistics, proportions were compared using the Chi-square test as appropriate for the categorical data. Wilcoxon rank-sum test was used for non-parametric continuous variables. Logistic regression analysis was also conducted to assess the varying odds of Plasmodium species composition. All analyses were performed using R Studio version 4.5.1. Statistical analyses were performed at the 5% significance level and the corresponding 95% confidence interval (CI). The critical significance level was set at p ≤ 0.05.

Results

A total of 741 samples comprising 437 (58.9%) of symptomatic participants and 304 (41.0%) of the asymptomatic participants were analyzed. The description of the study population is summarized in Table 2. Metadata was available for 733/741 participants though species analyses data was available for all the 741 samples. The median ages for all age categories and number of participants per age category varied significantly across the two infections presentations χ² test p = 0.000 (Table 2). The categories of less than 5 years were highest in symptomatic infections, 258 (79.4%) while over 18 years were highest in asymptomatic infections 81 (66.9%) (Table 2). Wilcoxon rank-sum test revealed a significantly higher age among the asymptomatic, median 9 years; IQR, 5–20.5 than symptomatic 4 years; IQR, 3–6, p = 0.000, r = 0.38. Gender was comparable between the symptomatic and asymptomatic infections. The geometric mean of parasite density per microliter of blood was significantly higher among the symptomatic (47504.83/ul, 95%CI 39131.25–57670.26) than asymptomatic infections (784.11/ul, 95%CI 784.11–1667.1) (Table 2).

Table 2. Participants Metadata. Metadata for symptomatic and asymptomatic Plasmodium infections.

Variable	Symptomatic	Asymptomatic	p value
Age years:
median (IQR)	4 (3–6)	9 (5–21)	0.000
Age category:
<5 years (n)%	258 (79.38)	67 (20.62)	0.000
5-18 years (n)%	131 (45.64)	156 (54.36)
>18 years (n)%	40 (33.06)	81 (66.94)
Gender:
Male (n)%	195 (60.56)	127 (39.44)	0.323
Female (n)%	234 (56.93)	177 (43.07)
Parasite density:
Geometric mean	47504.83	1143.33	0.000
(95% CI)	(39131.25-57670.26)	(784.11-1667.107)

Open in a new tab

Plasmodium co-infections analyses were conducted, and the species composition analyses detected the presence of single Plasmodium species in most infections and presence of two or three or four Plasmodium species in a subset of infections. Therefore, computing the raw frequencies of any detection of Plasmodium species yielded varying percentages that cumulatively exceeded 100%, consistent with the expected classification of infections containing multiple species under two or more species profiles. On this basis, Plasmodium species detection by qPCR assay showed that, 655/741 (88.3%) of the infections contained P. falciparum, 153/741 (20.7%) P. ovalewallikeri, 70/741 (9.4%) P. malariae, and 64/741 (8.7%) P. ovalecurtisi without consideration of the number of species per infection (Table 3). However, 12/741 (1.6%) of the samples that amplified for presence of Plasmodium genus did not amplify for any species.

Table 3. Overall Plasmodium species frequency. Overall Plasmodium species frequency detected in the samples.

Species	n	%
P. falciparum	655	88.4
P. ovalewallikeri	153	20.7
P.malariae	70	9.5
P.ovalecurtisi	64	8.7

Open in a new tab

Subsequent analysis with a focus on the presence or absence of more than one species per infection revealed that a total of 535/741 (72.2%) samples had single species while 194/741 (26.1%) had multiple species infections. P. falciparum was the most frequent single-species infection occurring in 470/535 (87.9%) infections, followed by P. ovalewallikeri in 34/535 (6.4%), P. malariae in 18/535 (3.4%), and P. ovalecurtisi in 13/535 (2.4%). Notably, all the P. malariae and P. ovalecurtisi single-species infections were detected among asymptomatic infections only. Multiple species infections included Pf/Pow 96/194 (49.5%), being dominant followed by Pf/Pm 41/194 (21.1%), Pf/Poc 30/194 (15.5), Pf/Pow/Poc 15/194 (7.7%), Pm/Pow 5/194 (2.6%), Pf/Pm/Poc 2/194 (1.0%), Pm/Poc 2/194 (1.0%), Pf/Pm/Pow 1/194 (0.5%), Pm/Poc/Pow 1/194 (0.5%), Pow/Poc 1/194 (0.5%).

Symptomatic infections

Assessment of frequency of single Plasmodium species showed that P. falciparum 262/437 (60%) and P. ovale wallikeri 15/437 (3.4%) were the only single species detected among the symptomatic infections (Fig 2). The symptomatic individuals harbored multiple Plasmodium species, comprising 2 species; PfPow 92/437 (21.1%), PfPm 28/437 (6.4%), PfPoc 22/437 (5%), PowPoc 1/437 (0.2%), while three species included; PfPowPoc 15/437 (3.4%), PfPmPoc 2/437 (0.5%) (Fig 2). Further, neither P. ovalecurtisi nor P. malariae occurred as a single species infection among symptomatic participants during this study period (Fig 2).

Fig 2 — Symptomatic infections refer to infections that generate malarial parasitemia alongside symptoms.

Asymptomatic infections

Single Plasmodium species infections included P. falciparum detected in 218/304 (71.7%) of the asymptomatic infections as the most prevalent species, followed by P. ovalewallikeri 18/304 (5.9%), P. malariae 16/304 (5.3%), and P. ovalecurtisi 15/304 (4.9%), respectively (Fig 3). Multiple species infections comprised of double species; PfPm 14/304 (4.6%), PfPoc 8/304 (2.6%), PmPow 5/304 (1.6%), PfPow 5/304 (1.6%), PmPoc 2/304 (0.7%), or triple species PfPmPow 2/304 (0.7%) and PmPocPow 1/304 (0.3%) infections (Fig 3).

Fig 3 — Asymptomatic *Plasmodium* parasite carriers are the infections that generate malarial parasitemia in the absence of fever or other classical symptoms and signs, in otherwise healthy individuals.

The P. falciparum single-species infections were more prevalent in asymptomatic than symptomatic individuals (Figs 2 and 3). Multiple species were more likely to be symptomatic than asymptomatic infections. Assessment of the role of infection composition in disease presentation showed that P. falciparum with P. ovalewallikeri; P. falciparum with P. ovalecurtisi, and P. falciparum, P. ovalewallikeri with P. ovalecurtisi mixed-species infections had higher odds of progressing to symptomatic infection than remaining asymptomatic (Fig 4). The mixed species had increased odds of symptomatic infection (Fig 4).

Fig 4 — The blue represents no significant association, while the red color represents a significant association.

Discussion

This study concurrently compared the prevalence of Plasmodium species among symptomatic individuals seeking treatment at the Kombewa Sub-County hospital versus asymptomatic individuals in households within the same geographic location that doubles up as the catchment of the hospital using qPCR. About 13% and 26% prevalence of multiple species was detected among asymptomatic and symptomatic infections, respectively. Studies in West and Central Africa focusing on school-going children have also shown a higher burden of non-falciparum species in asymptomatic Plasmodium parasite carriers [52, 53]. This finding is contrary to a recent meta-analysis showing no difference in the prevalence of either P. malariae or P. ovale spp between symptomatic and asymptomatic individuals [71]. Additionally, large-scale studies of non-falciparum parasites report conflicting results for those from West Africa [72] versus those from central or East Africa [73]. These varying observations underscore the peculiarity of Plasmodium infection presentation across different disease endemicities and are evocative of the need for characterizing species composition in diverse disease geo-ecotypes for effective targeting.

The occurrence of Plasmodium parasitemia in the absence of classical malaria symptoms, and the mechanisms that influence the transition from an asymptomatic infection to symptomatic infection, remain subjects of ongoing debate. A prospective study by Chen and coworkers showed that some individuals harboring Plasmodium parasites can either remain healthy for an unlimited amount of time and are referred to as asymptomatic [23] while others progress to disease with malaria symptoms within 7–85 days and seek for the treatment depending on various factors, including the species composition of the infection [49, 60, 74, 75]. This study detected a higher frequency of mixed species infection among symptomatic than asymptomatic individuals, an observation that appears to align with the theory that harboring multiple species potentiates the transition of infections to the symptomatic phase.

Studies on inter-parasite interactions within human hosts suggest that parasites often interact with unrelated competitors within the host [76] and use this mechanism to prioritize the resource allocation framework, opting to increase replication to occupy most of the red blood cells at the expense of the development of sexual stages as one of the exclusion strategies. The changes in resource utilization resulting from the presence of the additional species have been associated with modulation of the host response [61, 77–79], toward either the persistence of the asymptomatic phase of the infection [80] or progression to symptomatic disease in the presence of virulence-enhancing species mixtures [81]. The detection of a higher frequency of multiple species infections among the symptomatic than asymptomatic, with a reciprocal higher frequency of single species infections in asymptomatic than symptomatic, by this study appears to suggest that infection with more than one species is likely to progress to a more symptomatic state than single-species infections as reported elsewhere [28, 29]. It was, however, surprising that asymptomatic individuals harbored more diverse species profiles than symptomatic individuals based on PCR-based diagnosis.

The composition of mixed species infections varied significantly between the symptomatic and asymptomatic infections. For example, there was a ten-fold higher prevalence of co-infections containing P. falciparum and P. ovalewallikeri among the symptomatic individuals than among the asymptomatic individuals. A similar pattern of frequency was observed among infections containing P. falciparum, P. ovalewallikeri, plus P. ovalecurtisi, contrary to P. falciparum/P. ovalecurtisi, or P. falciparum/P. malariae or either of these species in single-species infections, an observation that may suggest between-species interactions.

Evidence from malaria ecology indicates that the acquisition of an additional Plasmodium species within a host can modify the within-host ecological environment by introducing competition for limited resources such as red blood cells. For example, in mixed-species infections involving human malaria parasites, including P. falciparum and P. vivax, parasites may compete for host erythrocytes and other resources, which can alter parasite replication dynamics and suppress the density of competing species. These competitive interactions may consequently influence parasite fitness, disease outcomes, and transmission potential [82]. Parasite biology studies show that P. falciparum attacks all ages of red blood cells, hence it has been hypothesized to be a “generalist” while P. ovale and P. malariae attack younger and older red blood cells, respectively, and are hypothesized to be specialists [80, 81, 83].

Studies show that in mixed-species infections, the presence of an RBC Plasmodium species regarded as “generalists” enhances the density of RBC specialists [79]. A study monitoring blood levels of tumor necrosis factor-alpha (TNF-alpha), lactate dehydrogenase (LDH), Thrombin-antithrombin III (TAT) and elastase as drivers of malaria symptoms through modulation of host immune response among uncomplicated malaria was conducted [81, 84]. The study further noted that these parameters were higher per parasitized P. ovale erythrocyte levels than P. falciparum, with the former attaining full-strength host response at lower parasitemia than the latter [81]. Observation of significantly higher frequency P. falciparum and P. ovalewallikeri among naturally acquired symptomatic than asymptomatic infection by this study suggests that parasitemia increases in P. ovalewallikeri, a specialist, given the presence of P. falciparum a generalist, could be contributing to elevated immune response leading to the occurrence of symptoms among these infections. This phenomenon, which is absent in P. ovalecurtisi infections, highlights the biological differences between the two P. ovale species. Notably, P. ovalewallikeri single-species infections were detected among symptomatic as well as asymptomatic infections while P. ovalecurtisi alone was not detected among the symptomatic, suggesting that P. ovalewallikeri alone causes symptoms more frequently than P. ovalecurtisi among individuals.

Single-species infections of P. falciparum, P. malariae, or P. ovalecurtisi were mostly detected among asymptomatic individuals than symptomatic. Notably, P. ovalecurtisi single-species infections were detected in 4.8% of the asymptomatic infections while none was detected in symptomatic infections. Additionally, infections comprising P. malariae/P. ovalecurtisi or P. malariae/P. ovalewallikeri were detected in asymptomatic infections at less than 2% frequency while none were detected among symptomatic infections. P. malariae co-infections with P. ovalecurtisi or P. ovalewallikeri have been associated with low pyrogenic thresholds, occurring in less than 2% of the symptomatic cases [80]. This infection characteristic is a challenge for malaria elimination since the chronically infected individual would remain obscure to healthcare facilities while still capable of transmitting the parasite to mosquitoes and therefore sustaining transmission to humans. Such infections have been proposed as the last battlefield for malaria elimination [85] since they will also remain undetected by the histidine-rich protein based malaria rapid diagnostic test that are expedient for population-based strategies of bringing down diseases.

This study has some limitations. The study depended on the vital signs of the participants at the time of enrolment such as fever ≥37.5 °C or a history of fever within the preceding 48 hours accompanied by symptoms such as chills, headache, malaise, or sweating, to be categorized as symptomatic participants, while those without these signs were categorized as asymptomatic. Because of the study design, it was difficult to determine when, specifically, the time-point in the previous period preceding enrolment day, at which either the asymptomatic or symptomatic individuals acquired the infection. Consequently, it was not possible to establish whether individuals with asymptomatic infections would subsequently develop symptoms as parasite densities increased to the pyrogenic threshold, or whether the infections in these individuals were chronic and would remain asymptomatic. It was again not possible to ascertain which of the infecting species in individuals harbouring multiple species infections came first and which one came later. This, therefore, made it harder to tell whether there was protectiveness proffered by some species or immune silencing by other species to delay symptoms, or associate entry of a given species with the onset of symptoms. Further, the study was not able to filter out and show within-host response to varying species composition of infections or between-species interactions within each of the mixed infection profiles to filter out specific parasite species-specific biology that infer implication to the progression of disease or epidemiology of each of the species versus presently deployed malaria interventions. Finally, host immunity was not characterized in this study because it was not one of the endpoints for the study.

Conclusion

These findings in a malaria-endemic zone suggest that intervention strategies need to consider the species composition of asymptomatic Plasmodium parasite infections to progress the region to the elimination phase. The ten-fold higher frequency of P. ovalewallikeri species among the symptomatic than asymptomatic infections and higher P. falciparum single-species infections in the asymptomatic than symptomatic appears to associate this infection composition with higher likelihood of symptoms. Interventions need to focus on the mixed infections asymptomatic Plasmodium parasite carriers since these two serves as silent reservoirs for transmission and are a lynchpin to malaria elimination in a given region.

Acknowledgments

Material has been reviewed by the Walter Reed Army Institute of Research. There is no objection to its presentation and/or publication. The opinions or assertions contained herein are the private views of the author, and are not to be construed as official, or as reflecting true views of the Department of the Army or the Department of Defense. The investigators have adhered to the policies for protection of human subjects as prescribed in AR 70–25. We thank the individuals who participated in this study for providing these invaluable samples and time to generate these findings. We also thank the County Government of Kisumu and the Ministry of Health, Kenya, for giving us access to these samples. We thank the Commander, Walter Reed Army Institute of Research – Africa, COL. Lacy Shannon, Director, Walter Reed Army Institute of Research – Africa, Kisumu Field Stations, COL. Gerald Keller, Deputy Director General, Center for Clinical Research, Kenya Medical Research Institute, Kenya, for supporting this study and giving their permission to publish these data. We also thank all clinical staff at all the participating hospitals for their assistance.

Data Availability

All relevant data are within the paper.

Funding Statement

Funding for this study was provided by the Armed Forces Health Surveillance Branch and its Global Emerging Infections Surveillance Section, P0209_15_KY, Dr. Hoseah M. Akala. The study sponsors had no role in study design; in the collection, analysis, and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication.

References

1.Ansari HR, Templeton TJ, Subudhi AK, Ramaprasad A, Tang J, Lu F, et al. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species. Int J Parasitol. 2016;46(11):685–96. doi: 10.1016/j.ijpara.2016.05.009 [DOI] [PubMed] [Google Scholar]
2.Antinori S, Galimberti L, Milazzo L, Corbellino M. Plasmodium knowlesi: the emerging zoonotic malaria parasite. Acta Trop. 2013;125(2):191–201. doi: 10.1016/j.actatropica.2012.10.008 [DOI] [PubMed] [Google Scholar]
3.Snounou G, Sharp PM, Culleton R. The two parasite species formerly known as Plasmodium ovale. Trends Parasitol. 2024;40(1):21–7. doi: 10.1016/j.pt.2023.11.004 [DOI] [PubMed] [Google Scholar]
4.Higgins M, Manko E, Ward D, Phelan JE, Nolder D, Sutherland CJ, et al. New reference genomes to distinguish the sympatric malaria parasites, Plasmodium ovale curtisi and Plasmodium ovale wallikeri. Sci Rep. 2024;14(1):3843. doi: 10.1038/s41598-024-54382-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Organization WH. WHO guidelines for malaria. World Health Organization. 2025. [Google Scholar]
6.Weiss DJ, Dzianach PA, Saddler A, Lubinda J, Browne A, McPhail M, et al. Mapping the global prevalence, incidence, and mortality of Plasmodium falciparum and Plasmodium vivax malaria, 2000–22: a spatial and temporal modelling study. The Lancet. 2025;405(10483):979–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Sinka ME, Bangs MJ, Manguin S, Rubio-Palis Y, Chareonviriyaphap T, Coetzee M, et al. A global map of dominant malaria vectors. Parasit Vectors. 2012;5:69. doi: 10.1186/1756-3305-5-69 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Weiss DJ, Lucas TC, Nguyen M, Nandi AK, Bisanzio D, Battle KE. Mapping the global prevalence, incidence, and mortality of Plasmodium falciparum, 2000–17: a spatial and temporal modelling study. The Lancet. 2019;394(10195):322–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Battle KE, Lucas TC, Nguyen M, Howes RE, Nandi AK, Twohig KA. Mapping the global endemicity and clinical burden of Plasmodium vivax, 2000–17: a spatial and temporal modelling study. The Lancet. 2019;394(10195):332–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Price RN, Commons RJ, Battle KE, Thriemer K, Mendis K. Plasmodium vivax in the Era of the Shrinking P. falciparum Map. Trends in Parasitology. 2020;36(6):560–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Mahittikorn A, Masangkay FR, Kotepui KU, Milanez GDJ, Kotepui M. Comparison of Plasmodium ovale curtisi and Plasmodium ovale wallikeri infections by a meta-analysis approach. Sci Rep. 2021;11(1):6409. doi: 10.1038/s41598-021-85398-w [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Sutherland CJ. Persistent Parasitism: The Adaptive Biology of Malariae and Ovale Malaria. Trends Parasitol. 2016;32(10):808–19. doi: 10.1016/j.pt.2016.07.001 [DOI] [PubMed] [Google Scholar]
13.Diagne A, Sambe BS, Gaba FM, Sarr I, Diatta AS, Sadio O, et al. Variable effects of non-falciparum species infections on malaria disease severity in high transmission regions in Senegal. Trop Med Health. 2024;52(1):93. doi: 10.1186/s41182-024-00655-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Sendor R, Banek K, Kashamuka MM, Mvuama N, Bala JA, Nkalani M. Epidemiology of Plasmodium malariae and Plasmodium ovale spp. in Kinshasa Province, Democratic Republic of Congo. Nature Communications. 2023;14(1):6618. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Omondi P, Musyoka B, Okai T, Kongere J, Kagaya W, Chan CW. Non-random distribution of Plasmodium species infections and associated clinical features in children in the lake Victoria region, Kenya, 2012-2018. Trop Med Health. 2024;52(1):52. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Zarocostas J. Malaria treatment should begin with parasitological diagnosis where possible, says WHO. BMJ. 2010;340:c1402. doi: 10.1136/bmj.c1402 [DOI] [PubMed] [Google Scholar]
17.Newman RD. World Malaria Report 2011. 2012.
18.ACTwatch Group, Musuva A, Ejersa W, Kiptui R, Memusi D, Abwao E. The malaria testing and treatment landscape in Kenya: results from a nationally representative survey among the public and private sector in 2016. Malar J. 2017;16(1):494. doi: 10.1186/s12936-017-2089-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Kamal-Yanni MM, Potet J, Saunders PM. Scaling-up malaria treatment: a review of the performance of different providers. Malar J. 2012;11:414. doi: 10.1186/1475-2875-11-414 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Alonso P, Noor AM. The global fight against malaria is at crossroads. Lancet. 2017;390(10112):2532–4. doi: 10.1016/S0140-6736(17)33080-5 [DOI] [PubMed] [Google Scholar]
21.Larsen DA, Ngwenya-Kangombe T, Cheelo S, Hamainza B, Miller J, Winters A, et al. Location, location, location: environmental factors better predict malaria-positive individuals during reactive case detection than index case demographics in Southern Province, Zambia. Malar J. 2017;16(1):18. doi: 10.1186/s12936-016-1649-z [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Hamainza B, Moonga H, Sikaala CH, Kamuliwo M, Bennett A, Eisele TP, et al. Monitoring, characterization and control of chronic, symptomatic malaria infections in rural Zambia through monthly household visits by paid community health workers. Malar J. 2014;13:128. doi: 10.1186/1475-2875-13-128 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Chen I, Clarke SE, Gosling R, Hamainza B, Killeen G, Magill A, et al. “Asymptomatic” Malaria: A Chronic and Debilitating Infection That Should Be Treated. PLoS Med. 2016;13(1):e1001942. doi: 10.1371/journal.pmed.1001942 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Mueller I, Slutsker L, Tanner M. Estimating the burden of malaria: the need for improved surveillance. PLoS Med. 2011;8(12):e1001144. doi: 10.1371/journal.pmed.1001144 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Kamau E, Alemayehu S, Feghali KC, Saunders D, Ockenhouse CF. Multiplex qPCR for detection and absolute quantification of malaria. PLoS One. 2013;8(8):e71539. doi: 10.1371/journal.pone.0071539 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Veron V, Simon S, Carme B. Multiplex real-time PCR detection of P. falciparum, P. vivax and P. malariae in human blood samples. Exp Parasitol. 2009;121(4):346–51. doi: 10.1016/j.exppara.2008.12.012 [DOI] [PubMed] [Google Scholar]
27.Murray CK, Gasser RA Jr, Magill AJ, Miller RS. Update on rapid diagnostic testing for malaria. Clin Microbiol Rev. 2008;21(1):97–110. doi: 10.1128/CMR.00035-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Okyere B, Owusu-Ofori A, Ansong D, Buxton R, Benson S, Osei-Akoto A, et al. Point prevalence of asymptomatic Plasmodium infection and the comparison of microscopy, rapid diagnostic test and nested PCR for the diagnosis of asymptomatic malaria among children under 5 years in Ghana. PLoS One. 2020;15(7):e0232874. doi: 10.1371/journal.pone.0232874 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.van Eijk AM, Sutton PL, Ramanathapuram L, Sullivan SA, Kanagaraj D, Priya GSL, et al. The burden of submicroscopic and asymptomatic malaria in India revealed from epidemiology studies at three varied transmission sites in India. Sci Rep. 2019;9(1):17095. doi: 10.1038/s41598-019-53386-w [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Perandin F, Manca N, Calderaro A, Piccolo G, Galati L, Ricci L, et al. Development of a real-time PCR assay for detection of Plasmodium falciparum, Plasmodium vivax, and Plasmodium ovale for routine clinical diagnosis. J Clin Microbiol. 2004;42(3):1214–9. doi: 10.1128/JCM.42.3.1214-1219.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Kamau E, Tolbert LS, Kortepeter L, Pratt M, Nyakoe N, Muringo L, et al. Development of a highly sensitive genus-specific quantitative reverse transcriptase real-time PCR assay for detection and quantitation of plasmodium by amplifying RNA and DNA of the 18S rRNA genes. J Clin Microbiol. 2011;49(8):2946–53. doi: 10.1128/JCM.00276-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Ouédraogo AL, Eckhoff PA, Luty AJF, Roeffen W, Sauerwein RW, Bousema T, et al. Modeling the impact of Plasmodium falciparum sexual stage immunity on the composition and dynamics of the human infectious reservoir for malaria in natural settings. PLoS Pathog. 2018;14(5):e1007034. doi: 10.1371/journal.ppat.1007034 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Gholizadeh S, Naseri Karimi N, Zakeri S, Dinparast Djadid N. The Role of Molecular Techniques on Malaria Control and Elimination Programs in Iran: A Review Article. Iran J Parasitol. 2018;13(2):161–71. [PMC free article] [PubMed] [Google Scholar]
34.Tedla M. A focus on improving molecular diagnostic approaches to malaria control and elimination in low transmission settings: Review. Parasite Epidemiol Control. 2019;6:e00107. doi: 10.1016/j.parepi.2019.e00107 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Njuguna P, Maitland K, Nyaguara A, Mwanga D, Mogeni P, Mturi N, et al. Observational study: 27 years of severe malaria surveillance in Kilifi, Kenya. BMC medicine. 2019;17(1):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Cheaveau J, Mogollon DC, Mohon MAN, Golassa L, Yewhalaw D, Pillai DR. Asymptomatic malaria in the clinical and public health context. Expert review of anti-infective therapy. 2019;17(12):997–1010. [DOI] [PubMed] [Google Scholar]
37.Zimmerman PA, Mehlotra RK, Kasehagen LJ, Kazura JW. Why do we need to know more about mixed Plasmodium species infections in humans?. Trends in Parasitology. 2004;20(9):440–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Portugal S, Drakesmith H, Mota MM. Superinfection in malaria: Plasmodium shows its iron will. EMBO Rep. 2011;12(12):1233–42. doi: 10.1038/embor.2011.213 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Imwong M, Nakeesathit S, Day NPJ, White NJ. A review of mixed malaria species infections in anopheline mosquitoes. Malar J. 2011;10:253. doi: 10.1186/1475-2875-10-253 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Beier MS, Schwartz IK, Beier JC, Perkins PV, Onyango F, Koros JK, et al. Identification of malaria species by ELISA in sporozoite and oocyst infected Anopheles from western Kenya. Am J Trop Med Hyg. 1988;39(4):323–7. doi: 10.4269/ajtmh.1988.39.323 [DOI] [PubMed] [Google Scholar]
41.Verra F, Angheben A, Martello E, Giorli G, Perandin F, Bisoffi Z. A systematic review of transfusion-transmitted malaria in non-endemic areas. Malar J. 2018;17(1):36. doi: 10.1186/s12936-018-2181-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Orish V, Afutu L, Ayodele O, Likaj L, Marinkovic A, Sanyaolu A. A 4-day incubation period of Plasmodium falciparum infection in a nonimmune patient in Ghana: a case report. Open Forum Infectious Diseases. 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Okafor CN, Finnigan NA. Plasmodium ovale malaria. 2018. [PubMed]
44.Bartoloni A, Zammarchi L. Clinical aspects of uncomplicated and severe malaria. Mediterr J Hematol Infect Dis. 2012;4(1):e2012026. doi: 10.4084/MJHID.2012.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Krajden S, Panisko DM, Tobe B, Yang J, Keystone JS. Prolonged infection with Plasmodium falciparum in a semi-immune patient. Trans R Soc Trop Med Hyg. 1991;85(6):731–2. doi: 10.1016/0035-9203(91)90434-z [DOI] [PubMed] [Google Scholar]
46.Greenwood T, Vikerfors T, Sjöberg M, Skeppner G, Färnert A. Febrile Plasmodium falciparum malaria 4 years after exposure in a man with sickle cell disease. Clin Infect Dis. 2008;47(4):e39-41. doi: 10.1086/590250 [DOI] [PubMed] [Google Scholar]
47.Szmitko PE, Kohn ML, Simor AE. Plasmodium falciparum malaria occurring 8 years after leaving an endemic area. Diagn Microbiol Infect Dis. 2009;63(1):105–7. doi: 10.1016/j.diagmicrobio.2008.08.017 [DOI] [PubMed] [Google Scholar]
48.Moonen B, Cohen JM, Snow RW, Slutsker L, Drakeley C, Smith DL, et al. Operational strategies to achieve and maintain malaria elimination. Lancet. 2010;376(9752):1592–603. doi: 10.1016/S0140-6736(10)61269-X [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Lindblade KA, Steinhardt L, Samuels A, Kachur SP, Slutsker L. The silent threat: asymptomatic parasitemia and malaria transmission. Expert Review of Anti-Infective Therapy. 2013;11(6):623–39. [DOI] [PubMed] [Google Scholar]
50.Bottius E, Guanzirolli A, Trape JF, Rogier C, Konate L, Druilhe P. Malaria: even more chronic in nature than previously thought; evidence for subpatent parasitaemia detectable by the polymerase chain reaction. Trans R Soc Trop Med Hyg. 1996;90(1):15–9. doi: 10.1016/s0035-9203(96)90463-0 [DOI] [PubMed] [Google Scholar]
51.Rouamba T, Samadoulougou S, Ouédraogo M, Hien H, Tinto H, Kirakoya-Samadoulougou F. Asymptomatic malaria and anaemia among pregnant women during high and low malaria transmission seasons in Burkina Faso: household-based cross-sectional surveys in Burkina Faso, 2013 and 2017. Malar J. 2021;20(1):211. doi: 10.1186/s12936-021-03703-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Abdulraheem MA, Ernest M, Ugwuanyi I, Abkallo HM, Nishikawa S, Adeleke M, et al. High prevalence of Plasmodium malariae and Plasmodium ovale in co-infections with Plasmodium falciparum in asymptomatic malaria parasite carriers in southwestern Nigeria. Int J Parasitol. 2022;52(1):23–33. doi: 10.1016/j.ijpara.2021.06.003 [DOI] [PubMed] [Google Scholar]
53.Nundu SS, Culleton R, Simpson SV, Arima H, Muyembe J-J, Mita T, et al. Malaria parasite species composition of Plasmodium infections among asymptomatic and symptomatic school-age children in rural and urban areas of Kinshasa, Democratic Republic of Congo. Malar J. 2021;20(1):389. doi: 10.1186/s12936-021-03919-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Kho S, Qotrunnada L, Leonardo L, Andries B, Wardani PAI, Fricot A, et al. Evaluation of splenic accumulation and colocalization of immature reticulocytes and Plasmodium vivax in asymptomatic malaria: A prospective human splenectomy study. PLoS Med. 2021;18(5):e1003632. doi: 10.1371/journal.pmed.1003632 [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Pava Z, Handayuni I, Trianty L, Utami RA, Tirta YK, Puspitasari AM. Passively versus actively detected malaria: similar genetic diversity but different complexity of infection. The American Journal of Tropical Medicine and Hygiene. 2017;97(6):1788–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Buchwald AG, Sorkin JD, Sixpence A, Chimenya M, Damson M, Wilson ML, et al. Association Between Age and Plasmodium falciparum Infection Dynamics. Am J Epidemiol. 2019;188(1):169–76. doi: 10.1093/aje/kwy213 [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Worku L, Damtie D, Endris M, Getie S, Aemero M. Asymptomatic Malaria and Associated Risk Factors among School Children in Sanja Town, Northwest Ethiopia. Int Sch Res Notices. 2014;2014:303269. doi: 10.1155/2014/303269 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Kwiatkowski D, Nowak M. Periodic and chaotic host-parasite interactions in human malaria. Proc Natl Acad Sci U S A. 1991;88(12):5111–3. doi: 10.1073/pnas.88.12.5111 [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Mason DP, McKenzie FE. Blood-stage dynamics and clinical implications of mixed Plasmodium vivax-Plasmodium falciparum infections. Am J Trop Med Hyg. 1999;61(3):367–74. doi: 10.4269/ajtmh.1999.61.367 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Richie TL. Interactions between malaria parasites infecting the same vertebrate host. Parasitology. 1988;96 (Pt 3):607–39. doi: 10.1017/s0031182000080227 [DOI] [PubMed] [Google Scholar]
61.Bruce MC, Day KP. Cross-species regulation of malaria parasitaemia in the human host. Curr Opin Microbiol. 2002;5(4):431–7. doi: 10.1016/s1369-5274(02)00348-x [DOI] [PubMed] [Google Scholar]
62.Mayxay M, Pukrittayakamee S, Newton PN, White NJ. Mixed-species malaria infections in humans. Trends Parasitol. 2004;20(5):233–40. doi: 10.1016/j.pt.2004.03.006 [DOI] [PubMed] [Google Scholar]
63.Kotepui M, Kotepui KU, De Jesus Milanez G, Masangkay FR. Plasmodium spp. mixed infection leading to severe malaria: a systematic review and meta-analysis. Sci Rep. 2020;10(1):11068. doi: 10.1038/s41598-020-68082-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Akala HM, Watson OJ, Mitei KK, Juma DW, Verity R, Ingasia LA, et al. Plasmodium interspecies interactions during a period of increasing prevalence of Plasmodium ovale in symptomatic individuals seeking treatment: an observational study. Lancet Microbe. 2021;2(4):e141–50. doi: 10.1016/S2666-5247(21)00009-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Taylor-Robinson D, Jones K, Garner P. Malaria: uncomplicated, caused by Plasmodium falciparum. BMJ Clin Evid. 2007;2007:0919. [PMC free article] [PubMed] [Google Scholar]
66.Achieng AO, Muiruri P, Ingasia LA, Opot BH, Juma DW, Yeda R, et al. Temporal trends in prevalence of Plasmodium falciparum molecular markers selected for by artemether-lumefantrine treatment in pre-ACT and post-ACT parasites in western Kenya. Int J Parasitol Drugs Drug Resist. 2015;5(3):92–9. doi: 10.1016/j.ijpddr.2015.05.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Akala HM, Eyase FL, Cheruiyot AC, Omondi AA, Ogutu BR, Waters NC, et al. Antimalarial drug sensitivity profile of western Kenya Plasmodium falciparum field isolates determined by a SYBR Green I in vitro assay and molecular analysis. Am J Trop Med Hyg. 2011;85(1):34–41. doi: 10.4269/ajtmh.2011.10-0674 [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Rougemont M, Van Saanen M, Sahli R, Hinrikson HP, Bille J, Jaton K. Detection of four Plasmodium species in blood from humans by 18S rRNA gene subunit-based and species-specific real-time PCR assays. J Clin Microbiol. 2004;42(12):5636–43. doi: 10.1128/JCM.42.12.5636-5643.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Kamau E, Alemayehu S, Feghali KC, Juma DW, Blackstone GM, Marion WR, et al. Sample-ready multiplex qPCR assay for detection of malaria. Malar J. 2014;13:158. doi: 10.1186/1475-2875-13-158 [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Calderaro A, Piccolo G, Gorrini C, Montecchini S, Rossi S, Medici MC, et al. A new real-time PCR for the detection of Plasmodium ovale wallikeri. PLoS One. 2012;7(10):e48033. doi: 10.1371/journal.pone.0048033 [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Hawadak J, Dongang Nana RR, Singh V. Global trend of Plasmodium malariae and Plasmodium ovale spp. malaria infections in the last two decades (2000-2020): a systematic review and meta-analysis. Parasit Vectors. 2021;14(1):297. doi: 10.1186/s13071-021-04797-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Chen J, Ma X, Tang J, Xu S, Gu Y, Tang F, et al. Disparate selection of mutations in the dihydrofolate reductase gene (dhfr) of Plasmodium ovale curtisi and P. o. wallikeri in Africa. PLoS Negl Trop Dis. 2022;16(12):e0010977. doi: 10.1371/journal.pntd.0010977 [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Joste V, Coppée R, Bailly J, Rakotoarivony Y, Tchokoteu FGT, Achache S, et al. Plasmodium ovale spp dhfr mutations associated with reduced susceptibility to pyrimethamine in sub-Saharan Africa: a retrospective genetic epidemiology and functional study. The Lancet Microbe. 2024;5(7):669–78. [DOI] [PubMed] [Google Scholar]
74.Bruce MC, Donnelly CA, Alpers MP, Galinski MR, Barnwell JW, Walliker D, et al. Cross-species interactions between malaria parasites in humans. Science. 2000;287(5454):845–8. doi: 10.1126/science.287.5454.845 [DOI] [PubMed] [Google Scholar]
75.Bruce MC, Day KP. Cross-species regulation of Plasmodium parasitemia in semi-immune children from Papua New Guinea. Trends Parasitol. 2003;19(6):271–7. doi: 10.1016/s1471-4922(03)00116-8 [DOI] [PubMed] [Google Scholar]
76.Reece SE, Thompson J. Transformation of the rodent malaria parasite Plasmodium chabaudi and generation of a stable fluorescent line PcGFPCON. Malar J. 2008;7:183. doi: 10.1186/1475-2875-7-183 [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Mideo N. Parasite adaptations to within-host competition. Trends Parasitol. 2009;25(6):261–8. doi: 10.1016/j.pt.2009.03.001 [DOI] [PubMed] [Google Scholar]
78.Costa G, Gildenhard M, Eldering M, Lindquist RL, Hauser AE, Sauerwein R, et al. Non-competitive resource exploitation within mosquito shapes within-host malaria infectivity and virulence. Nat Commun. 2018;9(1):3474. doi: 10.1038/s41467-018-05893-z [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Ramiro RS, Pollitt LC, Mideo N, Reece SE. Facilitation through altered resource availability in a mixed-species rodent malaria infection. Ecol Lett. 2016;19(9):1041–50. doi: 10.1111/ele.12639 [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Faye FBK, Spiegel A, Tall A, Sokhna C, Fontenille D, Rogier C, et al. Diagnostic criteria and risk factors for Plasmodium ovale malaria. J Infect Dis. 2002;186(5):690–5. doi: 10.1086/342395 [DOI] [PubMed] [Google Scholar]
81.Hemmer CJ, Holst FGE, Kern P, Chiwakata CB, Dietrich M, Reisinger EC. Stronger host response per parasitized erythrocyte in Plasmodium vivax or ovale than in Plasmodium falciparum malaria. Trop Med Int Health. 2006;11(6):817–23. doi: 10.1111/j.1365-3156.2006.01635.x [DOI] [PubMed] [Google Scholar]
82.McQueen PG, McKenzie FE. Competition for red blood cells can enhance Plasmodium vivax parasitemia in mixed-species malaria infections. Am J Trop Med Hyg. 2006;75(1):112–25. doi: 10.4269/ajtmh.2006.75.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Okafor CN, Finnigan NA. Plasmodium ovale Malaria. StatPearls. Treasure Island (FL): StatPearls Publishing. 2023. [PubMed] [Google Scholar]
84.Hemmer CJ, Kern P, Holst FG, Radtke KP, Egbring R, Bierhaus A, et al. Activation of the host response in human Plasmodium falciparum malaria: relation of parasitemia to tumor necrosis factor/cachectin, thrombin-antithrombin III, and protein C levels. Am J Med. 1991;91(1):37–44. doi: 10.1016/0002-9343(91)90071-5 [DOI] [PubMed] [Google Scholar]
85.Nyarko PB, Claessens A. Understanding Host-Pathogen-Vector Interactions with Chronic Asymptomatic Malaria Infections. Trends Parasitol. 2021;37(3):195–204. doi: 10.1016/j.pt.2020.09.017 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0334188.r001

Decision Letter 0

Kristan Alexander Schneider

23 Jan 2026

Dear Dr. Akala,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Mar 09 2026 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

A letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Kristan Alexander Schneider, Ph.D.

Academic Editor

PLOS One

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that Figure 1 in your submission contain map images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

1) You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an ""Other"" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

2) If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

3. If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Additional Editor Comments:

The reviewers found merit in the manuscript and suggested revisions. However, both reviewers raised concerns regarding the quality of the language and the statistical rigor of the manuscript. Please keep this in mind while carefully preparing your revised manuscript. I also went over the manuscript briefly and agree with the reviewers. I also noted some text editing inconsistencies. In the abstract, sometimes a decimal point is in the normal style, e.g. 1.2, sometimes in the style of a raised decimal point, e.g. "1·2". Please use a consistent format.I also suggest to mention somewhere that P. ovalewallikeri and P. ovalecurtisi are now considered two morphologically identical but distinct species. Also, as far as I am concerned, the names P. ovalewallikeri and P. ovalecurtisi are now preferred over the classical trinominal names. At this point I would like to remind you of the PLoS One policies, which encourage authors to give detailed explanations (there is no word limit) so you can present more background information in the introduction.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: No

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: No

Reviewer #2: No

**********

Reviewer #1: Comments and Recommendations

This study investigated the prevalence of co-infections with Plasmodium species among symptomatic and asymptomatic carriers of the malaria parasite in Kisumu, Kenya. It further explored the P. ovale subspecies- P. ovalewallikeri and P. ovalecurtisi in a high malaria burden area.

The authors included both symptomatic and asymptomatic individuals, allowing for direct comparison between the two study groups. Moreover, the use of qPCR enabled sensitive detection of Plasmodium species enables the detection of low-density infections, asymptomatic carriage, and mixed-species infections that microscopy would likely miss.

To enhance the strength and clarity of the manuscript, the following comments and recommendations should be addressed:

Abstract

1. The abstract should include the study design, the detection method (qPCR), and the statistical approach.

2. The authors present the comparison between species prevalence, single vs. mixed infections, symptomatic vs. asymptomatic, and specific species combinations, but fail to tell the reader the implications of each result.

3. Sort the grammatical errors: lines 33, 39, 40. Correct the repetition in the abstract: lines 47-49, 51-52, and 55-56 say essentially the same thing. Correct the style and formatting errors: Missing space: 30(6·8%), Misplaced brackets: [0.02 – 0.36, P = 0.0008) among others.

4. The logistic regression results in the abstract are different from what is displayed in Figure 4. Please reconcile. Additionally, the odds ratios reported should be correctly interpreted.

Introduction

1. The introduction needs to be more focused. The authors tell a lot about malaria before mentioning why this study was necessary.

2. The research gap appears later in the introduction section. Until lines 118-120, does the reader encounter the research gap.

3. Line 63-64- Add Plasmodium before each species name and correct the duplicate citations “(1, 2) (3)” to (1–3).

4. Line 81-85- revise the sentence to read clearly.

5. Line 103-107- please reword this sentence as WHO does not recommend the routine treatment of asymptomatic malaria infections in all settings. Instead, the WHO's general recommendation for case management is to test and treat all suspected cases with a parasitological diagnosis before administering antimalarial medicine.

6. The RDT/microscopy section can be cut without losing impact since it’s too long.

7. Correct the subject-verb agreements. For instance, Clinical symptoms of malaria starts… - start, The WHO guidelines… is based – are based, necessitating treatment seeking – treatment-seeking, etc. Also, correct the inconsistent hyphenation: non-falciparum / non falciparum.

Taken together, the introduction is too long, grammatically inconsistent, and reveals the research question later.

Methodology

1. Line 84- add period.

1. In lines 128 and 167, the headers have each word capitalized, while their sub-headers have sentence cases. Please make it consistent.

2. Line 129- the header should be in plural (Ethical considerations) as more than one approvals were obtained.

Line 130- the first sentence refers to the studies that have not been introduced prior to that sentence. The studies are introduced in the following section. Revise the first sentence, for instance, “Ethical approval was obtained from…”, without mentioning the studies not yet introduced, for a logical flow.

3. Line 136- Revise the phrase “sampling collection” to sample collection for clarity.

The header mentions study sites, but only one study site is mentioned- Kombewa Health and Demographic Surveillance System (HDSS) is in a rural part of Kisumu County. It is not clear where the other site(s) are located.

4. Line 137- the first sentence has a sentence construction error. Please rewrite for clarity.

5. Line 142- remove article “the” from the first sentence, as it implies that the studies have been mentioned before. In addition, replace running with ran or conducted to correct the inconsistent tense in the sentence. Cite the two studies at the end of the first sentence.

6. Capitalization inconsistencies- the word County in lines 138, 146, 157. The word "That" in line 144 should be in lowercase. Line 166- Sub County in the figure legend should be hyphenated for consistency.

7. Line 170- which groups are being referred to here, and where have they been introduced or defined?

8. Line 173- Make the first sentence clear.

9. Line 181- Make Genus lowercase. See line 173.

10. Line 183- Remove the space after the opening bracket.

11. Include a statistical analysis section in the methodology to describe the statistical methods used to analyze the data presented.

Results

1. Line 192- The opening bracket is repetitive and should be rewritten.

2. The sample size inconsistency in the first paragraph (total samples=741 and metadata available=526) should be clearly stated in the text.

In the opening sentence, what analysis was performed on the 741 samples, as the analysis of the metadata was performed for only a subset (526)?

3. Line 195- A statistical test of significance is required to say that a variable in the table is comparable between the two study groups. Add a third column for the p-value.

Include other clinical and laboratory variables of the study participants in the metadata table. For instance, parasitemia, vital signs that were measured (line 160),

Include the number of males and females in the study groups, i.e., n (%).

Table 2- Age is summarized using mean, median, SD, and IQR to describe distribution shape, but with age in bands, the tests within bands restrict variance. As such, the tests should be done on raw age (continuous variable), not stratified age, and then compare age between the symptomatic and asymptomatic groups using the Wilcoxon rank-sum test (Mann–Whitney U test).

Test age category distribution (bands) using χ² test of independence or Fisher’s exact (if any expected count <5). Do the same for sex (Distribution of males and females).

As a continuous variable, report median (IQR), while as bands, report n (%) in the table.

The total percentage for asymptomatic males and females does not add upto 100%.

4. Line 199- Since you have mixed infections, reporting species percentages without stating this upfront is confusing to the readers, as percentages exceed 100%. Add an exlanation.

The numbers presented in this section do not match those presented in Figure 2. Reconcile.

Line 199-204- the author should distinguish clearly between any detection (including mixed infection and single species infections only. As it's written, the reader has to infer this. 15(3·4%) missing sace, line 210.

Line 206- The opening statement is wordy and needs to be rephrased.

Line 217- the figure description in the legend does not match the figure description in Figure 2.

5. Define the symptoms of uncomplicated malaria in the methods section.

The numbers presented in this section do not match those presented in Figure 3. Reconcile.

Line 230- the figure description in the legend does not match the figure description in Figure 3.

6. Line 240-243- logistic regression does not model risk but the odds. Therefore, line 240 should say, higher odds of … instead of higher risk of …

Similarly, in line 243, the sentence should read that mixed species had reduced odds of symptomatic infection.

7. In Figure 4, please indicate in the figure legend what the colors of the error bars (blue and red)represent. Update the legend to reflect the odds and not the risk of symptomatic infection.

Discussion

1. The discussion section needs to be restructured into clear subsections: Key findings, comparison with prior studies, biological interpretation implications for transmission and elimination, and the limitations of the study, if any.

2. Some sentences are overloaded with information. For instance, paragraph 2 defines asymptomatic malaria, summarizes a cohort study, introduces parasite competition theory, and then interprets results, making it overwhelming for the reader.

3. The author repeatedly states that mixed infections differ between symptomatic and asymptomatic groups, species interaction may affect symptoms, and regional differences exist. These points should be stated clearly once, then built upon.

4. There are grammar and language problems in this section. For example, incorrect phrases include: seek treatment instead of seek for the treatment, appear to suggest instead of appear to suggests etc.

Line 259- fix the grammar in the last sentence.

Line 268- add a space after the period.

Line 292- move the citation before the period. The sentence after the citation is incomplete.

Line 330- the limitations paragraph gramartically incorrect.

5. Please reconcile the following statemets that appear as contradictions: Mixed infections are more common in symptomatic individuals [(Lines 251–252) and (Lines 275–277), and Asymptomatic individuals have more diverse species profiles (Lines 280–281). That Symptomatic group had more mixed infections and asymptomatic had greater overall species diversity is an interesting observation that needs to be explained.

6. RBC generalist/specialist argument needs to be clearly framed as a hypothesis but not as an inferred mechanism, because the study did not measure parasitemia by species, measure immune markers or model interaction effects.

7. Line 324- The definition applies to asymptomatic and not symptomatic.

8. Please discuss the logistic regression results in Figure 4

Overall, the discussion requires substantial editing for clarity, flow, and interpretation.

Reviewer #2: The study is fairly well executed and presents results of original research EXCEPT these results have not been explicitly reflected and hence requires some major revision to improve the statistical meaning and clarity. Additionally, the manuscript has grammatical errors and errors of syntax that equally need to be corrected.

**********

what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

To ensure your figures meet our technical requirements, please review our figure guidelines: https://journals.plos.org/plosone/s/figures

You may also use PLOS’s free figure tool, NAAS, to help you prepare publication quality figures: https://journals.plos.org/plosone/s/figures#loc-tools-for-figure-preparation.

NAAS will assess whether your figures meet our technical requirements by comparing each figure against our figure specifications.

Attachment

Submitted filename: PLoS One Manuscript Review 19-1-2026.docx

pone.0334188.s001.docx^{(16.4KB, docx)}

Attachment

Submitted filename: PONE-D-25-45620-reviewed.pdf

pone.0334188.s002.pdf^{(3.2MB, pdf)}

PLoS One. 2026 Oct 7;21(10):e0334188. doi: 10.1371/journal.pone.0334188.r002

Author response to Decision Letter 1

3 Jun 2026

Manuscript Review: High prevalence of Plasmodium ovalewallikeri in co-infections with Plasmodium falciparum in symptomatic than asymptomatic malaria parasite carriers in Kisumu, Kenya

We wish to convey our appreciation for the critical review and insightful comments from the reviewer. We have addressed all the queries that have made the manuscript better with more clarity and focus. Please see below the responses to the comments:

• The study is fairly well executed and presents results of original research EXCEPT these results have not been explicitly reflected and hence requires some major revision to improve the statistical meaning and clarity.

Response: Descriptive statistics were employed to illustrate the burden of Plasmodium species among the symptomatic and asymptomatic groups with positive infections. For inferential statistics, proportions were compared using the Chi-square test as appropriate for the categorical data including the stratified age bands, gender and Plasmodium species proportions. Continuous variables, including age in years, were first assessed for normality using the Shapiro–Wilk test and then expressed as median together with their corresponding interquartile ranges (IQR) when non-normal distributions were observed. Wilcoxon rank-sum test was used for non-parametric continuous variables specifically for age in years. The geometric mean was used as a measure of central tendency for parasite density. Logistic regression analysis was also conducted to assess the varying odds of Plasmodium species composition. All analyses were performed using R Studio version 4.5.1. Statistical analyses were performed at the 5% significance level and the corresponding 95% confidence interval (CI). The critical significance level was set at p≤0.05.

A detailed description on data management and statistical analysis is indicated on the manuscript line 208-222 and the results section has been revised to include the inferential and descriptive statistical analyses used.

• The results depict malaria co-infections as detected by molecular analysis which is robust but the presentation of the results does not explicitly reflect this which is misleading.

Response: The molecular analysis results for Plasmodium species that were obtained following use of qPCR are presented as percentage frequencies in table 3 and in figures 2-3.

In addition, the results section highlights the finding of the molecular analysis using qPCR which is mentioned on line 247-283. …” On this basis, Plasmodium species detection by qPCR assay showed that, 655/741 (88.3%) of the infections contained P. falciparum, 153/741 (20.7%) P. ovalewallikeri, 70/741 (9.4%) P. malariae, and 64/741 (8.7%) P. ovalecurtisi without consideration of the number of species per infection (Table 3). However, 12/741 (1.6%) amplifying for presence of Plasmodium genus did not amplify for any species…” The proportions of the Plasmodium species composition following qPCR detection assays have been presented as percentage frequencies in the results and discussion sections.

• No information has been provided on the statistical analysis used to analyze the data. I have highlighted the discrepancies in the reviewed copy of the manuscript as well. For instance, this presentation “Broadly, 741 mostly contained Pf 668 (90·15%) followed by Pow 154 (20·78%), Pm 7041 (9·45%) and Poc 64 (8·7%)’’. There is need to explicitly indicate that this was a co-infection analysis, without which the information is misleading as the proportions look like mere percentages of 741.

Response: As stated above descriptive and inferential statistics were employed to illustrate the burden of Plasmodium species among the participants with positive infections as indicated in the manuscript, lines 215-222. Furthermore, we have indicated that Plasmodium co-infection analyses were conducted to detect the presence of single or multiple species and the raw data presented as percentage frequencies, lines 241-263.

• The wording reflecting the percentages and totals are not explicit. For instance, “The frequency of Plasmodium species among the symptomatic and asymptomatic infections were Pf 421 (96·3%) and 247 (81·25%), Pow 123 (28·3%) and 31 (10·19%), Poc 40 (9·2%) and 26 (8·55%) while Pm was 30(6·8%) and 40 (13·2%), respectively.” These frequencies are depicted without clearly reflecting the denominators used, which is misleading.

Response: We have noted this and placed the denominators/ fractions that were used to obtain each frequency in the abstract lines 45-48 and results section lines 247-283. The proportions are now OK and there is no mismatch in the numbers.

• In line 199 “Plasmodium speciation by qPCR assay showed that, of the 741 infections 668 (90·15%), contained P. falciparum, 154 (20·78%) P. ovalewallikeri, 70 (9·45%), P. malariae and 64 (8·7%) P. ovalecurtisi” is very confusing to readers. Without explicitly stating that co-infections were included, the percentages exceeding 100 are very misleading to readers.

Response: We have revised the statement in the main text, results section and clarified that “Plasmodium co-infections analyses were conducted...”, “Therefore, computing the raw frequencies of any detection of Plasmodium species yielded varying percentages that cumulatively exceeded 100%, consistent with the expected classification of infections containing multiple species under two or more species profiles…” Please see manuscript lines 241-246.

• In line 201-204, the counts of single species reflected are less than the sum of 544 provided.

Response: We have rectified this and all the numbers captured in this section for the single species are reflected accurately and reads as follows: “Subsequent analysis with a focus on the presence or absence of more than one species per infection revealed that a total of 535/741 (72.2%) samples had single species while 194/741 (26.1%) had multiple species infections. P. falciparum was the most frequent single-species infection occurring in 470/535 (87.9%) infections, followed by P. ovalewallikeri in 34/535 (6.4%), P. malariae in 18/535 (3.4%), and P. ovalecurtisi in 13/535 (2.4%) …” Please see lines 252-258 in the manuscript.

• In general, the statistics and other analyses have not been performed to a high technical standard and are not described in sufficient detail, which can be very confusing to readers, limiting the potential of replicating similar studies in the future.

Response: We have revised the manuscript and described in detail the statistical tests used for data analysis in the data management and statistical analysis section in lines 208-222.

• The discussion and conclusions provided are very repetitive/redundant and do not clearly distinguish the alignment to the data presented in the document and the alignment towards policy recommendations.

Response: We have revised the discussion and conclusion section to omit repetitive and redundant statements. The data has been well discussed and aligned towards policy recommendations, lines 412-419.

• The document requires stringent language revision to correct some grammar errors and syntax. Some sentences are way too long. For instance, in line 268-272 “Studies on inter-parasite interactions within human hosts suggest that parasites often interact with unrelated competitors within the host (74) and use this information to prioritize the resource allocation framework opting to increase replication to occupy most of the red blood cells at the expense of the development of sexual stages as one of the exclusion strategies”. The term “use this information” in relation to parasites is misleading and should be replaced with a scientifically acceptable term.

Response: We have revised the manuscript and corrected all the grammatical errors and syntax. We have replaced the word “information” with “mechanism” in line 328. However, some of the long sentences could not be shortened further as it would lose meaning.

• In line 106, there is a full stop before the citations.

Response: We have corrected this and the full stop before the citation has been removed.

• Line 330 “Finally, host immunity was not characterized were not the endpoint of this study” is grammatically very poor. Other grammatical and syntax errors have been pointed/highlighted in the copy of the reviewed manuscript.

Response: We have rectified this statement to read as follows: “Finally, host immunity was not characterized in this study because it was not one of the endpoints for the study…” Please see line 409-410.

• The research was conducted as per the international ethical standards. And the data availability guidelines have been adhered to.

Response: We have revised the manuscript and included a statement on data availability after the main text, line 436-438.

Closing statement.

Many thanks for the comments and queries, we hope the manuscript is well structured.

Attachment

Submitted filename: Response to Reviewers_11May2026.docx

pone.0334188.s003.docx^{(22.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0334188.r003

Decision Letter 1

Kristan Alexander Schneider

16 Jul 2026

Dear Dr. Akala,

Please submit your revised manuscript by Aug 30 2026 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

A letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

As the corresponding author, your ORCID iD is verified in the submission system and will appear in the published article. PLOS supports the use of ORCID, and we encourage all coauthors to register for an ORCID iD and use it as well. Please encourage your coauthors to verify their ORCID iD within the submission system before final acceptance, as unverified ORCID iDs will not appear in the published article. Only the individual author can complete the verification step; PLOS staff cannot verify ORCID iDs on behalf of authors.

We look forward to receiving your revised manuscript.

Kind regards,

Kristan Alexander Schneider, Ph.D.

Academic Editor

PLOS One

Journal Requirements:

If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

We are converging. The reviewers were very positive. Reviewer #2 listed a number of minor changes. Please incorporate them inn your revised version.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions??>

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: Yes

Reviewer #2: No

**********

Reviewer #1: (No Response)

Reviewer #2: The authors have keenly addressed the major concerns that I had raised which is highly commendable. While the science is substantially improved, I noted a few grammatical errors that need to be corrected to improve the quality of the paper. These are very minor changes as illustrated below and equally highlighted in the manuscript as tracked changes:

� In line 40 please add “participants” between symptomatic and at Kombewa for the sentence to read; 437 symptomatic participants at….

� In line 44, please add “a” between within and given for the sentence to read: within a given infection….

� In line 47, please add “samples” after the brackets with the percentages for both the first and the second percentage.

� In line 48, please add, “samples contained”, after the brackets

� In line 57, please add “the” between on and burden and “a” between suggest and need

� In line 70 please add a full-stop after the citation bracket, (6).

� In line 88, please add “a” between as and mono-infection for the sentence to read: as a mono-infection.

� In line 156, please provide the case definition for uncomplicated malaria.

� In line 252, please improve the grammar by including the words “of the samples that amplified” after the brackets with the percentage as highlighted in the manuscript.

In your results section, you have legends above and below the tables (tables 2-3), ignore if this is the required journal format.

� In line 271 please add “while” after the second bracket and “included” after three species.

� In line 283, please add “of”’ between comprised and double and “species” after double

� In line 285, add “species” after triple

� In line 323, please add “are” between and referred for the sentence to read as: and are referred to….

� In line 366, please cite the paper that has been described.

� In line 380, complete the sentence with “individuals”

� In line 394 please add “ as” between such and fever.

**********

what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #1: No

Reviewer #2: No

**********

To ensure your figures meet our technical requirements, please review our figure guidelines: https://journals.plos.org/plosone/s/figures

You may also use PLOS’s free figure tool, NAAS, to help you prepare publication quality figures: https://journals.plos.org/plosone/s/figures#loc-tools-for-figure-preparation.

NAAS will assess whether your figures meet our technical requirements by comparing each figure against our figure specifications.

Attachment

Submitted filename: Manuscript Review comments 29-6-2026.docx

pone.0334188.s004.docx^{(13KB, docx)}

Attachment

Submitted filename: PONE-D-25-45620_R1 29-6-2026.pdf

pone.0334188.s005.pdf^{(4.4MB, pdf)}

PLoS One. 2026 Oct 7;21(10):e0334188. doi: 10.1371/journal.pone.0334188.r004

Author response to Decision Letter 2

18 Aug 2026

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict-of-interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Response: Thank you for the positive feedback, we truly appreciate

________________________________________

2. Is the manuscript technically sound, and does the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Response: Many thanks for the comments, we are grateful.

________________________________________

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Response: This is well noted.

________________________________________

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Response: Noted.

________________________________________

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

Response: The manuscript has been revised and formatted according to the reviewers’ comments. The current manuscript reads well.

________________________________________

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

� In line 40 please add “participants” between symptomatic and at Kombewa for the sentence to read; 437 symptomatic participants at….

Response: Done

� In line 44, please add “a” between within and given for the sentence to read: within a given infection….

Response: Done.

� In line 47, please add “samples” after the brackets with the percentages for both the first and the second percentage.

Response: Done.

� In line 48, please add, “samples contained”, after the brackets

Response: Done.

� In line 57, please add “the” between on and burden and “a” between suggest and need

Response: Done.

� In line 70 please add a full-stop after the citation bracket, (6).

Response: Done.

� In line 88, please add “a” between as and mono-infection for the sentence to read: as a mono-infection.

Response: Done.

� In line 156, please provide the case definition for uncomplicated malaria.

Response: Thank you for the comment. An appropriate definition of uncomplicated malaria has been added to the draft. The section reads, “… having symptoms consistent with uncomplicated malaria, characterized by symptomatic, laboratory-confirmed Plasmodium infection in a patient who had no clinical or laboratory evidence of severe malaria or vital organ dysfunction and able to tolerate oral antimalarial therapy. These individuals presented with clinical features including fever (≥37.5 °C) or a history of fever within the preceding 48 hours accompanied by symptoms such as Chills, rigors, sweating, Headache, Malaise, fatigue Myalgia and arthralgia, Nausea and/or vomiting.”

� In line 252, please improve the grammar by including the words “of the samples that amplified” after the brackets with the percentage as highlighted in the manuscript.

Response: Done

In your results section, you have legends above and below the tables (tables 2-3), ignore if this is the required journal format.

Response: This is part of the journal format hence no changes.

� In line 271 please add “while” after the second bracket and “included” after three species.

� In line 283, please add “of”’ between comprised and double and “species” after double

� In line 285, add “species” after triple

� In line 323, please add “are” between and referred for the sentence to read as: and are referred to….

Response for lines 271,283, 285, 323: Done, the grammatical errors in the manuscript have been corrected.

� In line 366, please cite the paper that has been described.

Response: Concur. This was an omission. Citations, “(Hemmer et al., 2006, Hemmer et al., 1991)” have been inserted

� In line 380, complete the sentence with “individuals”

� In line 394 please add “as” between such and fever.

Response for lines 380 and 394: Done

________________________________________

Closing Statement; Thank you for your kind consideration and valuable inputs to make the current manuscript even better. We look forward to continuing fruitful engagements in the future.

Attachment

Submitted filename: Response to Reviewers_18August2026.docx

pone.0334188.s006.docx^{(15.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0334188.r005

Decision Letter 2

Kristan Alexander Schneider

11 Sep 2026

High prevalence of Plasmodium ovalewallikeri in co-infections with Plasmodium falciparum in symptomatic than asymptomatic Plasmodium parasite infections in Kisumu, Kenya

PONE-D-25-45620R2

Dear Dr. Akala,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Kristan Alexander Schneider, Ph.D.

Academic Editor

PLOS One

Additional Editor Comments (optional): I noticed there are some inconsistencies in the typesetting. E.g. "Fig.1 Map of Kombewa" at line 178 should be "Fig 1 …". Similarly, “Fig. 2” occurs several times in the text and it should be “Fig 2”. Please carefully check the typesetting for consistency and make sure you follow the journal's guidelines.

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0334188.r006

Acceptance letter

Kristan Alexander Schneider

PONE-D-25-45620R2

PLOS One

Dear Dr. Akala,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS One. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

You will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS One and supporting open access.

Kind regards,

PLOS One Editorial Office Staff

on behalf of

Professor Kristan Alexander Schneider

Academic Editor

PLOS One

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Attachment

Submitted filename: PLoS One Manuscript Review 19-1-2026.docx

pone.0334188.s001.docx^{(16.4KB, docx)}

Attachment

Submitted filename: PONE-D-25-45620-reviewed.pdf

pone.0334188.s002.pdf^{(3.2MB, pdf)}

Attachment

Submitted filename: Response to Reviewers_11May2026.docx

pone.0334188.s003.docx^{(22.3KB, docx)}

Attachment

Submitted filename: Manuscript Review comments 29-6-2026.docx

pone.0334188.s004.docx^{(13KB, docx)}

Attachment

Submitted filename: PONE-D-25-45620_R1 29-6-2026.pdf

pone.0334188.s005.pdf^{(4.4MB, pdf)}

Attachment

Submitted filename: Response to Reviewers_18August2026.docx

pone.0334188.s006.docx^{(15.3KB, docx)}

Data Availability Statement

All relevant data are within the paper.

[pone.0334188.ref001] 1.Ansari HR, Templeton TJ, Subudhi AK, Ramaprasad A, Tang J, Lu F, et al. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species. Int J Parasitol. 2016;46(11):685–96. doi: 10.1016/j.ijpara.2016.05.009 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref002] 2.Antinori S, Galimberti L, Milazzo L, Corbellino M. Plasmodium knowlesi: the emerging zoonotic malaria parasite. Acta Trop. 2013;125(2):191–201. doi: 10.1016/j.actatropica.2012.10.008 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref003] 3.Snounou G, Sharp PM, Culleton R. The two parasite species formerly known as Plasmodium ovale. Trends Parasitol. 2024;40(1):21–7. doi: 10.1016/j.pt.2023.11.004 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref004] 4.Higgins M, Manko E, Ward D, Phelan JE, Nolder D, Sutherland CJ, et al. New reference genomes to distinguish the sympatric malaria parasites, Plasmodium ovale curtisi and Plasmodium ovale wallikeri. Sci Rep. 2024;14(1):3843. doi: 10.1038/s41598-024-54382-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref005] 5.Organization WH. WHO guidelines for malaria. World Health Organization. 2025. [Google Scholar]

[pone.0334188.ref006] 6.Weiss DJ, Dzianach PA, Saddler A, Lubinda J, Browne A, McPhail M, et al. Mapping the global prevalence, incidence, and mortality of Plasmodium falciparum and Plasmodium vivax malaria, 2000–22: a spatial and temporal modelling study. The Lancet. 2025;405(10483):979–90. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref007] 7.Sinka ME, Bangs MJ, Manguin S, Rubio-Palis Y, Chareonviriyaphap T, Coetzee M, et al. A global map of dominant malaria vectors. Parasit Vectors. 2012;5:69. doi: 10.1186/1756-3305-5-69 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref008] 8.Weiss DJ, Lucas TC, Nguyen M, Nandi AK, Bisanzio D, Battle KE. Mapping the global prevalence, incidence, and mortality of Plasmodium falciparum, 2000–17: a spatial and temporal modelling study. The Lancet. 2019;394(10195):322–31. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref009] 9.Battle KE, Lucas TC, Nguyen M, Howes RE, Nandi AK, Twohig KA. Mapping the global endemicity and clinical burden of Plasmodium vivax, 2000–17: a spatial and temporal modelling study. The Lancet. 2019;394(10195):332–43. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref010] 10.Price RN, Commons RJ, Battle KE, Thriemer K, Mendis K. Plasmodium vivax in the Era of the Shrinking P. falciparum Map. Trends in Parasitology. 2020;36(6):560–70. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref011] 11.Mahittikorn A, Masangkay FR, Kotepui KU, Milanez GDJ, Kotepui M. Comparison of Plasmodium ovale curtisi and Plasmodium ovale wallikeri infections by a meta-analysis approach. Sci Rep. 2021;11(1):6409. doi: 10.1038/s41598-021-85398-w [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref012] 12.Sutherland CJ. Persistent Parasitism: The Adaptive Biology of Malariae and Ovale Malaria. Trends Parasitol. 2016;32(10):808–19. doi: 10.1016/j.pt.2016.07.001 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref013] 13.Diagne A, Sambe BS, Gaba FM, Sarr I, Diatta AS, Sadio O, et al. Variable effects of non-falciparum species infections on malaria disease severity in high transmission regions in Senegal. Trop Med Health. 2024;52(1):93. doi: 10.1186/s41182-024-00655-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref014] 14.Sendor R, Banek K, Kashamuka MM, Mvuama N, Bala JA, Nkalani M. Epidemiology of Plasmodium malariae and Plasmodium ovale spp. in Kinshasa Province, Democratic Republic of Congo. Nature Communications. 2023;14(1):6618. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref015] 15.Omondi P, Musyoka B, Okai T, Kongere J, Kagaya W, Chan CW. Non-random distribution of Plasmodium species infections and associated clinical features in children in the lake Victoria region, Kenya, 2012-2018. Trop Med Health. 2024;52(1):52. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref016] 16.Zarocostas J. Malaria treatment should begin with parasitological diagnosis where possible, says WHO. BMJ. 2010;340:c1402. doi: 10.1136/bmj.c1402 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref017] 17.Newman RD. World Malaria Report 2011. 2012.

[pone.0334188.ref018] 18.ACTwatch Group, Musuva A, Ejersa W, Kiptui R, Memusi D, Abwao E. The malaria testing and treatment landscape in Kenya: results from a nationally representative survey among the public and private sector in 2016. Malar J. 2017;16(1):494. doi: 10.1186/s12936-017-2089-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref019] 19.Kamal-Yanni MM, Potet J, Saunders PM. Scaling-up malaria treatment: a review of the performance of different providers. Malar J. 2012;11:414. doi: 10.1186/1475-2875-11-414 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref020] 20.Alonso P, Noor AM. The global fight against malaria is at crossroads. Lancet. 2017;390(10112):2532–4. doi: 10.1016/S0140-6736(17)33080-5 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref021] 21.Larsen DA, Ngwenya-Kangombe T, Cheelo S, Hamainza B, Miller J, Winters A, et al. Location, location, location: environmental factors better predict malaria-positive individuals during reactive case detection than index case demographics in Southern Province, Zambia. Malar J. 2017;16(1):18. doi: 10.1186/s12936-016-1649-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref022] 22.Hamainza B, Moonga H, Sikaala CH, Kamuliwo M, Bennett A, Eisele TP, et al. Monitoring, characterization and control of chronic, symptomatic malaria infections in rural Zambia through monthly household visits by paid community health workers. Malar J. 2014;13:128. doi: 10.1186/1475-2875-13-128 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref023] 23.Chen I, Clarke SE, Gosling R, Hamainza B, Killeen G, Magill A, et al. “Asymptomatic” Malaria: A Chronic and Debilitating Infection That Should Be Treated. PLoS Med. 2016;13(1):e1001942. doi: 10.1371/journal.pmed.1001942 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref024] 24.Mueller I, Slutsker L, Tanner M. Estimating the burden of malaria: the need for improved surveillance. PLoS Med. 2011;8(12):e1001144. doi: 10.1371/journal.pmed.1001144 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref025] 25.Kamau E, Alemayehu S, Feghali KC, Saunders D, Ockenhouse CF. Multiplex qPCR for detection and absolute quantification of malaria. PLoS One. 2013;8(8):e71539. doi: 10.1371/journal.pone.0071539 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref026] 26.Veron V, Simon S, Carme B. Multiplex real-time PCR detection of P. falciparum, P. vivax and P. malariae in human blood samples. Exp Parasitol. 2009;121(4):346–51. doi: 10.1016/j.exppara.2008.12.012 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref027] 27.Murray CK, Gasser RA Jr, Magill AJ, Miller RS. Update on rapid diagnostic testing for malaria. Clin Microbiol Rev. 2008;21(1):97–110. doi: 10.1128/CMR.00035-07 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref028] 28.Okyere B, Owusu-Ofori A, Ansong D, Buxton R, Benson S, Osei-Akoto A, et al. Point prevalence of asymptomatic Plasmodium infection and the comparison of microscopy, rapid diagnostic test and nested PCR for the diagnosis of asymptomatic malaria among children under 5 years in Ghana. PLoS One. 2020;15(7):e0232874. doi: 10.1371/journal.pone.0232874 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref029] 29.van Eijk AM, Sutton PL, Ramanathapuram L, Sullivan SA, Kanagaraj D, Priya GSL, et al. The burden of submicroscopic and asymptomatic malaria in India revealed from epidemiology studies at three varied transmission sites in India. Sci Rep. 2019;9(1):17095. doi: 10.1038/s41598-019-53386-w [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref030] 30.Perandin F, Manca N, Calderaro A, Piccolo G, Galati L, Ricci L, et al. Development of a real-time PCR assay for detection of Plasmodium falciparum, Plasmodium vivax, and Plasmodium ovale for routine clinical diagnosis. J Clin Microbiol. 2004;42(3):1214–9. doi: 10.1128/JCM.42.3.1214-1219.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref031] 31.Kamau E, Tolbert LS, Kortepeter L, Pratt M, Nyakoe N, Muringo L, et al. Development of a highly sensitive genus-specific quantitative reverse transcriptase real-time PCR assay for detection and quantitation of plasmodium by amplifying RNA and DNA of the 18S rRNA genes. J Clin Microbiol. 2011;49(8):2946–53. doi: 10.1128/JCM.00276-11 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref032] 32.Ouédraogo AL, Eckhoff PA, Luty AJF, Roeffen W, Sauerwein RW, Bousema T, et al. Modeling the impact of Plasmodium falciparum sexual stage immunity on the composition and dynamics of the human infectious reservoir for malaria in natural settings. PLoS Pathog. 2018;14(5):e1007034. doi: 10.1371/journal.ppat.1007034 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref033] 33.Gholizadeh S, Naseri Karimi N, Zakeri S, Dinparast Djadid N. The Role of Molecular Techniques on Malaria Control and Elimination Programs in Iran: A Review Article. Iran J Parasitol. 2018;13(2):161–71. [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref034] 34.Tedla M. A focus on improving molecular diagnostic approaches to malaria control and elimination in low transmission settings: Review. Parasite Epidemiol Control. 2019;6:e00107. doi: 10.1016/j.parepi.2019.e00107 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref035] 35.Njuguna P, Maitland K, Nyaguara A, Mwanga D, Mogeni P, Mturi N, et al. Observational study: 27 years of severe malaria surveillance in Kilifi, Kenya. BMC medicine. 2019;17(1):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref036] 36.Cheaveau J, Mogollon DC, Mohon MAN, Golassa L, Yewhalaw D, Pillai DR. Asymptomatic malaria in the clinical and public health context. Expert review of anti-infective therapy. 2019;17(12):997–1010. [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref037] 37.Zimmerman PA, Mehlotra RK, Kasehagen LJ, Kazura JW. Why do we need to know more about mixed Plasmodium species infections in humans?. Trends in Parasitology. 2004;20(9):440–7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref038] 38.Portugal S, Drakesmith H, Mota MM. Superinfection in malaria: Plasmodium shows its iron will. EMBO Rep. 2011;12(12):1233–42. doi: 10.1038/embor.2011.213 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref039] 39.Imwong M, Nakeesathit S, Day NPJ, White NJ. A review of mixed malaria species infections in anopheline mosquitoes. Malar J. 2011;10:253. doi: 10.1186/1475-2875-10-253 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref040] 40.Beier MS, Schwartz IK, Beier JC, Perkins PV, Onyango F, Koros JK, et al. Identification of malaria species by ELISA in sporozoite and oocyst infected Anopheles from western Kenya. Am J Trop Med Hyg. 1988;39(4):323–7. doi: 10.4269/ajtmh.1988.39.323 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref041] 41.Verra F, Angheben A, Martello E, Giorli G, Perandin F, Bisoffi Z. A systematic review of transfusion-transmitted malaria in non-endemic areas. Malar J. 2018;17(1):36. doi: 10.1186/s12936-018-2181-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref042] 42.Orish V, Afutu L, Ayodele O, Likaj L, Marinkovic A, Sanyaolu A. A 4-day incubation period of Plasmodium falciparum infection in a nonimmune patient in Ghana: a case report. Open Forum Infectious Diseases. 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref043] 43.Okafor CN, Finnigan NA. Plasmodium ovale malaria. 2018. [PubMed]

[pone.0334188.ref044] 44.Bartoloni A, Zammarchi L. Clinical aspects of uncomplicated and severe malaria. Mediterr J Hematol Infect Dis. 2012;4(1):e2012026. doi: 10.4084/MJHID.2012.026 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref045] 45.Krajden S, Panisko DM, Tobe B, Yang J, Keystone JS. Prolonged infection with Plasmodium falciparum in a semi-immune patient. Trans R Soc Trop Med Hyg. 1991;85(6):731–2. doi: 10.1016/0035-9203(91)90434-z [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref046] 46.Greenwood T, Vikerfors T, Sjöberg M, Skeppner G, Färnert A. Febrile Plasmodium falciparum malaria 4 years after exposure in a man with sickle cell disease. Clin Infect Dis. 2008;47(4):e39-41. doi: 10.1086/590250 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref047] 47.Szmitko PE, Kohn ML, Simor AE. Plasmodium falciparum malaria occurring 8 years after leaving an endemic area. Diagn Microbiol Infect Dis. 2009;63(1):105–7. doi: 10.1016/j.diagmicrobio.2008.08.017 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref048] 48.Moonen B, Cohen JM, Snow RW, Slutsker L, Drakeley C, Smith DL, et al. Operational strategies to achieve and maintain malaria elimination. Lancet. 2010;376(9752):1592–603. doi: 10.1016/S0140-6736(10)61269-X [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref049] 49.Lindblade KA, Steinhardt L, Samuels A, Kachur SP, Slutsker L. The silent threat: asymptomatic parasitemia and malaria transmission. Expert Review of Anti-Infective Therapy. 2013;11(6):623–39. [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref050] 50.Bottius E, Guanzirolli A, Trape JF, Rogier C, Konate L, Druilhe P. Malaria: even more chronic in nature than previously thought; evidence for subpatent parasitaemia detectable by the polymerase chain reaction. Trans R Soc Trop Med Hyg. 1996;90(1):15–9. doi: 10.1016/s0035-9203(96)90463-0 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref051] 51.Rouamba T, Samadoulougou S, Ouédraogo M, Hien H, Tinto H, Kirakoya-Samadoulougou F. Asymptomatic malaria and anaemia among pregnant women during high and low malaria transmission seasons in Burkina Faso: household-based cross-sectional surveys in Burkina Faso, 2013 and 2017. Malar J. 2021;20(1):211. doi: 10.1186/s12936-021-03703-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref052] 52.Abdulraheem MA, Ernest M, Ugwuanyi I, Abkallo HM, Nishikawa S, Adeleke M, et al. High prevalence of Plasmodium malariae and Plasmodium ovale in co-infections with Plasmodium falciparum in asymptomatic malaria parasite carriers in southwestern Nigeria. Int J Parasitol. 2022;52(1):23–33. doi: 10.1016/j.ijpara.2021.06.003 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref053] 53.Nundu SS, Culleton R, Simpson SV, Arima H, Muyembe J-J, Mita T, et al. Malaria parasite species composition of Plasmodium infections among asymptomatic and symptomatic school-age children in rural and urban areas of Kinshasa, Democratic Republic of Congo. Malar J. 2021;20(1):389. doi: 10.1186/s12936-021-03919-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref054] 54.Kho S, Qotrunnada L, Leonardo L, Andries B, Wardani PAI, Fricot A, et al. Evaluation of splenic accumulation and colocalization of immature reticulocytes and Plasmodium vivax in asymptomatic malaria: A prospective human splenectomy study. PLoS Med. 2021;18(5):e1003632. doi: 10.1371/journal.pmed.1003632 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref055] 55.Pava Z, Handayuni I, Trianty L, Utami RA, Tirta YK, Puspitasari AM. Passively versus actively detected malaria: similar genetic diversity but different complexity of infection. The American Journal of Tropical Medicine and Hygiene. 2017;97(6):1788–96. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref056] 56.Buchwald AG, Sorkin JD, Sixpence A, Chimenya M, Damson M, Wilson ML, et al. Association Between Age and Plasmodium falciparum Infection Dynamics. Am J Epidemiol. 2019;188(1):169–76. doi: 10.1093/aje/kwy213 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref057] 57.Worku L, Damtie D, Endris M, Getie S, Aemero M. Asymptomatic Malaria and Associated Risk Factors among School Children in Sanja Town, Northwest Ethiopia. Int Sch Res Notices. 2014;2014:303269. doi: 10.1155/2014/303269 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref058] 58.Kwiatkowski D, Nowak M. Periodic and chaotic host-parasite interactions in human malaria. Proc Natl Acad Sci U S A. 1991;88(12):5111–3. doi: 10.1073/pnas.88.12.5111 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref059] 59.Mason DP, McKenzie FE. Blood-stage dynamics and clinical implications of mixed Plasmodium vivax-Plasmodium falciparum infections. Am J Trop Med Hyg. 1999;61(3):367–74. doi: 10.4269/ajtmh.1999.61.367 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref060] 60.Richie TL. Interactions between malaria parasites infecting the same vertebrate host. Parasitology. 1988;96 (Pt 3):607–39. doi: 10.1017/s0031182000080227 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref061] 61.Bruce MC, Day KP. Cross-species regulation of malaria parasitaemia in the human host. Curr Opin Microbiol. 2002;5(4):431–7. doi: 10.1016/s1369-5274(02)00348-x [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref062] 62.Mayxay M, Pukrittayakamee S, Newton PN, White NJ. Mixed-species malaria infections in humans. Trends Parasitol. 2004;20(5):233–40. doi: 10.1016/j.pt.2004.03.006 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref063] 63.Kotepui M, Kotepui KU, De Jesus Milanez G, Masangkay FR. Plasmodium spp. mixed infection leading to severe malaria: a systematic review and meta-analysis. Sci Rep. 2020;10(1):11068. doi: 10.1038/s41598-020-68082-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref064] 64.Akala HM, Watson OJ, Mitei KK, Juma DW, Verity R, Ingasia LA, et al. Plasmodium interspecies interactions during a period of increasing prevalence of Plasmodium ovale in symptomatic individuals seeking treatment: an observational study. Lancet Microbe. 2021;2(4):e141–50. doi: 10.1016/S2666-5247(21)00009-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref065] 65.Taylor-Robinson D, Jones K, Garner P. Malaria: uncomplicated, caused by Plasmodium falciparum. BMJ Clin Evid. 2007;2007:0919. [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref066] 66.Achieng AO, Muiruri P, Ingasia LA, Opot BH, Juma DW, Yeda R, et al. Temporal trends in prevalence of Plasmodium falciparum molecular markers selected for by artemether-lumefantrine treatment in pre-ACT and post-ACT parasites in western Kenya. Int J Parasitol Drugs Drug Resist. 2015;5(3):92–9. doi: 10.1016/j.ijpddr.2015.05.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref067] 67.Akala HM, Eyase FL, Cheruiyot AC, Omondi AA, Ogutu BR, Waters NC, et al. Antimalarial drug sensitivity profile of western Kenya Plasmodium falciparum field isolates determined by a SYBR Green I in vitro assay and molecular analysis. Am J Trop Med Hyg. 2011;85(1):34–41. doi: 10.4269/ajtmh.2011.10-0674 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref068] 68.Rougemont M, Van Saanen M, Sahli R, Hinrikson HP, Bille J, Jaton K. Detection of four Plasmodium species in blood from humans by 18S rRNA gene subunit-based and species-specific real-time PCR assays. J Clin Microbiol. 2004;42(12):5636–43. doi: 10.1128/JCM.42.12.5636-5643.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref069] 69.Kamau E, Alemayehu S, Feghali KC, Juma DW, Blackstone GM, Marion WR, et al. Sample-ready multiplex qPCR assay for detection of malaria. Malar J. 2014;13:158. doi: 10.1186/1475-2875-13-158 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref070] 70.Calderaro A, Piccolo G, Gorrini C, Montecchini S, Rossi S, Medici MC, et al. A new real-time PCR for the detection of Plasmodium ovale wallikeri. PLoS One. 2012;7(10):e48033. doi: 10.1371/journal.pone.0048033 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref071] 71.Hawadak J, Dongang Nana RR, Singh V. Global trend of Plasmodium malariae and Plasmodium ovale spp. malaria infections in the last two decades (2000-2020): a systematic review and meta-analysis. Parasit Vectors. 2021;14(1):297. doi: 10.1186/s13071-021-04797-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref072] 72.Chen J, Ma X, Tang J, Xu S, Gu Y, Tang F, et al. Disparate selection of mutations in the dihydrofolate reductase gene (dhfr) of Plasmodium ovale curtisi and P. o. wallikeri in Africa. PLoS Negl Trop Dis. 2022;16(12):e0010977. doi: 10.1371/journal.pntd.0010977 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref073] 73.Joste V, Coppée R, Bailly J, Rakotoarivony Y, Tchokoteu FGT, Achache S, et al. Plasmodium ovale spp dhfr mutations associated with reduced susceptibility to pyrimethamine in sub-Saharan Africa: a retrospective genetic epidemiology and functional study. The Lancet Microbe. 2024;5(7):669–78. [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref074] 74.Bruce MC, Donnelly CA, Alpers MP, Galinski MR, Barnwell JW, Walliker D, et al. Cross-species interactions between malaria parasites in humans. Science. 2000;287(5454):845–8. doi: 10.1126/science.287.5454.845 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref075] 75.Bruce MC, Day KP. Cross-species regulation of Plasmodium parasitemia in semi-immune children from Papua New Guinea. Trends Parasitol. 2003;19(6):271–7. doi: 10.1016/s1471-4922(03)00116-8 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref076] 76.Reece SE, Thompson J. Transformation of the rodent malaria parasite Plasmodium chabaudi and generation of a stable fluorescent line PcGFPCON. Malar J. 2008;7:183. doi: 10.1186/1475-2875-7-183 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref077] 77.Mideo N. Parasite adaptations to within-host competition. Trends Parasitol. 2009;25(6):261–8. doi: 10.1016/j.pt.2009.03.001 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref078] 78.Costa G, Gildenhard M, Eldering M, Lindquist RL, Hauser AE, Sauerwein R, et al. Non-competitive resource exploitation within mosquito shapes within-host malaria infectivity and virulence. Nat Commun. 2018;9(1):3474. doi: 10.1038/s41467-018-05893-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref079] 79.Ramiro RS, Pollitt LC, Mideo N, Reece SE. Facilitation through altered resource availability in a mixed-species rodent malaria infection. Ecol Lett. 2016;19(9):1041–50. doi: 10.1111/ele.12639 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref080] 80.Faye FBK, Spiegel A, Tall A, Sokhna C, Fontenille D, Rogier C, et al. Diagnostic criteria and risk factors for Plasmodium ovale malaria. J Infect Dis. 2002;186(5):690–5. doi: 10.1086/342395 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref081] 81.Hemmer CJ, Holst FGE, Kern P, Chiwakata CB, Dietrich M, Reisinger EC. Stronger host response per parasitized erythrocyte in Plasmodium vivax or ovale than in Plasmodium falciparum malaria. Trop Med Int Health. 2006;11(6):817–23. doi: 10.1111/j.1365-3156.2006.01635.x [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref082] 82.McQueen PG, McKenzie FE. Competition for red blood cells can enhance Plasmodium vivax parasitemia in mixed-species malaria infections. Am J Trop Med Hyg. 2006;75(1):112–25. doi: 10.4269/ajtmh.2006.75.112 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0334188.ref083] 83.Okafor CN, Finnigan NA. Plasmodium ovale Malaria. StatPearls. Treasure Island (FL): StatPearls Publishing. 2023. [PubMed] [Google Scholar]

[pone.0334188.ref084] 84.Hemmer CJ, Kern P, Holst FG, Radtke KP, Egbring R, Bierhaus A, et al. Activation of the host response in human Plasmodium falciparum malaria: relation of parasitemia to tumor necrosis factor/cachectin, thrombin-antithrombin III, and protein C levels. Am J Med. 1991;91(1):37–44. doi: 10.1016/0002-9343(91)90071-5 [DOI] [PubMed] [Google Scholar]

[pone.0334188.ref085] 85.Nyarko PB, Claessens A. Understanding Host-Pathogen-Vector Interactions with Chronic Asymptomatic Malaria Infections. Trends Parasitol. 2021;37(3):195–204. doi: 10.1016/j.pt.2020.09.017 [DOI] [PubMed] [Google Scholar]

PERMALINK

High prevalence of Plasmodium ovalewallikeri in co-infections with Plasmodium falciparum in symptomatic than asymptomatic Plasmodium parasite infections in Kisumu, Kenya

Jackline A Juma

Oliver J Watson

Dennis W Juma

Benjamin H Opot

Gladys Chemwor

Mary Mutahi

Raphael Okoth

Edwin W Mwakio

Redemptah Yeda

Charles O Okello

Agnes Cheruiyot

Duke Omariba

Liliana Dayo

Hellen A Ogola

Gladys Biwott

Charles Adega

Fredrick Oluoch

Vincent Omondi

George Otieno

Edwin Kamau

Ben Andagalu

Peter Sifuna

Amanda Roth

Sammy Khagayi

Eric C Garges

Bernhards Ogutu

Hoseah M Akala

Roles

Abstract

Introduction

Materials and methods

Ethical considerations

Study site and sample collection

Fig 1. Map of Kombewa.

Molecular assay

Nucleic acids extraction.

Plasmodium genus diagnosis by molecular methods.

Table 1. Primers and probes used for screening and identification of Plasmodium species.

Detection of species composition of infections.

Data management and statistical analysis

Results

Table 2. Participants Metadata. Metadata for symptomatic and asymptomatic Plasmodium infections.

Table 3. Overall Plasmodium species frequency. Overall Plasmodium species frequency detected in the samples.

Symptomatic infections

Fig 2. Plasmodium single species and mixed species frequency among symptomatic infections by molecular diagnosis.

Asymptomatic infections

Fig 3. Plasmodium mixed and single species frequency among asymptomatic infections by molecular diagnosis.

Fig 4. Odds of Plasmodium species composition in infection presentation.

Discussion

Conclusion

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Kristan Alexander Schneider

Roles

Author response to Decision Letter 1

Decision Letter 1

Kristan Alexander Schneider

Roles

Author response to Decision Letter 2

Decision Letter 2

Kristan Alexander Schneider

Roles

Acceptance letter

Kristan Alexander Schneider

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases