Cabergoline Suppresses FSH‐Induced Differentiation and Steroidogenesis in Primary Cultured Rat Granulosa Cells

Yusuke Mori; Hiroshi Kishi; Ayako Hasunuma; Yuta Kasahara; Aikou Okamoto

doi:10.1002/rmb2.70104

. 2026 Oct 8;25(1):e70104. doi: 10.1002/rmb2.70104

Cabergoline Suppresses FSH‐Induced Differentiation and Steroidogenesis in Primary Cultured Rat Granulosa Cells

Yusuke Mori ¹, Hiroshi Kishi ^1,^✉, Ayako Hasunuma ¹, Yuta Kasahara ¹, Aikou Okamoto ¹

PMCID: PMC13647201 PMID: 42851757

ABSTRACT

Purpose

Cabergoline, a dopamine D₂ receptor agonist widely used to prevent ovarian hyperstimulation syndrome (OHSS), has unclear effects on granulosa cells during the follicular phase. This study aimed to investigate how cabergoline affects follicle‐stimulating hormone (FSH)‐induced cell differentiation and steroidogenesis.

Methods

Primary granulosa cells were isolated from immature female rats pretreated with diethylstilbestrol (DES) and cultured under four conditions: control, cabergoline alone, FSH alone, and FSH combined with cabergoline. mRNA expression of Lhcgr, Cyp19a1, and related genes was quantified by real‐time PCR, and luteinizing hormone (LH) receptor binding, estradiol (E₂) and progesterone (P₄) secretion, and cyclic adenosine monophosphate (cAMP) production were evaluated. Dopamine D₂ receptor expression was analyzed by Western blotting.

Results

Cabergoline significantly suppressed FSH‐induced mRNA expression of Lhcgr, Cyp19a1, Cyp11a1, and Hsd3b1; hCG binding; E₂ and P₄ secretion; and cAMP accumulation. Most inhibitory effects were dose dependent, although cAMP suppression did not exhibit clear concentration dependency. Dopamine D₂ receptor expression was detectable, although at low levels.

Conclusions

Cabergoline suppresses FSH‐induced granulosa cell differentiation and steroidogenesis, at least partly through attenuation of FSH‐induced cAMP signaling. Although dopamine D₂ receptor signaling may contribute to the inhibitory effects of cabergoline, the downstream molecular mechanisms remain unclear, warranting further investigation.

Keywords: cabergoline, follicle‐stimulating hormone, granulosa cells, luteinizing hormone receptors, steroidogenesis

1. Introduction

Cabergoline (Cab), a dopamine D₂ receptor agonist, is clinically used for the treatment of hyperprolactinemia and Parkinson's disease [1, 2]. It reduces prolactin secretion by acting on dopamine D₂ receptors in the anterior pituitary and exerts antiparkinsonian effects via D₂ receptor activation in the nigrostriatal pathway. In addition to these central actions, cabergoline has been reported to act directly on the ovary. Its efficacy in preventing ovarian hyperstimulation syndrome (OHSS) has been demonstrated in recent years [3, 4], and it is now widely applied in reproductive medicine.

Previous studies investigating the effects of cabergoline on ovarian function have primarily focused on OHSS using rat models and human luteinized granulosa cells. These studies showed that dopamine D₂ receptor activation suppresses vascular endothelial growth factor (VEGF) secretion and inhibits VEGF/vascular endothelial growth factor receptor 2 (VEGFR2) signaling [5, 6, 7]. These mechanisms are considered central to the clinical efficacy of cabergoline in OHSS prevention. However, the effects of cabergoline on follicular development and ovarian steroidogenesis remain poorly understood. A previous study reported that co‐treatment with cabergoline suppresses estradiol (E₂) and progesterone (P₄) production in granulosa cells stimulated with follicle‐stimulating hormone (FSH) [8]. Nevertheless, its influence on cellular differentiation markers, such as luteinizing hormone (LH) receptor expression, remains unclear.

A clinical observation of attenuated estradiol response during high‐dose cabergoline treatment further motivated this study. This clinical observation raised the possibility that cabergoline directly impairs ovarian responsiveness to FSH. To investigate this hypothesis, we conducted an in vitro study using a primary culture system of rat ovarian granulosa cells. In rodents, diethylstilbestrol (DES), a synthetic estrogen, has been reported to enhance granulosa cell proliferation and promote the development of preantral and early antral follicles [9]. Granulosa cells isolated from DES‐pretreated rats are widely used for functional analyses. In this culture system, granulosa cells express FSH receptors from the early phase of culture, while LH receptor expression is initially absent and is induced only after FSH stimulation [10, 11]. This induction is concentration‐dependent and can also be elicited by cyclic adenosine monophosphate (cAMP) stimulation [12].

In this study, we aimed to clarify the effects of cabergoline on FSH‐induced gene and protein expression, including LH receptor expression as well as ovarian steroid hormone synthesis, and to elucidate the underlying mechanisms in this culture system.

2. Materials and Methods

2.1. Hormones and Reagents

Dulbecco's Modified Eagle's Medium (DMEM)/Nutrient Mixture F‐12 Ham and bovine serum albumin (BSA) were obtained from Sigma‐Aldrich (St. Louis, MO, USA). DES, testosterone, and forskolin were purchased from Tokyo Chemical Industry Co. Ltd. (Tokyo, Japan). Cabergoline was obtained from Med Chem Express (Monmouth Junction, NJ, USA). Cabergoline was dissolved in dimethyl sulfoxide (DMSO). In the revised experiments, DMSO was added to all experimental groups, including controls, at an identical final concentration (≤ 0.2% v/v). Cholera toxin was purchased from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). Gentamicin sulfate and amphotericin B were purchased from Thermo Fisher Scientific (Waltham, MA, USA). 3‐Isobutyl‐1‐methylxanthine (IBMX) was obtained from Nacalai Tesque Inc. (Kyoto, Japan). The RNA extraction kits were obtained from Takara Bio Inc. (Shiga, Japan). Recombinant human FSH and human chorionic gonadotropin (hCG) were obtained from Merck Biopharma Co. Ltd. (Tokyo, Japan).

2.2. Animals

Immature female Wistar rats (21 days old; Japan SLC Inc., Hamamatsu, Japan) were housed under controlled conditions (22°C ± 2°C; 12‐h light/12‐h dark cycle) with ad libitum access to food and water. Details of ethical oversight and regulatory compliance are provided in Ethics section.

2.3. Granulosa Cell Culture

Granulosa cells were isolated and cultured according to a previously published method using a primary culture system of rat granulosa cells [13, 14]. Immature female Wistar rats (21 days old) were subcutaneously injected with DES (2 mg dissolved in 0.2 mL sesame oil) once daily for four consecutive days. Ovaries were dissected from 25‐day‐old rats and transferred to a 100 mm culture dish (Corning) containing DMEM. Granulosa cells were released into the medium by puncturing ovarian follicles with a 26‐gauge needle. Granulosa cells obtained from 10 rats per experiment were pooled on the same day to obtain a sufficient number of cells and to minimize inter‐animal variability. The pooled cell suspension was passed through a 70‐μm cell strainer and collected in a centrifuge tube. The cell suspension was centrifuged at approximately 415× g for 5 min, and the supernatant was removed. The cell pellet was resuspended in DMEM by repeated pipetting with a Pasteur pipette and centrifuged again at approximately 415× g for 5 min. This washing procedure was repeated three times. After the final centrifugation, the supernatant was removed, and the cell pellet was resuspended in DMEM containing BSA (1 g/L) and thoroughly mixed by repeated pipetting with a Pasteur pipette. Cells were then counted and seeded at a density of 2 × 10⁶ viable cells per 35‐mm collagen‐coated dish or at an equivalent density in 12‐well collagen‐coated plates.

Independent pools prepared on different days were considered biological replicates (n ≥ 3), and each independent pool was used to assess all experimental conditions. Data points represent independent pools. The culture medium consisted of DMEM containing BSA (1 g/L), gentamicin (20 mg/L), and amphotericin B (500 μg/L). Cells were cultured according to previously described methods [13, 14] at 37°C in a humidified atmosphere of 5% CO₂. After 24 h of culture, the designated reagents were added directly to the existing culture medium without medium replacement. Cellular responses—including gene expression, hormone secretion, receptor binding, cAMP production, and protein expression—were then analyzed.

2.4. RNA Isolation

Granulosa cells were maintained in 12‐well collagen‐coated plates (1 × 10⁶ viable cells/well in 1 mL of medium) for 24 h. After this period, reagents were added, and cells were further cultured for 24 h under four conditions: control (no additives), cabergoline alone, FSH alone, and FSH plus cabergoline (0.01–10 μM), with the cabergoline concentrations selected based on a previous in vitro study using primary rat granulosa cells [8]. Total RNA was extracted using the NucleoSpin RNA Plus kit (Macherey‐Nagel, Düren, Germany) following the supplier's protocol. Briefly, cells were lysed, genomic DNA (gDNA) was removed using a gDNA removal column, and the lysates were applied to a silica membrane column. After washing, total RNA was eluted with RNase‐free water.

2.5. Reverse Transcription Followed by Quantitative Real‐Time Polymerase Chain Reaction

Extracted RNA was reverse transcribed into cDNA using the Transcriptor Universal cDNA Master (Roche). Reverse transcription was performed in a thermal cycler under the following conditions: 25°C for 5 min, 55°C for 10 min, and 85°C for 5 min. qPCR was performed using gene‐specific primers (Table 1) and PowerTrack SYBR Green Master Mix (Thermo Fisher Scientific) on the QuantStudio 3 Real‐Time PCR System (Thermo Fisher Scientific). Melting curve analysis was performed after amplification to confirm the specificity of each PCR product. All qPCR reactions were performed in triplicate. Relative mRNA expression levels were calculated using the ΔΔCT method [15]: ΔCT = CTgene − CTgapdh, ΔΔCT = ΔCTsample − ΔCTcalibrator, and relative expression = 2^−ΔΔCT. For mRNAs induced by FSH (e.g., Lhcgr and Cyp19a1), the 24 h FSH‐stimulated group was used as the calibrator. For constitutively expressed genes (e.g., Fshr), baseline expression at time 0 was used as the calibrator. Glyceraldehyde‐3‐phosphate dehydrogenase (Gapdh) was used as the endogenous reference gene because it has been widely used in previous studies of primary rat granulosa cells [14, 16]. In addition, Hypoxanthine phosphoribosyltransferase 1 (Hprt1) was evaluated as an alternative endogenous reference gene [17]. Data are presented as the mean ± standard error of the mean (SEM) from at least three independent experiments performed under identical conditions.

TABLE 1.

Primer sequences for quantitative real‐time polymerase chain reaction.

Primer name	Accession no.	Primer sequence (5′‐3′)
Gapdh	NM_017008.4	Forward (5′‐3′): AGTGCCAGCCTCGTCTCATA Reverse (5′‐3′): GTAACCAGGCGTCCGATACG
Lhcgr	NM_012978.2	Forward (5′‐3′): GACGACTCTAATCTCGCTGGAG Reverse (5′‐3′): GCGATGAGCGTCTGAATGGA
Cyp19a1	NM_017085.2	Forward (5′‐3′): GCTGGACACTTCTAACACGCT Reverse (5′‐3′): AAGTCCTTGACGGATCTCTCATAC
Fshr	NM_199237.2	Forward (5′‐3′): GGTGACAGAGATTCCGACCG Reverse (5′‐3′): GGTTGGAGAACACATCTGCCT
Hsd17b1	NM_012851.2	Forward (5′‐3′): GCTGGAAGCGCATGAGTTG Reverse (5′‐3′): TGCTGGCACAGTACACTTCG
Star	NM_031558.3	Forward (5′‐3′): ACTCAACAACCAGGAAGGCTG Reverse (5′‐3′): CACCTGGCACCACCTTACTTA
Cyp11a1	NM_017286.3	Forward (5′‐3′): AACGGCACACACAGAATCCATTA Reverse (5′‐3′): CTGGTAATACTGGTGATAGGCCAC
Hsd3b1	NM_001007719.3	Forward (5′‐3′): ACACCGCTGCTGTCATTGAT Reverse (5′‐3′): ATGAAGGCTGGCACACTGG

Open in a new tab

Abbreviations: Cyp11a1, cytochrome P450 family 11 subfamily A member 1; Cyp19a1, cytochrome P450 family 19 subfamily A member 1; Fshr, follicle‐stimulating hormone receptor; Gapdh, glyceraldehyde‐3‐phosphate dehydrogenase; Hsd17b1, hydroxysteroid (17‐beta) dehydrogenase 1; Hsd3b1, hydroxy‐delta‐5‐steroid dehydrogenase, 3 beta‐ and steroid delta‐isomerase 1; Lhcgr, luteinizing hormone/choriogonadotropin receptor; Star, Steroidogenic acute regulatory protein.

2.6. Receptor Binding Assay

The receptor binding assay was performed according to a previously published method using a primary culture system of rat granulosa cells [14]. Granulosa cells were cultured in 35‐mm collagen‐coated dishes (2 × 10⁶ viable cells/dish in 2 mL of medium) for 24 h. Reagents were then added, and cells were cultured for 48 h under three conditions: control (no additives), FSH alone, and FSH plus cabergoline (0.1–10 μM). The 48‐h treatment period was selected based on a previously published study using a primary culture system of rat granulosa cells [14]. Recombinant hCG (100 ng/mL) was added and incubated at 37°C for 2 h. Cells were placed on ice, washed twice with cold culture medium and twice with PBS (−), and then lysed with radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris–HCl; 150 mM NaCl; 1% Nonidet P‐40; 0.5% sodium deoxycholate; 0.1% SDS; adjusted to pH 7.6) containing protease (cOmplete Mini, Roche) and phosphatase (PhosSTOP, Roche) inhibitors. After incubation on ice for 5 min, lysates were centrifuged at 17 400× g for 10 min at 4°C, and supernatants were collected for analysis. Protein concentrations were determined using the DC Protein Assay (Bio‐Rad Laboratories) according to the manufacturer's instructions. Briefly, protein samples were mixed with the assay reagents, absorbance was measured spectrophotometrically, and protein concentrations were determined using a BSA standard curve. hCG concentrations in lysates were quantified by chemiluminescent enzyme immunoassay (CLEIA; SRL Inc., Tokyo, Japan) and normalized to protein concentration. This method allows the evaluation of relative changes in receptor binding without the use of radiolabeled ligands, although its sensitivity is lower than that of conventional radioligand binding assays. Data are presented as the mean ± SEM from at least three independent experiments performed under identical conditions.

2.7. Estradiol (E₂ ) and Progesterone (P₄ ) Assay

Granulosa cells were cultured in 35‐mm collagen‐coated dishes at a density of 2 × 10⁶ viable cells per dish in 2 mL of culture medium for 24 h. After this initial culture period, all dishes received testosterone (100 nM) as a substrate, followed by treatment with FSH alone or FSH in combination with cabergoline (1–10 μM). Cells were cultured for an additional 24 h. The 24‐h treatment period was selected based on a previously published study using primary cultured rat granulosa cells [14]. After incubation, culture media were collected, and E₂ and P₄ concentrations were determined by electrochemiluminescence immunoassay (ECLIA; SRL Inc., Tokyo, Japan). Data are presented as the mean ± SEM from at least three independent experiments performed under identical conditions.

2.8. cAMP Assay

The cAMP assay was performed according to a previously published method using a primary culture system of rat granulosa cells [14]. Granulosa cells were cultured in 35‐mm collagen‐coated dishes at a density of 2 × 10⁶ viable cells per dish in 2 mL of culture medium for 24 h. After this period, reagents were added directly to the existing culture medium without medium replacement, and the cells were incubated for 2 h, according to a previously published protocol [14]. The experimental groups consisted of control (no additives), FSH alone, and FSH combined with cabergoline (0.01–10 μM). Following incubation, the culture medium was collected, and cAMP concentrations were quantified by radioimmunoassay (RIA; SRL Inc., Tokyo, Japan) [14, 18]. Results were normalized to the corresponding protein concentrations. Protein concentrations were determined using the DC Protein Assay (Bio‐Rad Laboratories) according to the manufacturer's instructions. Briefly, protein samples were mixed with the assay reagents, absorbance was measured spectrophotometrically, and protein concentrations were determined using a BSA standard curve. In parallel experiments, cells were pre‐incubated with IBMX (0.5 mM) for 30 min, and forskolin (0.1, 1, or 10 μM) was used instead of FSH to stimulate cAMP production. The concentrations of forskolin and IBMX were selected according to previously published studies using primary cultured rat granulosa cells [19, 20]. Data are presented as the mean ± SEM from at least three independent experiments performed under identical conditions.

2.9. Western Blot Analysis

Granulosa cells were cultured in 35‐mm collagen‐coated dishes at a density of 2 × 10⁶ viable cells per dish in 2 mL of culture medium for 24 h. Reagents were then added, and cells were cultured for 24 h under the following conditions: control (no additives), FSH alone, and FSH plus cabergoline (1 μM). The 24‐h treatment period was selected based on a previously published study using a primary culture system of rat granulosa cells [21]. After incubation, cells were placed on ice, washed twice with PBS (−), and lysed with RIPA buffer. Lysates were incubated on ice for 5 min, centrifuged at 17 400× g for 10 min at 4°C, and the supernatants were collected. Protein concentrations were determined using the DC Protein Assay (Bio‐Rad Laboratories) according to the manufacturer's instructions. Briefly, protein samples were mixed with the assay reagents, absorbance was measured spectrophotometrically, and protein concentrations were determined using a BSA standard curve. Equal amounts of protein were separated by electrophoresis on NuPAGE 4%–12% Bis‐Tris gels (Thermo Fisher Scientific) and transferred onto PVDF membranes using an iBlot Gel Transfer Device (Thermo Fisher Scientific). Membranes were blocked for 1 h at room temperature (22°C–24°C) in Tris‐buffered saline containing 0.1% Tween 20 and 5% nonfat dry milk. Membranes were then incubated overnight at 4°C with a rabbit monoclonal anti‐dopamine D₂ receptor antibody (Anti‐Dopamine D₂ Receptor [HL1478] − BSA and Azide free, ab313857; Abcam), diluted 1:2000 in Tris‐buffered saline containing 0.1% Tween 20 and 5% BSA. β‐actin was used as a loading control [22, 23], and membranes were incubated overnight at 4°C with a rabbit monoclonal anti‐β‐actin antibody (#4970S; Cell Signaling Technology) diluted 1:4000. Membranes were then incubated for 1 h at room temperature (22°C–24°C) with an HRP‐conjugated anti‐rabbit secondary antibody (#7074S; Cell Signaling Technology), diluted 1:10 000 in Tris‐buffered saline containing 0.1% Tween 20 and 5% nonfat dry milk. Immunoreactive signals were visualized using ImmunoStar LD (FUJIFILM Wako Pure Chemical Corporation). Protein molecular weights were estimated by comparison with molecular weight markers. Rat brain extract (sc‐2392; Santa Cruz Biotechnology) was included as a positive control.

2.10. Statistical Analysis

Statistical analyses were performed using Prism software, version 9.5.1 (GraphPad Software, San Diego, California). Prior to statistical analysis, normality was assessed using the Shapiro–Wilk test, and homogeneity of variance was evaluated using the Brown–Forsythe test. Most datasets satisfied these assumptions, although minor deviations from normality were observed in a small number of groups. Quantitative data are expressed as the mean ± SEM from at least three independent experiments conducted under identical conditions. For each independent pool, experiments were performed in triplicate. The technical replicates were averaged to obtain a single value for each independent pool, and these values from at least three independent pools were used for statistical analysis (n ≥ 3). One‐way analysis of variance (ANOVA), followed by Tukey's post hoc test for multiple comparisons, was used to compare three or more groups. For experiments involving two independent variables (e.g., forskolin concentration and cabergoline treatment), two‐way ANOVA was used to assess main effects and interactions. p value < 0.05 was considered statistically significant.

3. Results

3.1. Gene Expression

Basal mRNA expression levels of Lhcgr and Cyp19a1 before FSH stimulation were negligible and were not affected by cabergoline alone. In contrast, treatment with FSH (30 ng/mL) markedly increased the expression of Lhcgr and Cyp19a1 (Figure 1A,B). In this culture system, Fshr mRNA expression was detectable from the beginning (Figure 1C). Co‐treatment with FSH and increasing concentrations of cabergoline (0.01–10 μM) led to a concentration‐dependent suppression of Lhcgr and Cyp19a1 expression compared with FSH alone, with significant suppression first observed at 0.1 μM for Lhcgr and at 0.01 μM for Cyp19a1 (Figure 1A,B). To exclude the potential influence of DMSO, key qPCR experiments were performed under vehicle‐matched conditions (DMSO at an identical final concentration across groups). Similar suppressive effects of cabergoline on Lhcgr and Cyp19a1 expression were observed in the presence of DMSO, and similar trends were observed when gene expression was normalized to Hprt1 (Figure S1A,B). Fshr mRNA expression was not significantly induced by FSH and was not affected by cabergoline (Figure 1C). To further examine the effects of cabergoline on other steroidogenic enzymes, additional genes were analyzed (Figure 1D–G). Expression of Cyp11a1 and Hsd3b1 was significantly suppressed by cabergoline co‐treatment, with significant suppression first observed at 0.1 μM for both genes (Figure 1F,G). In contrast, Hsd17b1 and Star expression remained unchanged (Figure 1D,E).

Effects of cabergoline on FSH‐induced mRNA expression of *Lhcgr*, *Cyp19a1*, and related genes. Granulosa cells isolated from DES‐primed immature rats were cultured for 24 h, followed by a 24‐h incubation under the following conditions: Control, cabergoline alone (10 μM), FSH alone (30 ng/mL), or FSH plus cabergoline (0.01–10 μM). mRNA expression was measured by quantitative RT‐PCR and normalized to *Gapdh*. Data are presented as the mean ± SEM from ≥ 3 independent experiments performed under identical conditions. Relative expression was calculated using the ΔΔCt method. For *Lhcgr, Cyp19a1, Cyp11a1*, and *Hsd3b1*, the FSH‐alone group was used as the calibrator. For *Fshr, Hsd17b1*, and *Star*, the control group was used as the calibrator. Different letters indicate statistically significant differences among the experimental groups according to Tukey's multiple comparisons test (p < 0.05). (A) *Lhcgr*; (B) *Cyp19a1*; (C) *Fshr*; (D) *Hsd17b1*; (E) *Star*; (F) *Cyp11a1*; (G) *Hsd3b1*. Cab, cabergoline; DES, diethylstilbestrol; FSH, follicle‐stimulating hormone; RT‐PCR, reverse transcription–polymerase chain reaction; SEM, standard error of the mean.

3.2. Protein/Receptor Binding Assay

The effect of cabergoline on functional hCG‐binding capacity, as a surrogate for cell‐surface LH receptor expression, was assessed using an hCG binding assay. In the absence of FSH, hCG binding was negligible. Treatment with FSH (30 ng/mL) significantly increased hCG binding. However, co‐treatment with FSH and cabergoline (0.1–10 μM) reduced hCG binding in a concentration‐dependent manner compared with FSH alone, with a significant reduction first observed at 10 μM (Figure 2).

Effects of cabergoline on FSH‐induced hCG binding to LH receptors. Granulosa cells from DES‐primed immature rats were cultured for 24 h, followed by a 48‐h incubation with control, FSH alone (30 ng/mL), or FSH plus cabergoline (0.1–10 μM). An hCG‐binding assay was performed. hCG concentrations in cell lysates were measured by CLEIA and normalized to protein content. Data are presented as the mean ± SEM from ≥ 3 independent experiments. No measurable binding was detected under conditions where LH receptor expression is expected to be minimal, indicating a low background under the present assay conditions. Different letters indicate statistically significant differences among the experimental groups according to Tukey's multiple comparisons test (p < 0.05). Cab, cabergoline; CLEIA, chemiluminescent enzyme immunoassay; DES, diethylstilbestrol; FSH, follicle‐stimulating hormone; hCG, human chorionic gonadotropin; SEM, standard error of the mean.

3.3. Hormone Secretion

To assess estradiol (E₂) production, testosterone—a substrate for estrogen synthesis—was added to the culture medium. E₂ concentrations were minimal in both the control and cabergoline‐alone groups. Treatment with FSH (30 ng/mL) alone markedly increased E₂ levels by promoting the conversion of testosterone to estradiol. However, co‐treatment with FSH and cabergoline (1–10 μM) reduced E₂ production in a concentration‐dependent manner compared with FSH alone, with a significant reduction first observed at 10 μM (Figure 3A). A similar trend was observed for progesterone (P₄). Co‐treatment with FSH and cabergoline (1–10 μM) decreased P₄ secretion in a concentration‐dependent manner compared with FSH alone, with a significant reduction first observed at 1 μM (Figure 3B).

Effects of cabergoline on FSH‐induced E₂ and P₄ secretion. Granulosa cells were cultured for 24 h. Testosterone (100 nM) was then added as a substrate, followed by a 24‐h incubation with control, FSH alone (30 ng/mL), or FSH plus cabergoline (1–10 μM). E₂ and P₄ concentrations in the culture medium were measured by ECLIA. Data are presented as the mean ± SEM from ≥ 3 independent experiments. Different letters indicate statistically significant differences among the experimental groups according to Tukey's multiple comparisons test (p < 0.05). (A) E₂; (B) P₄. Cab, cabergoline; E₂, estradiol; ECLIA, electrochemiluminescence immunoassay; FSH, follicle‐stimulating hormone; P₄, progesterone; SEM, standard error of the mean.

3.4. Signaling Mechanisms

cAMP accumulation in the culture medium, used as an indicator of FSH‐induced cAMP production, was measured. Basal cAMP levels were negligible in both the control and cabergoline‐alone groups. FSH (30 ng/mL) significantly increased cAMP levels. However, co‐treatment with FSH and increasing concentrations of cabergoline tended to reduce cAMP production, with a significant reduction observed only at 1 μM (Figure 4).

Effects of cabergoline on FSH‐induced cAMP production. Granulosa cells were cultured for 24 h and incubated for 2 h under control, FSH alone (30 ng/mL), or FSH plus cabergoline (0.01–10 μM). cAMP concentrations in the culture medium were measured by RIA and normalized to protein content. Data are presented as the mean ± SEM from ≥ 3 independent experiments. Different letters indicate statistically significant differences among the experimental groups according to Tukey's multiple comparisons test (p < 0.05). Cab, cabergoline; cAMP, cyclic adenosine monophosphate; FSH, follicle‐stimulating hormone; RIA, radioimmunoassay; SEM, standard error of the mean.

To determine the site of action of cabergoline, cells were treated with forskolin (10 μM) instead of FSH. Forskolin (10 μM) markedly increased cAMP levels, and this effect was not altered by cabergoline (Figure 5A). To further examine whether cabergoline affects adenylyl cyclase activity, we evaluated the dose–response relationship of forskolin‐induced cAMP production. As shown in Figure 5B, forskolin induced a dose‐dependent increase in cAMP levels, and cabergoline did not significantly affect this response at any concentration. In contrast, cabergoline significantly suppressed forskolin‐induced expression of Lhcgr and Cyp19a1 in a concentration‐dependent manner (Figure 5C1,C2), despite no change in cAMP levels.

Effects of cabergoline on forskolin‐induced cAMP production and mRNA expression of *Lhcgr* and *Cyp19a1*. (A) Granulosa cells were cultured for 24 h, pre‐incubated with IBMX (0.5 mM) for 30 min, and then treated for 2 h with control, forskolin alone (10 μM), or forskolin plus cabergoline (10 μM). cAMP concentrations in the culture medium were measured by RIA and normalized to protein content. Data are presented as the mean ± SEM from ≥ 3 independent experiments. Different letters indicate statistically significant differences among the experimental groups according to Tukey's multiple comparisons test (p < 0.05). (B) Granulosa cells were cultured for 24 h, pre‐incubated with IBMX (0.5 mM) for 30 min, and then treated for 2 h with increasing concentrations of forskolin (0.1–10 μM) in the presence or absence of cabergoline (10 μM). cAMP concentrations in the culture medium were measured by RIA and normalized to protein content. Data are presented as the mean ± SEM from ≥ 3 independent experiments. Statistical analysis was performed using two‐way ANOVA. (C) Granulosa cells were cultured for 24 h and then incubated for 24 h with control, forskolin alone (10 μM), or forskolin plus cabergoline (1–10 μM). mRNA expression was measured by quantitative RT–PCR and normalized to *Gapdh*. Data are presented as the mean ± SEM from ≥ 3 independent experiments. Relative expression was calculated using the ΔΔCt method, with the forskolin‐alone group as the calibrator. Different letters indicate statistically significant differences among the experimental groups according to Tukey's multiple comparisons test (p < 0.05). (C1) *Lhcgr*; (C2) *Cyp19a1*. Cab, cabergoline; cAMP, cyclic adenosine monophosphate; IBMX, 3‐isobutyl‐1‐methylxanthine; RT–PCR, reverse transcription–polymerase chain reaction; SEM, standard error of the mean.

3.5. Investigation of Mechanisms via D₂DR

Western blot analysis was performed to determine whether dopamine D₂ receptor (D₂DR)—the principal target of cabergoline—was expressed in the primary granulosa cell culture system. D₂DR‐specific bands were detected, although expression was low (Figure 6).

Effects of cabergoline on dopamine D₂ receptor (D₂DR) expression. Granulosa cells were cultured for 24 h, followed by a 24‐h incubation with control, FSH alone (30 ng/mL), or FSH plus cabergoline (1 μM). D₂DR protein expression was analyzed by Western blotting, with β‐actin used as a loading control. A positive control (P) was included. Cab, cabergoline; D₂DR, dopamine D₂ receptor; FSH, follicle‐stimulating hormone.

4. Discussion

In this study, we demonstrated that cabergoline, a D₂DR agonist, exerts inhibitory effects on rat ovarian granulosa cell differentiation and steroid hormone synthesis under FSH stimulation. Specifically, co‐treatment with cabergoline significantly suppressed FSH‐induced Lhcgr and Cyp19a1 mRNA expression, LH receptor protein expression, and the production of E₂ and P₄. These inhibitory effects appear to be mediated, at least in part, by the suppression of cAMP production in the FSH signaling pathway. However, the downregulation of gene expression was also observed under conditions where cAMP levels were not reduced, suggesting that cabergoline may also act downstream of cAMP signaling. In the primary granulosa cell culture system used in this study, FSH stimulation induces LH receptor expression and E₂ production, mimicking granulosa cell differentiation during the follicular phase. Thus, our findings suggest that cabergoline administration during the follicular phase may modulate granulosa cell responsiveness to FSH, including follicular development and steroidogenesis, which could potentially influence ovarian responsiveness during controlled stimulation in ART.

Most previous studies investigating the effects of cabergoline on ovarian function have focused on its role in preventing OHSS during the luteal phase after hCG administration. It is well established that hCG induces VEGF expression in luteinized granulosa cells [24], and secreted VEGF increases vascular permeability via VEGFR‐2 activation, a key mechanism underlying OHSS [25]. In OHSS rat models, cabergoline has been reported to suppress VEGFR‐2 phosphorylation and VEGF secretion, thereby reducing vascular permeability [5, 7]. These effects were partially reversed by co‐administration of a D₂DR antagonist, indicating that they are at least partly mediated through the D₂DR [7]. In vitro studies using human luteinized granulosa cells further demonstrated that cabergoline suppresses VEGF secretion in a concentration‐dependent manner and that this suppression correlates with D₂DR expression levels on the granulosa cell surface [6]. Collectively, these findings support the current clinical use of cabergoline for OHSS prevention. A systematic review and meta‐analysis also showed that cabergoline significantly reduces the risk of moderate to severe OHSS in clinical practice [4]. However, most studies have concentrated on the luteal phase or luteinized granulosa cells, and few have addressed the effects and mechanisms of cabergoline during the follicular phase, particularly in relation to FSH‐induced events. Negishi et al. [8] reported that cabergoline suppressed E₂ and P₄ production in cultured rat granulosa cells; however, their study did not investigate LH receptor expression, cAMP production, or mRNA expression. In the present study, we demonstrated for the first time that cabergoline significantly suppresses FSH‐induced responses, including LH receptor expression, steroid hormone synthesis, cAMP production, and mRNA expression. These findings suggest that cabergoline directly inhibits granulosa cell differentiation during the follicular phase, thereby providing important complementary evidence to previous studies.

FSH receptor (FSHR) is classified as a G protein–coupled receptor (GPCR) within the rhodopsin family. Its primary signaling pathway is mediated by the Gs protein, through which FSH binding activates intracellular signaling cascades [26]. Upon receptor activation, adenylyl cyclase is stimulated, leading to increased cAMP production, activation of protein kinase A (PKA), and subsequent phosphorylation of cAMP response element‐binding protein, ultimately regulating gene transcription [27, 28]. In this study, cabergoline significantly reduced cAMP accumulation following FSH stimulation, suggesting that it attenuates FSHR‐mediated signaling. To further investigate the mechanism, we assessed cAMP levels under conditions where adenylyl cyclase was activated independently of FSHR. Forskolin, a diterpene derived from Coleus forskohlii, directly activates adenylyl cyclase and increases intracellular cAMP levels [29]. In our experiments, forskolin alone markedly elevated cAMP levels; however, co‐treatment with cabergoline did not suppress this forskolin‐induced increase. Similarly, cholera toxin, which elevates intracellular cAMP by activating Gsα proteins [30], increased cAMP production, but cabergoline co‐treatment again had no effect (data not shown). These findings suggest that cabergoline preferentially affects signaling initiated by FSHR rather than directly inhibiting Gs proteins or adenylyl cyclase. Cabergoline showed a tendency to reduce cAMP production only at higher concentrations, whereas gene expression (e.g., Lhcgr and Cyp19a1) was suppressed even at lower concentrations. These findings suggest that the effective concentration of cabergoline differs depending on the endpoint, with cAMP production requiring higher concentrations than gene expression changes. Together, these observations indicate that the inhibitory effects of cabergoline are not solely mediated by cAMP suppression and may involve additional downstream or cAMP‐independent mechanisms. Interestingly, under forskolin stimulation—where cAMP levels remained unchanged—cabergoline significantly suppressed forskolin‐induced Lhcgr and Cyp19a1 mRNA expression in a concentration‐dependent manner. This indicates that the inhibitory effects of cabergoline are not limited to cAMP suppression but may involve downstream pathways. Notably, in contrast to Lhcgr and Cyp19a1, Star expression was not significantly altered despite reduced cAMP levels. This may reflect differences in temporal regulation or the involvement of cAMP‐independent pathways, particularly in this primary granulosa cell culture system. Unlike previous studies that primarily investigated cabergoline's role in regulating vascular permeability for OHSS prevention, this study provides the first evidence of a novel intra‐ovarian mechanism of cabergoline action. Further study is needed to elucidate the molecular basis of this effect.

Cabergoline is a D₂DR agonist. D₂DR gene expression has been reported in several human tissues, including the brain, retina, pituitary gland, adrenal gland, salivary glands, endometrium, prostate, testes, and ovaries [31, 32]. Dopamine D₂ receptors have also been reported in equine ovaries and human granulosa cells [33, 34]. Furthermore, the signaling and regulatory properties of D₂ receptor isoforms have been characterized using recombinant Chinese hamster ovary (CHO) cell lines [35]. In rats, D₂DR expression is detectable in luteinized granulosa and theca cells but is minimal or absent in preovulatory granulosa cells [7]. To examine whether D₂DR could potentially mediate cabergoline's effects in our system, we assessed D₂DR expression in granulosa cell culture using Western blot analysis. A D₂DR‐specific band was detected, although expression was low. Similarly, King et al. reported a low incidence of D₂DR mRNA expression in equine granulosa/theca tissues [33]. These findings suggest that dopamine D₂ receptors may be involved in the ovarian effects of cabergoline; however, because a D₂DR antagonist or genetic inhibition of D₂DR was not employed, the present study cannot establish whether the observed effects of cabergoline were mediated through D₂DR. Notably, a previous study investigating the mechanism by which cabergoline reduces VEGF has also reported the involvement of dopamine D₂ receptor signaling, while highlighting the presence of downstream pathways that are not yet fully understood [36]. The low level of D₂DR expression observed in granulosa cells in our experimental system may be an important factor when considering the effects of cabergoline in these cells. This low expression may be related to the relatively high concentrations of cabergoline required to elicit measurable effects in our experiments. Furthermore, the mechanism by which cabergoline acts in granulosa cells may differ from classical pituitary‐type dopamine D₂ receptor signaling.

Like FSHR, LH receptor (LHR) is a GPCR belonging to the rhodopsin family. Its primary signaling pathway is also mediated by Gs proteins upon binding of LH or hCG [37, 38]. To evaluate cabergoline's effects under LHR activation, we first stimulated granulosa cells with FSH to induce LHR expression, followed by hCG stimulation. We then measured cAMP production in the presence or absence of cabergoline. In contrast to the suppressive effects observed under FSH stimulation, cabergoline did not reduce cAMP levels in response to hCG (data not shown). These findings suggest that cabergoline's inhibitory effects are specific to FSHR‐mediated signaling.

Taking these results as a whole, it is possible that administration of cabergoline during the follicular phase may affect the response of granulosa cells to FSH stimulation, particularly when relatively high doses of cabergoline are administered.

The concentration of cabergoline used in this study (1 μM) exceeds plasma concentrations typically achieved with standard clinical dosing. However, this concentration is lower than the 100 μM used in previous in vitro studies investigating VEGF‐related mechanisms [6, 7]. The present study was designed to explore the cellular mechanisms of cabergoline action in an in vitro setting, and concentrations were therefore selected to reliably elicit measurable biological responses. In this context, our findings may be relevant to conditions in which higher doses of cabergoline are administered, such as the prevention of OHSS or the treatment of pituitary adenomas, where the ovarian effects of cabergoline may be more pronounced.

A limitation of this study is the use of an in vitro primary culture system of rat granulosa cells. The present study utilized granulosa cells from DES‐primed immature rats, a widely used model for investigating FSH responsiveness. However, DES exposure may influence steroidogenic gene expression [39], and thus this model may not fully reflect physiological ovarian conditions. Nevertheless, this system allows the isolation of a relatively homogeneous population of granulosa cells expressing FSH receptors, in which Lhcgr expression is initially minimal and subsequently induced by FSH. This feature is advantageous for examining early FSH responses under controlled conditions. Future studies using human granulosa cells, in vitro follicle culture systems, or in vivo rat models are needed to further clarify the effects of cabergoline on ovarian function.

In addition, several methodological limitations should be considered. In the present study, LH receptor expression was evaluated using an hCG binding assay based on unlabeled (“cold”) ligand and CLEIA detection. Although no appreciable binding was observed under conditions where LH receptor expression is expected to be minimal, suggesting limited non‐specific binding, the sensitivity of this method is lower than that of conventional radiolabeled ligand binding assays. Furthermore, competitive binding experiments using excess unlabeled ligands or other glycoprotein hormones (e.g., FSH or TSH) were not performed, and therefore the specificity of the binding could not be fully confirmed. Thus, the present assay should be interpreted as a semi‐quantitative evaluation of relative changes in receptor binding.

In addition, several methodological considerations regarding the cAMP assay should be noted. IBMX was included only in the forskolin cAMP experiments to inhibit phosphodiesterase activity and promote cAMP accumulation, whereas it was not used in the FSH cAMP experiments. Therefore, the presence or absence of IBMX represents an important difference in the experimental conditions and may have contributed to differences in the absolute cAMP levels, including baseline values, between the forskolin and FSH experiments. Accordingly, absolute cAMP levels should not be directly compared between these experiments. Furthermore, cAMP concentrations were measured in the culture medium rather than directly within the cells. This represents a limitation when interpreting intracellular cAMP signaling, and the cAMP data should therefore be interpreted as reflecting extracellular cAMP accumulation under the respective experimental conditions.

Finally, the relatively small sample size may limit the statistical power and generalizability of the findings.

In conclusion, cabergoline suppresses Lhcgr and aromatase expression, as well as E₂ and P₄ production, at least in part through modulation of FSH‐induced cAMP signaling. Although dopamine D₂ receptor signaling may contribute to the inhibitory effects of cabergoline, the precise site and underlying molecular mechanisms remain to be clarified, and further studies are warranted to elucidate the pathways involved.

Funding

This work was supported by JSPS KAKENHI (JP25K20100) and Terumo Life Science Foundation.

Ethics Statement

All animal procedures were conducted in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals and the institutional policies of The Jikei University School of Medicine. The protocol was approved by the Institutional Animal Care and Use Committee of The Jikei University School of Medicine (Approval No. 2019‐006; Approval Date: 3 June 2019). The study adhered to the ARRIVE (Animal Research: Reporting In Vivo Experiments) guidelines.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Effects of cabergoline on gene expression in the presence of DMSO (vehicle control) and normalization using Hprt1. Granulosa cells isolated from DES‐primed immature rats were cultured for 24 h, followed by a 24‐h incubation under the following conditions: control, cabergoline alone (10 μM), FSH alone (30 ng/mL), or FSH plus cabergoline (0.01–10 μM). mRNA expression was measured by quantitative RT‐PCR and normalized to Hprt1. Data are presented as the mean ± SEM from ≥ 3 independent experiments performed under identical conditions. Relative expression was calculated using the ΔΔCt method. The FSH‐alone group was used as the calibrator. Different letters indicate statistically significant differences among the experimental groups according to Tukey's multiple comparisons test (p < 0.05). (A) Lhcgr; (B) Cyp19a1. Cab, cabergoline; DES, diethylstilbestrol; DMSO, dimethyl sulfoxide; FSH, follicle‐stimulating hormone; RT‐PCR, reverse transcription–polymerase chain reaction; SEM, standard error of the mean.

RMB2-25-e70104-s001.zip^{(757.2KB, zip)}

Acknowledgments

This study was supported by JSPS KAKENHI (Grant JP25K20100) and Terumo Life Science Foundation. The authors thank Misato Saito for her valuable technical assistance.

Data Availability Statement

All data produced or examined in this study are included in this article. Additional data sets used in this study are available from the corresponding author upon reasonable request.

References

1. Pastor P. and Tolosa E., “Cabergoline in the Treatment of Parkinson's Disease,” Neurología 18 (2003): 202–209. [PubMed] [Google Scholar]
2. Colao A. and Savastano S., “Medical Treatment of Prolactinomas,” Nature Reviews. Endocrinology 7 (2011): 267–278. [DOI] [PubMed] [Google Scholar]
3. Alvarez C., Martí‐Bonmatí L., Novella‐Maestre E., et al., “Dopamine Agonist Cabergoline Reduces Hemoconcentration and Ascites in Hyperstimulated Women Undergoing Assisted Reproduction,” Journal of Clinical Endocrinology and Metabolism 92 (2007): 2931–2937. [DOI] [PubMed] [Google Scholar]
4. Leitao V. M. S., Moroni R. M., Seko L. M. D., Nastri C. O., and Martins W. P., “Cabergoline for the Prevention of Ovarian Hyperstimulation Syndrome: Systematic Review and Meta‐Analysis of Randomized Controlled Trials,” Fertility and Sterility 101 (2014): 664–675. [DOI] [PubMed] [Google Scholar]
5. Gómez R., González‐Izquierdo M., Zimmermann R. C., et al., “Low‐Dose Dopamine Agonist Administration Blocks Vascular Endothelial Growth Factor (VEGF)‐Mediated Vascular Hyperpermeability Without Altering VEGF Receptor 2‐Dependent Luteal Angiogenesis in a Rat Ovarian Hyperstimulation Model,” Endocrinology 147 (2006): 5400–5411. [DOI] [PubMed] [Google Scholar]
6. Ferrero H., García‐Pascual C. M., Gómez R., et al., “Dopamine Receptor 2 Activation Inhibits Ovarian Vascular Endothelial Growth Factor Secretion In Vitro: Implications for Treatment of Ovarian Hyperstimulation Syndrome With Dopamine Receptor 2 Agonists,” Fertility and Sterility 101 (2014): 1411–1418.e2. [DOI] [PubMed] [Google Scholar]
7. Ferrero H., García‐Pascual C. M., Gaytán M., et al., “Dopamine Receptor 2 Activation Inhibits Ovarian Vascular Endothelial Growth Factor Secretion in an Ovarian Hyperstimulation Syndrome (OHSS) Animal Model: Implications for Treatment of OHSS With Dopamine Receptor 2 Agonists,” Fertility and Sterility 102 (2014): 1468–1476.e1. [DOI] [PubMed] [Google Scholar]
8. Negishi H., Furuta I., Ushigoe K., Fujimoto S., and Koide S. S., “In Vitro Production of Progesterone and Estradiol by Rat Granulosa Cells Regulated by Cabergoline and Prolactin,” Endocrine Research 24 (1998): 195–203. [DOI] [PubMed] [Google Scholar]
9. Goldenberg R. L., Vaitukaitis J. L., and Ross G. T., “Estrogen and Follicle‐Stimulating Hormone Interactions on Follicle Growth in Rats,” Endocrinology 90 (1972): 1492–1498. [DOI] [PubMed] [Google Scholar]
10. Erickson G. F., Wang C., and Hsueh A. J., “FSH Induction of Functional LH Receptors in Granulosa Cells Cultured in a Chemically Defined Medium,” Nature 279 (1979): 336–338. [DOI] [PubMed] [Google Scholar]
11. Hsueh A. J. W., Adashi E. Y., Jones P. B., and Welsh T. H., “Hormonal Regulation of the Differentiation of Cultured Ovarian Granulosa Cells,” Endocrine Reviews 5 (1984): 76–127. [DOI] [PubMed] [Google Scholar]
12. Knecht M. and Catt K. J., “Induction of Luteinizing Hormone Receptors by Adenosine 3′,5′‐Monophosphate in Cultured Granulosa Cells,” Endocrinology 111 (1982): 1192–1200. [DOI] [PubMed] [Google Scholar]
13. Hirakawa T., Minegishi T., Abe K., Kishi H., Ibuki Y., and Miyamoto K., “A Role of Insulin‐Like Growth Factor I in Luteinizing Hormone Receptor Expression in Granulosa Cells,” Endocrinology 140 (1999): 4965–4971. [DOI] [PubMed] [Google Scholar]
14. Kasahara Y., Kishi H., Yokomizo R., and Okamoto A., “Ethanol Potentiates Follicle‐Stimulating Hormone Action in Ovarian Granulosa Cells,” Journal of Endocrinology 257 (2023): e220254. [DOI] [PubMed] [Google Scholar]
15. Livak K. J. and Schmittgen T. D., “Analysis of Relative Gene Expression Data Using Real‐Time Quantitative PCR and the 2^−ΔΔCT Method,” Methods 25 (2001): 402–408. [DOI] [PubMed] [Google Scholar]
16. Chen H., Zhao L., Chu G., et al., “FSH Induces the Development of Circadian Clockwork in Rat Granulosa Cells via a Gap Junction Protein Cx43‐Dependent Pathway,” American Journal of Physiology. Endocrinology and Metabolism 304 (2013): E566–E575. [DOI] [PubMed] [Google Scholar]
17. Cai C., Cai P., and Chu G., “Selection of Suitable Reference Genes for Core Clock Gene Expression Analysis by Real‐Time qPCR in Rat Ovary Granulosa Cells,” Molecular Biology Reports 46 (2019): 2941–2946. [DOI] [PubMed] [Google Scholar]
18. Dias J. A., Campo B., Weaver B. A., et al., “Inhibition of Follicle‐Stimulating Hormone‐Induced Preovulatory Follicles in Rats Treated With a Nonsteroidal Negative Allosteric Modulator of Follicle‐Stimulating Hormone Receptor,” Biology of Reproduction 90 (2013): 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Adashi E. Y. and Resnick C. E., “Forskolin‐Induced Differentiation of Cultured Rat Granulosa Cells: New Evidence for an Intermediary Role of Adenosine 3′,5′‐Monophosphate in the Mechanism of Action of Follicle‐Stimulating Hormone,” Endocrinology 115 (1984): 183–190. [DOI] [PubMed] [Google Scholar]
20. Chen C. Y., Chen C. R., Chen C. N., et al., “Amphetamine‐Decreased Progesterone and Estradiol Release in Rat Granulosa Cells: The Regulatory Role of cAMP‐ and Ca²⁺‐Mediated Signaling Pathways,” Biomedicine 9 (2021): 493. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Wang Q., Leader A., and Tsang B. K., “Follicular Stage‐Dependent Regulation of Apoptosis and Steroidogenesis by Prohibitin in Rat Granulosa Cells,” Journal of Ovarian Research 6 (2013): 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Chen M. J., Chou C. H., Chen S. U., Yang W. S., Yang Y. S., and Ho H. N., “The Effect of Androgens on Ovarian Follicle Maturation: Dihydrotestosterone Suppress FSH‐Stimulated Granulosa Cell Proliferation by Upregulating PPARγ‐Dependent PTEN Expression,” Scientific Reports 5 (2015): 18319. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Hossein G., Khanmohammadi M., Sahranavard Fard P., Heidarian Y., Kazemnejad S., and Akhondi M. M., “Exogenous Secreted Frizzled‐Related Protein‐4 Modulates Steroidogenesis of Rat Granulosa Cells Through Wnt/β‐Catenin and PI3K/AKT Signaling Pathways,” Avicenna Journal of Medical Biotechnology 8 (2016): 159–168. [PMC free article] [PubMed] [Google Scholar]
24. Neulen J., Yan Z., Raczek S., et al., “Human Chorionic Gonadotropin‐Dependent Expression of Vascular Endothelial Growth Factor/Vascular Permeability Factor in Human Granulosa Cells: Importance in Ovarian Hyperstimulation Syndrome,” Journal of Clinical Endocrinology and Metabolism 80 (1995): 1967–1971. [DOI] [PubMed] [Google Scholar]
25. Gómez R., Simón C., Remohí J., and Pellicer A., “Vascular Endothelial Growth Factor Receptor‐2 Activation Induces Vascular Permeability in Hyperstimulated Rats, and This Effect Is Prevented by Receptor Blockade,” Endocrinology 143 (2002): 4339–4348. [DOI] [PubMed] [Google Scholar]
26. Casarini L. and Crépieux P., “Molecular Mechanisms of Action of FSH,” Frontiers in Endocrinology 10 (2019): 305. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Simoni M., Gromoll J., and Nieschlag E., “The Follicle‐Stimulating Hormone Receptor: Biochemistry, Molecular Biology, Physiology, and Pathophysiology,” Endocrine Reviews 18 (1997): 739–773. [DOI] [PubMed] [Google Scholar]
28. Hunzicker‐Dunn M. and Maizels E. T., “FSH Signaling Pathways in Immature Granulosa Cells That Regulate Target Gene Expression: Branching Out From Protein Kinase A,” Cellular Signalling 18 (2006): 1351–1359. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Laurenza A., Sutkowski E. M., and Seamon K. B., “Forskolin: A Specific Stimulator of Adenylyl Cyclase or a Diterpene With Multiple Sites of Action?,” Trends in Pharmacological Sciences 10 (1989): 442–447. [DOI] [PubMed] [Google Scholar]
30. Vaughan M. and Moss J., “Mechanism of Action of Choleragen,” Journal of Supramolecular Structure 8 (1978): 473–488. [DOI] [PubMed] [Google Scholar]
31. Uhlén M., Fagerberg L., Hallström B. M., et al., “Tissue‐Based Map of the Human Proteome,” Science 347 (2015): 1260419. [DOI] [PubMed] [Google Scholar]
32. Human Protein Atlas , “DRD₂ Tissue Expression—RNA Expression Overview,” accessed July 7, 2025, https://www.proteinatlas.org/ENSG00000149295‐DRD2/tissue.
33. King S. S., Campbell A. G., Dille E. A., Roser J. F., Murphy L. L., and Jones K. L., “Dopamine Receptors in Equine Ovarian Tissues,” Domestic Animal Endocrinology 28 (2005): 405–415. [DOI] [PubMed] [Google Scholar]
34. Rey‐Ares V., Lazarov N., Berg D., Berg U., Kunz L., and Mayerhofer A., “Dopamine Receptor Repertoire of Human Granulosa Cells,” Reproductive Biology and Endocrinology 5 (2007): 40. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Zhang L. J., Lachowicz J. E., and Sibley D. R., “The D₂S and D₂L Dopamine Receptor Isoforms Are Differentially Regulated in Chinese Hamster Ovary Cells,” Molecular Pharmacology 45 (1994): 878–889. [PubMed] [Google Scholar]
36. Ferrero H., García‐Pascual C. M., Pellicer N., Simón C., Pellicer A., and Gómez R., “Dopamine Agonist Inhibits Vascular Endothelial Growth Factor Protein Production and Secretion in Granulosa Cells,” Reproductive Biology and Endocrinology 13 (2015): 104. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Jia X. C., Oikawa M., Bo M., et al., “Expression of Human Luteinizing Hormone (LH) Receptor: Interaction With LH and Chorionic Gonadotropin From Human but Not Equine, Rat, and Ovine Species,” Molecular Endocrinology 5 (1991): 759–768. [DOI] [PubMed] [Google Scholar]
38. Puett D., Li Y., DeMars G., Angelova K., and Fanelli F., “A Functional Transmembrane Complex: The Luteinizing Hormone Receptor With Bound Ligand and G Protein,” Molecular and Cellular Endocrinology 260 (2006): 126–136. [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Imamichi Y., Sekiguchi T., Kitano T., et al., “Diethylstilbestrol Administration Inhibits Theca Cell Androgen and Granulosa Cell Estrogen Production in Immature Rat Ovary,” Scientific Reports 7 (2017): 8374. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

RMB2-25-e70104-s001.zip^{(757.2KB, zip)}

Data Availability Statement

All data produced or examined in this study are included in this article. Additional data sets used in this study are available from the corresponding author upon reasonable request.

[rmb270104-bib-0001] 1. Pastor P. and Tolosa E., “Cabergoline in the Treatment of Parkinson's Disease,” Neurología 18 (2003): 202–209. [PubMed] [Google Scholar]

[rmb270104-bib-0002] 2. Colao A. and Savastano S., “Medical Treatment of Prolactinomas,” Nature Reviews. Endocrinology 7 (2011): 267–278. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0003] 3. Alvarez C., Martí‐Bonmatí L., Novella‐Maestre E., et al., “Dopamine Agonist Cabergoline Reduces Hemoconcentration and Ascites in Hyperstimulated Women Undergoing Assisted Reproduction,” Journal of Clinical Endocrinology and Metabolism 92 (2007): 2931–2937. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0004] 4. Leitao V. M. S., Moroni R. M., Seko L. M. D., Nastri C. O., and Martins W. P., “Cabergoline for the Prevention of Ovarian Hyperstimulation Syndrome: Systematic Review and Meta‐Analysis of Randomized Controlled Trials,” Fertility and Sterility 101 (2014): 664–675. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0005] 5. Gómez R., González‐Izquierdo M., Zimmermann R. C., et al., “Low‐Dose Dopamine Agonist Administration Blocks Vascular Endothelial Growth Factor (VEGF)‐Mediated Vascular Hyperpermeability Without Altering VEGF Receptor 2‐Dependent Luteal Angiogenesis in a Rat Ovarian Hyperstimulation Model,” Endocrinology 147 (2006): 5400–5411. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0006] 6. Ferrero H., García‐Pascual C. M., Gómez R., et al., “Dopamine Receptor 2 Activation Inhibits Ovarian Vascular Endothelial Growth Factor Secretion In Vitro: Implications for Treatment of Ovarian Hyperstimulation Syndrome With Dopamine Receptor 2 Agonists,” Fertility and Sterility 101 (2014): 1411–1418.e2. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0007] 7. Ferrero H., García‐Pascual C. M., Gaytán M., et al., “Dopamine Receptor 2 Activation Inhibits Ovarian Vascular Endothelial Growth Factor Secretion in an Ovarian Hyperstimulation Syndrome (OHSS) Animal Model: Implications for Treatment of OHSS With Dopamine Receptor 2 Agonists,” Fertility and Sterility 102 (2014): 1468–1476.e1. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0008] 8. Negishi H., Furuta I., Ushigoe K., Fujimoto S., and Koide S. S., “In Vitro Production of Progesterone and Estradiol by Rat Granulosa Cells Regulated by Cabergoline and Prolactin,” Endocrine Research 24 (1998): 195–203. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0009] 9. Goldenberg R. L., Vaitukaitis J. L., and Ross G. T., “Estrogen and Follicle‐Stimulating Hormone Interactions on Follicle Growth in Rats,” Endocrinology 90 (1972): 1492–1498. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0010] 10. Erickson G. F., Wang C., and Hsueh A. J., “FSH Induction of Functional LH Receptors in Granulosa Cells Cultured in a Chemically Defined Medium,” Nature 279 (1979): 336–338. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0011] 11. Hsueh A. J. W., Adashi E. Y., Jones P. B., and Welsh T. H., “Hormonal Regulation of the Differentiation of Cultured Ovarian Granulosa Cells,” Endocrine Reviews 5 (1984): 76–127. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0012] 12. Knecht M. and Catt K. J., “Induction of Luteinizing Hormone Receptors by Adenosine 3′,5′‐Monophosphate in Cultured Granulosa Cells,” Endocrinology 111 (1982): 1192–1200. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0013] 13. Hirakawa T., Minegishi T., Abe K., Kishi H., Ibuki Y., and Miyamoto K., “A Role of Insulin‐Like Growth Factor I in Luteinizing Hormone Receptor Expression in Granulosa Cells,” Endocrinology 140 (1999): 4965–4971. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0014] 14. Kasahara Y., Kishi H., Yokomizo R., and Okamoto A., “Ethanol Potentiates Follicle‐Stimulating Hormone Action in Ovarian Granulosa Cells,” Journal of Endocrinology 257 (2023): e220254. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0015] 15. Livak K. J. and Schmittgen T. D., “Analysis of Relative Gene Expression Data Using Real‐Time Quantitative PCR and the 2^−ΔΔCT Method,” Methods 25 (2001): 402–408. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0016] 16. Chen H., Zhao L., Chu G., et al., “FSH Induces the Development of Circadian Clockwork in Rat Granulosa Cells via a Gap Junction Protein Cx43‐Dependent Pathway,” American Journal of Physiology. Endocrinology and Metabolism 304 (2013): E566–E575. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0017] 17. Cai C., Cai P., and Chu G., “Selection of Suitable Reference Genes for Core Clock Gene Expression Analysis by Real‐Time qPCR in Rat Ovary Granulosa Cells,” Molecular Biology Reports 46 (2019): 2941–2946. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0018] 18. Dias J. A., Campo B., Weaver B. A., et al., “Inhibition of Follicle‐Stimulating Hormone‐Induced Preovulatory Follicles in Rats Treated With a Nonsteroidal Negative Allosteric Modulator of Follicle‐Stimulating Hormone Receptor,” Biology of Reproduction 90 (2013): 19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0019] 19. Adashi E. Y. and Resnick C. E., “Forskolin‐Induced Differentiation of Cultured Rat Granulosa Cells: New Evidence for an Intermediary Role of Adenosine 3′,5′‐Monophosphate in the Mechanism of Action of Follicle‐Stimulating Hormone,” Endocrinology 115 (1984): 183–190. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0020] 20. Chen C. Y., Chen C. R., Chen C. N., et al., “Amphetamine‐Decreased Progesterone and Estradiol Release in Rat Granulosa Cells: The Regulatory Role of cAMP‐ and Ca²⁺‐Mediated Signaling Pathways,” Biomedicine 9 (2021): 493. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0021] 21. Wang Q., Leader A., and Tsang B. K., “Follicular Stage‐Dependent Regulation of Apoptosis and Steroidogenesis by Prohibitin in Rat Granulosa Cells,” Journal of Ovarian Research 6 (2013): 23. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0022] 22. Chen M. J., Chou C. H., Chen S. U., Yang W. S., Yang Y. S., and Ho H. N., “The Effect of Androgens on Ovarian Follicle Maturation: Dihydrotestosterone Suppress FSH‐Stimulated Granulosa Cell Proliferation by Upregulating PPARγ‐Dependent PTEN Expression,” Scientific Reports 5 (2015): 18319. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0023] 23. Hossein G., Khanmohammadi M., Sahranavard Fard P., Heidarian Y., Kazemnejad S., and Akhondi M. M., “Exogenous Secreted Frizzled‐Related Protein‐4 Modulates Steroidogenesis of Rat Granulosa Cells Through Wnt/β‐Catenin and PI3K/AKT Signaling Pathways,” Avicenna Journal of Medical Biotechnology 8 (2016): 159–168. [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0024] 24. Neulen J., Yan Z., Raczek S., et al., “Human Chorionic Gonadotropin‐Dependent Expression of Vascular Endothelial Growth Factor/Vascular Permeability Factor in Human Granulosa Cells: Importance in Ovarian Hyperstimulation Syndrome,” Journal of Clinical Endocrinology and Metabolism 80 (1995): 1967–1971. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0025] 25. Gómez R., Simón C., Remohí J., and Pellicer A., “Vascular Endothelial Growth Factor Receptor‐2 Activation Induces Vascular Permeability in Hyperstimulated Rats, and This Effect Is Prevented by Receptor Blockade,” Endocrinology 143 (2002): 4339–4348. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0026] 26. Casarini L. and Crépieux P., “Molecular Mechanisms of Action of FSH,” Frontiers in Endocrinology 10 (2019): 305. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0027] 27. Simoni M., Gromoll J., and Nieschlag E., “The Follicle‐Stimulating Hormone Receptor: Biochemistry, Molecular Biology, Physiology, and Pathophysiology,” Endocrine Reviews 18 (1997): 739–773. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0028] 28. Hunzicker‐Dunn M. and Maizels E. T., “FSH Signaling Pathways in Immature Granulosa Cells That Regulate Target Gene Expression: Branching Out From Protein Kinase A,” Cellular Signalling 18 (2006): 1351–1359. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0029] 29. Laurenza A., Sutkowski E. M., and Seamon K. B., “Forskolin: A Specific Stimulator of Adenylyl Cyclase or a Diterpene With Multiple Sites of Action?,” Trends in Pharmacological Sciences 10 (1989): 442–447. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0030] 30. Vaughan M. and Moss J., “Mechanism of Action of Choleragen,” Journal of Supramolecular Structure 8 (1978): 473–488. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0031] 31. Uhlén M., Fagerberg L., Hallström B. M., et al., “Tissue‐Based Map of the Human Proteome,” Science 347 (2015): 1260419. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0032] 32. Human Protein Atlas , “DRD₂ Tissue Expression—RNA Expression Overview,” accessed July 7, 2025, https://www.proteinatlas.org/ENSG00000149295‐DRD2/tissue.

[rmb270104-bib-0033] 33. King S. S., Campbell A. G., Dille E. A., Roser J. F., Murphy L. L., and Jones K. L., “Dopamine Receptors in Equine Ovarian Tissues,” Domestic Animal Endocrinology 28 (2005): 405–415. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0034] 34. Rey‐Ares V., Lazarov N., Berg D., Berg U., Kunz L., and Mayerhofer A., “Dopamine Receptor Repertoire of Human Granulosa Cells,” Reproductive Biology and Endocrinology 5 (2007): 40. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0035] 35. Zhang L. J., Lachowicz J. E., and Sibley D. R., “The D₂S and D₂L Dopamine Receptor Isoforms Are Differentially Regulated in Chinese Hamster Ovary Cells,” Molecular Pharmacology 45 (1994): 878–889. [PubMed] [Google Scholar]

[rmb270104-bib-0036] 36. Ferrero H., García‐Pascual C. M., Pellicer N., Simón C., Pellicer A., and Gómez R., “Dopamine Agonist Inhibits Vascular Endothelial Growth Factor Protein Production and Secretion in Granulosa Cells,” Reproductive Biology and Endocrinology 13 (2015): 104. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0037] 37. Jia X. C., Oikawa M., Bo M., et al., “Expression of Human Luteinizing Hormone (LH) Receptor: Interaction With LH and Chorionic Gonadotropin From Human but Not Equine, Rat, and Ovine Species,” Molecular Endocrinology 5 (1991): 759–768. [DOI] [PubMed] [Google Scholar]

[rmb270104-bib-0038] 38. Puett D., Li Y., DeMars G., Angelova K., and Fanelli F., “A Functional Transmembrane Complex: The Luteinizing Hormone Receptor With Bound Ligand and G Protein,” Molecular and Cellular Endocrinology 260 (2006): 126–136. [DOI] [PMC free article] [PubMed] [Google Scholar]

[rmb270104-bib-0039] 39. Imamichi Y., Sekiguchi T., Kitano T., et al., “Diethylstilbestrol Administration Inhibits Theca Cell Androgen and Granulosa Cell Estrogen Production in Immature Rat Ovary,” Scientific Reports 7 (2017): 8374. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Cabergoline Suppresses FSH‐Induced Differentiation and Steroidogenesis in Primary Cultured Rat Granulosa Cells

Yusuke Mori

Hiroshi Kishi

Ayako Hasunuma

Yuta Kasahara

Aikou Okamoto

ABSTRACT

Purpose

Methods

Results

Conclusions

1. Introduction

2. Materials and Methods

2.1. Hormones and Reagents

2.2. Animals

2.3. Granulosa Cell Culture

2.4. RNA Isolation

2.5. Reverse Transcription Followed by Quantitative Real‐Time Polymerase Chain Reaction

TABLE 1.

2.6. Receptor Binding Assay

2.7. Estradiol (E2 ) and Progesterone (P4 ) Assay

2.8. cAMP Assay

2.9. Western Blot Analysis

2.10. Statistical Analysis

3. Results

3.1. Gene Expression

FIGURE 1.

3.2. Protein/Receptor Binding Assay

FIGURE 2.

3.3. Hormone Secretion

FIGURE 3.

3.4. Signaling Mechanisms

FIGURE 4.

FIGURE 5.

3.5. Investigation of Mechanisms via D2DR

FIGURE 6.

4. Discussion

Funding

Ethics Statement

Conflicts of Interest

Supporting information

Acknowledgments

Data Availability Statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

2.7. Estradiol (E₂ ) and Progesterone (P₄ ) Assay

3.5. Investigation of Mechanisms via D₂DR