Activation of the Nuclear Factor Kappa-light-chain-enhancer of Activated B-cells Pathway Induces a Pro-inflammatory Network in Patients with Pulmonary Tuberculosis

Abstract

Background:

Leukocyte-stimulating inflammatory cytokines, including interleukin (IL)-27, IL-1β, and IL-10, in conjunction with the transcription factor nuclear factor kappa-light-chain-enhancer of activated B-cells (NF-κB), are essential in limiting Mycobacterium tuberculosis infections; however, it remains uncertain if these indicators are a reliable indicator of the severity of TB illness.

Materials and Methods:

Using real-time polymerase chain reaction (PCR), we examined the mRNA expression of IL-27, IL-1β, IL-10, and NF-κB in peripheral blood mononuclear cell responses in patients with tuberculosis (TB) (n = 25).

Results:

PCR amplification of 16S specific to mycobacterium DNA showed 84% positivity rate among the 25 samples. Sputum patients with active TB showed higher activation NF-κB mRNA expression when compared to healthy controls. Furthermore, the multidimensional IL-27 secretion in TB patients showed statistically significant mRNA expression as compared to healthy controls. Similarly, TB patients had drastically changed pro-inflammatory cytokine IL-1β mRNA expression. In addition, TB patients’ anti-inflammatory cytokine IL-10 mRNA expression was substantially lower than that of healthy controls.

Conclusion:

Our findings highlight significant alterations in cytokine expression (IL-27, IL-1β, and IL-10) and NF-κB activation in active TB patients, indicating their potential roles in TB pathogenesis. However, further research is required to confirm their value as biomarkers for disease severity.

INTRODUCTION

Tuberculosis (TB) has claimed the lives of approximately 100 million people in the last century. The host immune response allows many infected individuals not to develop active TB despite being infected with Mycobacterium tuberculosis (MTB).[1] T lymphocytes are recruited to the lungs within granulomas, which are composed of a variety of cell types, during the response to MTB infection. To keep MTB infection in check, a complex interaction between different cell populations is required. Chemokines produced by various immune cells facilitate subsequent immune cell recruitment to the infection site.[2] However, MTB has evolved strategies to evade host immune mechanisms, which complicates TB control efforts. Understanding the interaction between host and pathogen can aid in developing new therapies to combat drug-resistant TB and reduce the current lengthy treatment duration.[3]

Controlling TB remains challenging due to MTB’s ability to evade host immune defenses and persist within phagocytes.[4] Adaptive immunity significantly influences TB pathogenesis, with early cellular-mediated responses crucial for localizing MTB in lung tissues.[5] Cytokines such as interleukin (IL)-1β, IL-2, IL-12, interferon gamma (IFNγ), and tumor necrosis factor-alpha (TNF-α) are key pro-inflammatory markers mediating this response.[6] Conversely, anti-inflammatory cytokines, including IL-4, IL-13, and IL-10, inhibit protective immune responses, facilitating active infection.[7] Balancing pro- and anti-inflammatory responses is thus critical for effective disease control and influences diagnostic outcomes. Immune profiles differ across populations, and impaired immunity complicates TB management, limiting vaccine effectiveness. Early detection of infection and immune compromise could improve treatment outcomes. Hence, comprehending the interaction between the host and pathogen is crucial to devise new treatment options for drug-resistant TB and reduce the current prolonged treatment duration. The current study examined the gene expression of transcription factors and inflammatory markers in active TB patients.

MATERIALS AND METHODS

Study population

This prospective study was conducted at Vinayaka Mission’s Medical College and Hospital, Karaikal, India, following approval from the Institutional Ethics Committee (IEC approval no: VMMC/2023/APR/02). A total of 50 participants, comprising 25 patients diagnosed with pulmonary TB and 25 healthy controls, were enrolled after obtaining written informed consent. Each participant provided 2 mL of peripheral blood and a sputum sample for analysis. The cohort included both male and female participants. Clinical and pathology records were reviewed to obtain demographic data, clinicopathological characteristics, and overall health status. All procedures involving human participants were performed in accordance with institutional guidelines and the ethical standards laid down in the Declaration of Helsinki.

Detection of mycobacterium through polymerase chain reaction

A study was conducted to collect respiratory specimens from 25 patients and 25 controls in a prospective manner. To ensure proper performance, all collected specimens were subjected to decontamination using the N-acetyl-L-cysteine–NaOH procedure, following the protocols outlined by the Centers for Disease Control and Prevention. The assay used in this study targeted the gene responsible for encoding the small subunit rRNA (16S rRNA). The lysates of cultivated organisms were prepared using the clinical specimen preparation technique. The manufacturer’s instructions were followed to extract and purify the DNA from these clinical samples using a kit. A NanoDrop spectrophotometer (U2, MicroDigital, Gyeonggi-do, South Korea) was used to determine the concentration of these DNA preparations. To amplify DNA, polymerase chain reaction (PCR) amplifications were carried out in 10-µL reaction mixtures by mixing 1 µL of template DNA with an already-made amplification master mixture (Ampliqon, Odense, Denmark). The target DNAs were amplified using the thermal cycler PCR apparatus (Veriti, Applied Biosystems, USA).

Quantitative real-time polymerase chain reaction analysis

Total RNA was extracted using TRIzol reagent (Ambion, USA), and its purity and concentration were assessed using a NanoDrop spectrophotometer. Following DNase I treatment, first-strand cDNA was synthesized using RevertAid Reverse Transcriptase (Thermo Scientific, USA) as per the manufacturer’s protocol. Gene expression levels of nuclear factor kappa-light-chain-enhancer of activated B-cells (NF-κB), IL-27, IL-1β, and IL-10 in peripheral blood leukocytes were quantified using SYBR Green-based quantitative (QuantStudio 5, Applied Biosystems, USA). PCR conditions included initial activation at 94°C for 2 min, followed by 40 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s. Melt curve analysis confirmed amplification specificity. Oligos used in this study are listed in Table 1.

Table 1.

List of primers used in this study

Primer name	Sequence
NFΚβ	FP: AAGACCCACCCCACCATCAA
	RP: ACTGTGGATGCAGCAGCGGTC
IL-27	FP - GAGCAGCTCCCTGATGTTTC
	RP - AGCTGCATCCTCTCCATGTT
IL-1β	FP: AATCTGTACCTGTCCTGCGTGTT
	RP: TGGGTAATTTTTGGGATCTACACTCT
IL-10	FP - TCTCCGAGATGCCTTCAGCAGA
	RP - TCAGACAAGGCTTGGCAACCCA
β- actin	FP: TCCACCTTCCAGCAGATGTG
	RP: GCATTTGCGGTGGACGAT
16-S	FP - AGAGTTTGATCCTGGCTCAG
	RP - GGTTACCTTGTTACGACTT-

IL=Interleukin

Statistical analysis

An analysis of variance was used to assess statistical significance, and a post hoc unpaired t-test was used to compare control and other groups. P < 0.05 was considered statistically significant. For the statistical analysis, GraphPad Prism was utilized.

RESULTS

Polymerase chain reaction amplification of mycobacterium 16S gene in sputum samples

We obtained sputum samples from active TB patients (n = 25) and healthy controls (n = 25), and nucleic acid extraction was completed using the kit method. All the sputum samples were subjected to acid-fast bacilli staining and confirmed. Further, 16S PCR amplification of DNA extracted from samples obtained from TB patients showed positive amplification in 21 out of 50 samples [Figure 1] with the positivity rate of 84%. PCR amplification of the 16S gene specific to mycobacterium species at 450 bp size in agarose gel electrophoresis clearly showed the presence of mycobacterium DNA in active TB patients.

Figure 1.

Polymerase chain reaction (PCR) amplification of mycobacterium 16S DNA in sputum samples of tuberculosis patients

Expression of inflammatory markers in blood samples

The immune system responds to infections by producing IL-27 cytokines. Therefore, blood samples of patients with TB were studied for IL-27 gene expression. Real time-PCR (RT-PCR) results indicated that IL-27 gene expression was considerably increased in patients with TB [Figure 2].

Figure 2.

Quantitative real-time polymerase chain reaction (RT-PCR) study demonstrated the expression of interleukin 27 (IL-27) mRNA transcript levels in circulating lymphocytes from control and tuberculosis (TB)-positive patients. Semi-quantitative polymerase chain reaction analysis of IL-27 in experimental groups (a). Fold change in the transcript level of controls and TB-positive patients as assessed by quantitative RT-PCR (b). The standard error of the means was used to indicate the fold change in transcript levels (* – P < 0.05, ** – P < 0.01, *** – P < 0.001, and *** – P < 0.0001, respectively). IL = Interleukin

Transcription factor expression

NF-κB is a transcription factor that plays a critical role in regulating the immune system’s response to diseases like TB. Numerous investigations have demonstrated elevated NF-κB gene expression in TB patients. When patients with active TB were compared to their healthy controls, the results of RT-PCR clearly showed that these people had distinct gene expression [Figure 3].

Figure 3.

Quantitative real time (RT) demonstrated the expression of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) mRNA transcript levels in circulating lymphocytes from control and tuberculosis (TB)-positive patients. Semi-quantitative Polymerase chain reaction (PCR) analysis of NF-κB in experimental groups (a). Fold change in the transcript level of controls and TB-positive patients as assessed by quantitative RT-PCR (b). The standard error of the means was used to indicate the fold change in transcript levels (* – P < 0.05, ** – P < 0.01, *** – P < 0.001, and *** – P < 0.0001, respectively). NF-κB = Nuclear factor kappa-light-chain-enhancer of activated B cells

Pro-inflammatory gene expression

IL-1β is a pro-inflammatory cytokine involved in the immune system’s response to infection. The relative gene expression of IL-1β in TB patients was investigated using RT-PCR to better understand its role in TB pathogenesis. The relative gene expression of IL-1β in TB patients was investigated using RT-PCR. The findings showed that TB patients’ IL-1β expression differed significantly from that of healthy controls [Figure 4].

Figure 4.

Semi-quantitative polymerase chain reaction (PCR) study of interleukin (IL)-1β in experimental groups (a) and quantitative real-time PCR (RT-PCR) analysis demonstrated circulating lymphocytes from control and tuberculosis (TB)-positive patients expressed IL-1β mRNA transcript levels (b). Fold change in the transcript level of controls and TB-positive patients as assessed by quantitative RT-PCR. The standard error of the means was used to indicate the fold change in transcript levels (* – P < 0.05, ** – P < 0.01, *** – P < 0.001, and *** – P < 0.0001, respectively). IL = Interleukin

Anti-inflammatory gene expression

One important cytokine that reduces inflammation and controls the immune system’s reaction to infections is IL-10. It has also been investigated if the IL-10 gene plays a part in the pathophysiology of TB by examining its expression in these individuals. The findings demonstrated that, in comparison to healthy controls, TB patients’ IL-10 gene expression was considerably lower [Figure 5].

Figure 5.

Quantitative real time polymerase chain reaction (RT PCR) analysis demonstrated the expression of interleukin (IL) 10 mRNA transcript levels in circulating lymphocytes from control and tuberculosis (TB) positive patients. Semi quantitative PCR analysis of IL 10 in experimental groups (a). Quantitative RT PCR was used to measure the fold change in the transcript levels of TB positive patients and controls. (b) The standard error of the means was used to indicate the fold change in transcript levels (* – P < 0.05, ** – P < 0.01, * – P < 0.001, and *** – P < 0.0001, respectively). IL = Interleukin

DISCUSSION

MTB infection causes TB. When the body detects bacteria, it triggers an immune response, often resulting in inflammation.[8] Inflammation helps the immune system fight infections and repair damaged tissues. In TB patients, inflammation occurs in the lungs, lymph nodes, and other affected areas.[9] During early infection stages, inflammation can contain bacteria and prevent spreading. However, chronic inflammation may develop if the immune system cannot control the infection, leading to tissue damage and scarring. Chronic inflammation in TB causes symptoms such as coughing, fever, and fatigue, and complications such as respiratory failure and lung damage.[10] Treatment typically includes antibiotics to eliminate bacteria and reduce inflammation. In severe cases, anti-inflammatory medications may be prescribed to manage symptoms. Therefore, the present study aimed to understand the role of NF-κB and proinflammatory marker gene expression in patients with active TB.

IL-27 is a cytokine crucial to the immune response against infections. Studies on IL-27 expression in TB have shown varied results. Our findings align with this observation, indicating elevated IL-27 expression in active TB patients. Similarly, Fan et al. in 2022 documented significant differences in IL-27 expression between TB patients and healthy controls, highlighting its substantial role in shaping the immune response during TB infection.[11]

NF-κB is a transcription factor essential in regulating immune responses against diseases like TB. Multiple studies report elevated NF-κB expression in TB patients. Constantoulakis et al. observed significantly higher NF-κB gene expression in peripheral blood mononuclear cells from TB patients compared to healthy controls.[12] Our findings similarly demonstrated increased NF-κB expression in active TB patients. Rajopadhye et al. also confirmed elevated NF-κB levels in TB patients, suggesting its involvement in host defence mechanisms. Collectively, these studies indicate NF-κB’s critical role in the immune response to TB.[13]

IL-1β is a pro-inflammatory cytokine involved in the immune response to infections, including TB. Several studies have reported elevated IL-1β gene expression in TB patients compared to healthy controls, likely due to the host immune response.[14] Higher IL-1β levels were detected in the blood, sputum, and bronchoalveolar lavage fluid of TB patients.[15] Similarly, our findings indicated significantly increased IL-1β expression in active TB patients, underscoring its essential role in response to MTB infection. Zhao et al. observed significant upregulation of inflammation-related genes, including IL-1β and CXCL10, in pediatric TB patients compared to healthy controls, highlighting inflammation’s critical role in TB pathophysiology.[16]

One important cytokine that reduces inflammation and controls the immune system’s reaction to infections is IL-10. It has also been investigated if the IL-10 gene plays a part in the pathophysiology of TB by examining its expression in these individuals.[17] Numerous investigations have demonstrated that TB patients have higher levels of IL-10 gene expression than healthy people. It is thought that the host immune system uses this upregulation as a means of reducing inflammation and averting tissue damage. On the other hand, the development of chronic TB and the duration of the infection may potentially be facilitated by the overproduction of IL-10.[18]

Studies suggest IL-1β and IL-10 regulate the balance between pro- and anti-inflammatory cytokines, influencing TB progression. An imbalance may lead to chronic TB.[7] Restrepo (2018) reported significantly elevated IL-10 expression in patients coinfected with diabetes mellitus (DM) and TB compared to TB-only, DM-only, and healthy controls.[19]

CONCLUSION

Our findings clearly demonstrate the critical role of IL-10 gene expression in the immune response against MTB infection. Further research is needed to fully understand IL-10’s involvement in TB pathophysiology and identify potential therapeutic targets.

Conflicts of interest

There are no conflicts of interest.

Funding Statement

Nil.