Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Oct 11;73(6):e70134. doi: 10.1111/jeu.70134

Engineering Anaerobic Metabolic Branch Points to Control Carbon Allocation Between Wax Ester Synthesis and Succinate Accumulation in Euglena gracilis

Rikuto Oishi 1, Ryunosuke Katayama 1, Mitsuhiro Ueda 1, Tatsuji Sakamoto 1, Masami Nakazawa 1,✉
PMCID: PMC13655293  PMID: 42860623

ABSTRACT

Under anaerobic conditions, Euglena gracilis degrades paramylon and synthesizes wax esters (WEs) while accumulating succinate in the culture supernatant. Succinate can either be converted to succinyl‐CoA by succinyl‐CoA synthetase (SCS) and enter the propionyl‐CoA biosynthetic pathway or accumulate extracellularly. Propionyl‐CoA serves as a primer for odd‐chain WE synthesis. Prior research revealed that knockout (KO) of the SCS α‐subunit (SCSα) nearly eliminated odd‐chain WE synthesis while preserving overall WE accumulation. In the present study, the effects of targeted modifications at anaerobic metabolic branch points on carbon allocation between WE synthesis and succinate accumulation were examined. SCSα KO increased succinate accumulation and markedly reduced odd‐chain WEs while largely maintaining total WE levels. Silencing mitochondrial NADP+‐dependent malic enzyme (ME), which affects carbon allocation at the malate branch point between WE synthesis and the fumarate‐to‐succinate pathway, also increased succinate accumulation, although total WE accumulation decreased only slightly. Combining ME silencing with SCSα KO increased succinate accumulation to 8.9‐fold that of the wild type while retaining more than 75% of the WT total WE level. These findings demonstrate that targeted modification of anaerobic metabolic branch points can redirect carbon allocation toward succinate accumulation without abolishing WE biosynthesis in E. gracilis .

Keywords: anaerobic metabolism, carbon allocation, Euglena gracilis , malic enzyme, odd‐chain fatty acid biosynthetic pathway, succinate metabolism, succinyl‐CoA synthetase, wax ester

Abbreviations

A340

absorbance at 340 nm

cDNA

complementary DNA

CoA

coenzyme A

FA

fatty acid

FAlc

fatty alcohol

GC

gas chromatography

KH

Koren–Hutner

KO

knockout

ME

malic enzyme

PCR

polymerase chain reaction

qRT‐PCR

quantitative reverse transcription polymerase chain reaction

RNAi

RNA interference

SCS

succinyl‐CoA synthetase

SCSα‐KO

succinyl‐CoA synthetase α‐subunit knockout

TCA cycle

tricarboxylic acid cycle

WE

wax ester

WT

wild type

1. Introduction

Photosynthetic microalgae that fix CO2 without competing with food resources are widely regarded as promising biological platforms for sustainable biofuel and biochemical production. In particular, lipid accumulation is common in microalgae, and algal oils have attracted considerable industrial interest (Chisti 2007; Hu et al. 2008; Gouveia and Oliveira 2009).

Among these organisms, Euglena gracilis is notable for its unique lipid metabolism. Under anaerobic conditions, E. gracilis rapidly degrades the intracellular storage polysaccharide paramylon and synthesizes wax esters (WEs) (Inui et al. 1982). Their carbon chains are produced through mitochondrial fatty acid synthesis via the reverse β‐oxidation pathway (Nakazawa et al. 2018). WEs mainly consist of saturated fatty acid and saturated fatty alcohol esters, with myristyl myristate as a major component (Inui et al. 1984). They also contain substantial amounts of odd‐chain fatty acids and fatty alcohols. Because WEs are enriched in saturated compounds, they are attractive fuel‐related molecules that can be converted into hydrocarbons, such as biojet fuel, through catalytic processing (Shimada et al. 2018).

Under anaerobic conditions, E. gracilis also accumulates succinate in the culture supernatant (Tomita et al. 2016). Therefore, anaerobic carbon allocation in this species is important for understanding how carbon is distributed between WE synthesis and succinate accumulation. Because WEs accumulate intracellularly, whereas succinate is secreted into the culture supernatant, simultaneous production of both compounds may facilitate downstream separation and recovery. Redirecting carbon flux at metabolic branch points is a common metabolic engineering strategy used to improve production of target compounds in microbial systems (Cheng et al. 2013; Liu et al. 2022; Blankschien et al. 2010). In E. gracilis , such engineering could improve coproduction of intracellular WEs and extracellular succinate under anaerobic conditions by regulating carbon allocation between these products.

Understanding this partitioning requires analysis of how carbon derived from paramylon degradation flows through anaerobic central metabolism. Carbon skeletons released following paramylon degradation enter the glycolysis pathway and are subsequently directed toward WE synthesis and succinate formation. Therefore, carbon partitioning is likely regulated at specific anaerobic metabolic branch points (Figure 1).

FIGURE 1.

FIGURE 1

Open in a new tab

Proposed anaerobic metabolic pathways and branch points in Euglena gracilis derived from previous studies. Schematic overview of proposed carbon flow under anaerobic conditions, linking glycolysis‐derived intermediates to wax ester synthesis and succinate formation. ME, NADP+‐dependent malic enzyme, mitochondrial; SCS, succinyl‐CoA synthetase.

Malate serves as a major branch point in this process. Phosphoenolpyruvate generated through glycolysis is converted to oxaloacetate and then to malate. Malate is transported into the mitochondria, where it can be converted to pyruvate by an NADP+‐dependent malic enzyme (ME), contributing to acetyl‐CoA production for WE synthesis (Nakazawa et al. 2021). Alternatively, malate can be converted to fumarate and subsequently to succinate through the reductive tricarboxylic acid (TCA) pathway.

Succinate represents a second branch point in anaerobic carbon metabolism. Carbon can either be metabolized intracellularly to succinyl‐CoA by succinyl‐CoA synthetase (SCS) or released into the culture supernatant as succinate. Succinyl‐CoA is then converted to propionyl‐CoA via the methylmalonyl‐CoA pathway (Schneider and Betz 1985), and propionyl‐CoA serves as a primer for synthesis of odd‐chain fatty acids and fatty alcohols incorporated into WEs. Thus, carbon allocation at the succinate branch point likely determines whether carbon is directed primarily toward odd‐chain WE synthesis or extracellular succinate accumulation. Notably, E. gracilis is believed to use a modified TCA cycle involving 2‐oxoglutarate decarboxylase (Shigeoka et al. 1986; Shigeoka and Nakano 1991; Nakazawa et al. 2017) and succinate semialdehyde dehydrogenase (Tokunaga et al. 1979) rather than relying exclusively on the conventional 2‐oxoglutarate dehydrogenase/SCS pathway.

The malate and succinate branch points therefore represent potential targets for controlling anaerobic carbon allocation in E. gracilis . In a previous study, ME silencing reduced anaerobic WE accumulation (Nakazawa et al. 2021), but whether this perturbation redirected carbon toward the fumarate‐to‐succinate pathway was not examined. At the succinate branch point, SCS α‐subunit (SCSα) knockout (KO) nearly abolished odd‐chain WE synthesis while maintaining total WE accumulation under anaerobic conditions (Katayama et al. 2026), but its effects on succinate accumulation and individual WE molecular species remained unclear. Moreover, the combined effect of perturbing the two branch points had not been tested. We therefore examined ME silencing and SCSα KO individually and in combination to determine whether targeted modification of these two branch points could redirect anaerobic carbon allocation between WE synthesis and succinate accumulation in E. gracilis .

2. Materials and Methods

2.1. Organisms and Culture Conditions

Euglena gracilis strain Z (ATCC‐12716) was used as the wild type (WT), and an SCSα‐KO strain previously generated from E. gracilis Z using Cas9 ribonucleoprotein‐mediated genome editing based on the method of Nomura et al. (2020), as described by Katayama et al. (2026), was used as the mutant. Prior complementary DNA (cDNA) sequence analysis confirmed the absence of a normal SCSα transcript in the mutant strain. Cells were cultured aerobically under mixotrophic conditions in malate‐free Koren–Hutner (KH) medium (Koren and Hutner 1967).

2.2. RNA Interference

Silencing of the mitochondrial NADP+‐dependent ME gene was performed by dsRNA‐mediated RNA interference based on the method established for E. gracilis (Iseki et al. 2002) and the procedure described previously for ME silencing (Nakazawa et al. 2021). Aerobically cultured cells were adjusted to 1 × 107 cells/mL, and 400 μL of the cell suspension was used for electroporation. For ME‐RNAi and SCSα‐KO ME‐RNAi cells, 30 μg of ME dsRNA was added to the cell suspension. For WT and SCSα‐KO cells, 30 μL of the Elution Solution supplied with the MEGAscript RNAi Kit (Thermo Fisher Scientific, MA, USA) was added in place of dsRNA for mock electroporation. After electroporation, the cells were recovered in 1 mL of malate‐free KH medium for 3 h at 27°C on a rotator.

2.3. Experimental Cultivation and Anaerobic Treatment

Following electroporation and recovery, 150 μL of the recovered cell suspension was inoculated into 3 mL of fresh malate‐free KH medium in 18 × 150 mm glass test tubes. The initial cell density was approximately 1 × 105 cells/mL under all conditions and was confirmed by cell counting on Day 0. Cells were cultured at 27°C with shaking at 110 strokes per minute under a 14‐h light/10‐h dark photoperiod for 4 days. Anaerobic treatment was performed as described previously (Nakazawa et al. 2015, 2021; Nagamine et al. 2024). Briefly, 3 mL of each culture was transferred to a 5‐mL plastic tube, bubbled with argon gas for 1 min, tightly capped and sealed with Parafilm, and incubated in the dark at 27°C on a gyratory shaker at 8 rpm for 48 h.

2.4. Quantitative RT‐PCR Analysis

ME transcript levels were quantified by quantitative reverse transcription PCR (qRT‐PCR). Total RNA was extracted from cells after 4 days of aerobic cultivation using ISOGEN II (Nippon Gene, Japan) according to the manufacturer's protocol. RNA concentrations were determined from absorbance at 260 nm, and 500 ng of total RNA was used for reverse transcription. Complementary DNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio, Japan). qRT‐PCR was performed using TB Green Premix Ex Taq II Fast qPCR (Takara Bio, Japan) with a Thermal Cycler Dice Real Time System (Takara Bio, Japan). The primer sequences were 5′‐CTGACGCTGCTGGAAAAGTATCG‐3′ (ME‐qPCR‐Fw) and 5′‐CAGCCTTGACCGTATCCAACAAC‐3′ (ME‐qPCR‐Rv) for ME, and 5′‐AGAAGGCGTACCATGAACAGC‐3′ (α‐tubulin‐qPCR‐Fw) and 5′‐TGGGCACCACATCACCA‐3′ (α‐tubulin‐qPCR‐Rv) for α‐tubulin. Each 25‐μL reaction contained 12.5 μL of the premix, 0.4 μM each of the forward and reverse primers, and 1 μL of cDNA. The amplification conditions were 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. A dissociation curve analysis was performed after amplification. ME transcript levels were normalized to α‐tubulin as the reference gene, and relative expression levels were calculated using the 2−ΔΔCt method. WT was used as the reference for ME‐RNAi, and SCSα‐KO was used as the reference for SCSα‐KO ME‐RNAi. Reactions were performed in technical triplicate.

2.5. Cell Counting

Cells were counted using a CDA‐1000 cell counter (Sysmex) as described previously (Nakazawa et al. 2021; Nagamine et al. 2024).

2.6. ME Activity Analysis

ME activity was measured by monitoring NADP+ reduction as an increase in absorbance at 340 nm according to established methods (Karn and Hudock 1973; Nakazawa et al. 2021) with minor modifications. Cells were collected after 4 days of aerobic cultivation, suspended in 30 mM potassium phosphate buffer (pH 7.5) containing 1 mM phenylmethylsulfonyl fluoride, and disrupted by sonication on ice for 15 s twice. After centrifugation (17,700 × g, 4°C, 5 min), the clarified supernatant was used as a crude enzyme extract. The reaction was performed in a 1.5‐mL mixture containing 6 mM potassium phosphate buffer (pH 7.5), 20 mM DL‐malic acid, 10 mM MgCl2, 0.5 mM NADP+, and the crude enzyme extract. NADP+ reduction was monitored at 340 nm for 5 min, and ME activity was calculated using an extinction coefficient of 6.22 mM−1 cm−1. Protein concentration was determined by the Bradford method using bovine serum albumin as a standard. Specific ME activity was expressed as μmol/min/mg protein.

2.7. Extraction and Quantification of Wax Esters

WEs were extracted using a Bligh–Dyer‐based method as described previously (Bligh and Dyer 1959; Nakazawa et al. 2015). The extracted total lipid fraction was evaporated and dissolved in chloroform. WE molecular species were analyzed by gas chromatography according to Nagamine et al. (2024), using a GC‐2014 system (Shimadzu) equipped with a glass column (2.1 m × 3.2 mm) packed with 2.5% Thermon‐3000 (Shinwasorb‐S 60/80). The column temperature was set at 235°C under isothermal conditions. Myristyl myristate (C14:0–C14:0Alc) was used as the external standard.

2.8. Extraction and Quantification of Paramylon

Paramylon was extracted as described by Yokota et al. (1982) with slight modifications. Residual cell pellets obtained after WE extraction were used as starting material. Paramylon was quantified via the phenol–sulfuric acid method (Hodge and Hofreiter 1962) using glucose as a standard and expressed as anhydroglucose equivalents (162 g/mol).

2.9. Organic Acid Analysis

Organic acids in culture supernatants were quantified using ion‐exclusion chromatography coupled with conductivity detection following an established method (Sasaki et al. 2025). Supernatants were clarified via centrifugation (17,700 × g, 4°C, 2 min) and filtered through a 0.45‐μm membrane filter (13‐mm diameter; Hawach Scientific, China) before injection. Organic acids were analyzed using a Nexera Organic Acid Analysis System (Shimadzu) equipped with an electronic conductivity detector. p‐Toluenesulfonic acid was employed as the mobile phase, with postcolumn pH buffering using EDTA·4H and Bis‐Tris. Isothermal separations were performed at 45°C. Calibration curves were generated using known concentrations of malate, succinate, and fumarate standards.

2.10. Statistical Analysis

Data are presented as means ± standard deviations (SDs) from at least three independent cultures, unless otherwise indicated. Comparisons between two groups were performed using Student's t‐test. For comparisons among multiple groups, one‐way analysis of variance (ANOVA) followed by the Tukey–Kramer honestly significant difference (HSD) test was used for all pairwise comparisons. Differences were considered statistically significant at p < 0.05. Groups not sharing the same letter were considered significantly different.

3. Results

3.1. Effects of SCSα KO on WE Accumulation and Organic Acid Secretion Under Anaerobic Conditions

Under aerobic conditions, WT and the SCSα‐KO strains showed comparable growth (Figure 2A). Paramylon accumulation after 4 days of aerobic cultivation was also similar between strains, and the decrease in paramylon content during the subsequent 48 h of anaerobic incubation did not differ substantially between them (Figure 2B).

FIGURE 2.

FIGURE 2

Open in a new tab

Effects of SCSα knockout (KO) on wax ester production and succinate secretion under anaerobic conditions. WT and SCSα‐KO cells were cultured aerobically for 4 days and then transferred to anaerobic conditions for 48 h. (A) Growth curve during 4 days of aerobic cultivation. (B) Paramylon content after 4 days of aerobic growth and following 48 h of anaerobic incubation. (C) Total wax ester content after 48 h of anaerobic incubation (μg/106 cells). (D) Composition of wax ester molecular species (C23–C32) after 48 h of anaerobic incubation. (E) Change (Δ) in extracellular succinate in the culture supernatant during 48 h of anaerobic incubation (μg/106 cells). Error bars indicate standard deviation (SD; n = 3 independent cultures). Statistical significance between WT and SCSα‐KO was assessed using Student's t‐test. Asterisks indicate significant differences (p < 0.05).

Katayama et al. (2026) previously reported that the proportion of odd‐chain WEs was markedly reduced in the SCSα‐KO strain, whereas total WE content was not significantly altered; however, prior characterization under anaerobic conditions focused solely on total WE content and odd‐chain WE proportion. In the present study, total WE accumulation after 48 h of anaerobic incubation was modestly but significantly decreased, while remaining at approximately 86% of the WT level (Figure 2C). Distribution analysis of individual WE molecular species (C23–C32) after 48 h of anaerobic incubation revealed marked differences between WT and SCSα‐KO cells (Figure 2D). Odd‐chain WEs were nearly absent in the mutant strain, whereas C28 and C30 species were more abundant. Total odd‐chain WE content declined from 26.6 μg per 106 cells in the WT to 0.994 μg per 106 cells in the SCSα‐KO strain.

Analysis of culture supernatants showed that succinate accumulation during the 48‐h anaerobic incubation was significantly greater in SCSα‐KO cells than in WT cells (Figure 2E).

3.2. Effects of ME Silencing on Wax Ester Accumulation and Organic Acid Secretion Under Anaerobic Conditions

Silencing of ME was confirmed by qRT‐PCR, which showed that ME transcript levels in ME‐RNAi cells were approximately 1% of those in WT cells (Figure 3A). Consistent with this reduction, NADP+‐dependent ME activity was significantly decreased to approximately 21% of the WT level (Figure 3B). WT and ME–RNAi cells exhibited comparable aerobic growth and similar paramylon dynamics during the subsequent 48‐h anaerobic incubation (Figure 3C,D). After this incubation, total WE accumulation in ME‐RNAi cells was significantly decreased but remained at approximately 82% of the WT level (Figure 3E). Analysis of WE molecular species (C23–C32) showed that the overall profile remained broadly similar, although several individual species differed significantly (Figure 3F).

FIGURE 3.

FIGURE 3

Open in a new tab

Effects of malic enzyme (ME) silencing on wax ester production and succinate secretion under anaerobic conditions. ME silencing was performed as described previously (Nakazawa et al. 2021). WT and ME‐RNAi cells were cultured aerobically for 4 days and then transferred to anaerobic conditions for 48 h. (A) Relative ME transcript levels determined by qRT‐PCR. (B) NADP+‐dependent ME activity in cell extracts prepared from aerobically cultured cells. (C) Growth curve during 4 days of aerobic cultivation. (D) Paramylon content after 4 days of aerobic growth and following 48 h of anaerobic incubation. (E) Total wax ester content after 48 h of anaerobic incubation (μg/106 cells). (F) Composition of wax ester molecular species (C23–C32) after 48 h of anaerobic incubation. (G) Change (Δ) in extracellular succinate in the culture supernatant during 48 h of anaerobic incubation (μg/106 cells). For panel A, error bars indicate standard deviation (SD) of technical triplicate measurements. For panels B–G, error bars indicate SD (n = 3 independent cultures). Statistical significance between WT and ME‐RNAi in panels B–G was assessed using Student's t‐test. Asterisks indicate significant differences (p < 0.05).

In contrast, succinate accumulation during the 48‐h anaerobic incubation increased markedly in ME‐RNAi cells, reaching 58.7 μg per 106 cells, approximately 4.9‐fold higher than that in WT cells (Figure 3G). Malate and fumarate accumulation also increased significantly (Figure S1).

3.3. Effects of Combined SCSα KO and ME Silencing on WE Accumulation and Organic Acid Secretion Under Anaerobic Conditions

Silencing of ME in the SCSα‐KO background was confirmed by qRT‐PCR, which showed that ME transcript levels in SCSα‐KO ME‐RNAi cells were approximately 2% of those in SCSα‐KO cells (Figure 4A). NADP+‐dependent ME activity was also significantly reduced to approximately 21% of the SCSα‐KO level (Figure 4B). WT, SCSα‐KO, and SCSα‐KO ME‐RNAi cells showed broadly similar aerobic growth, although the cell density of SCSα‐KO ME‐RNAi cells was slightly lower on Day 4 (Figure 4C). Paramylon accumulation after 4 days of aerobic cultivation was comparable among the three groups, and paramylon content decreased during the subsequent anaerobic incubation in all groups, with only modest differences at 48 h (Figure 4D). Following anaerobic incubation, total WE accumulation was significantly lower in SCSα‐KO and SCSα‐KO ME‐RNAi cells than in WT cells, but remained at approximately 86% and 77% of the WT level, respectively (Figure 4E). Analysis of WE molecular species (C23–C32) after 48‐h anaerobic incubation showed that the characteristic SCSα‐KO profile was largely maintained after ME silencing, with odd‐chain WEs remaining barely detectable (Figure 4F).

FIGURE 4.

FIGURE 4

Open in a new tab

Combined effects of SCSα knockout (KO) and malic enzyme (ME) silencing on wax ester production and succinate secretion under anaerobic conditions. ME suppression in the SCSα‐KO background was verified by qRT‐PCR. WT, SCSα‐KO, and SCSα‐KO ME‐RNAi cells were cultured aerobically for 4 days and then transferred to anaerobic conditions for 48 h. (A) Relative ME transcript levels determined by qRT‐PCR. (B) NADP+‐dependent ME activity in cell extracts prepared from aerobically cultured cells. (C) Growth curve during 4 days of aerobic cultivation. (D) Paramylon content after 4 days of aerobic growth and following 48 h of anaerobic incubation. (E) Total wax ester content after 48 h of anaerobic incubation (μg/106 cells). (F) Composition of wax ester molecular species (C23–C32) after 48 h of anaerobic incubation. (G) Change (Δ) in extracellular succinate in the culture supernatant during 48 h of anaerobic incubation (μg/106 cells). For panel A, error bars indicate standard deviation (SD) of technical triplicate measurements. For panels B–G, error bars indicate SD (n = 3 independent cultures). Statistical significance between SCSα‐KO and SCSα‐KO ME‐RNAi in panel B was assessed using Student's t‐test; the asterisk indicates a significant difference (p < 0.05). Statistical differences among WT, SCSα‐KO, and SCSα‐KO ME‐RNAi in panels C–G were assessed by one‐way ANOVA followed by the Tukey–Kramer HSD test. Different letters indicate significant differences (p < 0.05).

Despite this substantial retention of WE accumulation, succinate accumulation in SCSα‐KO cells was approximately 2.6‐fold higher than that in WT cells, and ME silencing in the SCSα‐KO background further increased succinate accumulation to 107.4 μg/106 cells, approximately 3.4‐fold higher than that in SCSα‐KO cells and 8.9‐fold higher than that in WT cells (Figure 4G). Malate and fumarate accumulation were also significantly higher in SCSα‐KO ME‐RNAi cells than in the other groups (Figure S1).

4. Discussion

In this study, targeted modification of anaerobic metabolic branch points altered the balance between WE synthesis and succinate accumulation in E. gracilis under anaerobic conditions. Carbon allocation shifted toward succinate accumulation while substantial WE synthesis was maintained.

In the SCSα‐KO strain, total WE accumulation remained relatively high at approximately 86% of the WT level, whereas odd‐chain WEs were nearly eliminated. These findings support the proposed role of SCS at the succinate branch point, where succinate is converted to succinyl‐CoA and subsequently used in propionyl‐CoA biosynthesis. Therefore, disruption of SCSα likely restricts propionyl‐CoA formation and strongly suppresses odd‐chain WE synthesis, whereas even‐chain WE synthesis can continue because it does not require a C3‐derived precursor (Katayama et al. 2026).

The increase in succinate accumulation in the SCSα‐KO strain was comparable to the estimated decrease in the propionyl‐CoA‐derived contribution to WE synthesis. This propionyl‐CoA‐derived contribution was estimated from the analyzed WE dataset using the mean molecular weight calculated from the measured WE molecular‐species distribution and the saponified fatty acid/fatty alcohol composition shown in Figure S2. The estimated reduction accounted for approximately 75% of the increase in succinate accumulation. However, succinate accumulation slightly exceeded this estimate, suggesting that additional carbon may have entered the succinate pool through other metabolic intermediates.

The same analysis indicated that the acetyl‐CoA‐derived contribution to WE synthesis was slightly lower in the SCSα‐KO strain than in the WT. This reduction aligns with the modest but significant decrease in total WE accumulation observed in the present study. However, the decrease in the acetyl‐CoA‐derived contribution was considerably smaller than that in the propionyl‐CoA‐derived contribution. Therefore, the primary effect of SCSα KO appears to be a marked reduction in propionyl‐CoA‐dependent odd‐chain WE synthesis rather than broad suppression of total WE production.

In ME‐RNAi cells, total WE accumulation decreased moderately, reaching approximately 82% of the WT level, whereas the overall WE profile remained similar to that in WT cells. A previous study reported a more pronounced reduction in anaerobic WE production when ME silencing was introduced into a chloroplast‐deficient background (Nakazawa et al. 2021). The smaller decrease observed here may reflect differences in strain background, as a photosynthetic Z strain was used in the current study. Thus, under the present conditions, ME silencing reduced but did not abolish WE synthesis.

ME silencing markedly increased organic acid accumulation in the culture supernatant. Because ME catalyzes the conversion of malate to pyruvate, suppression of this enzyme would be expected to reduce malate consumption through this pathway and thereby increase carbon retention within the fumarate‐to‐succinate route. The simultaneous increases in malate, fumarate, and succinate support this interpretation (Figure S1).

The greatest metabolic shift was observed in SCSα‐KO ME‐RNAi cells. In this strain, total WE accumulation remained substantial at approximately 77% of the WT level, whereas succinate accumulation increased approximately 8.9‐fold relative to the WT. These findings indicate that simultaneous modification of the malate and succinate branch points effectively promotes succinate accumulation under anaerobic conditions. This interpretation is consistent with reduced carbon flow through the malate‐to‐pyruvate route together with decreased downstream utilization of succinate.

This shift was also evident when product formation was compared on an acetyl‐CoA–equivalent basis using paramylon consumption as a reference. For this comparison, paramylon consumption was converted assuming two acetyl‐CoA equivalents per glucose unit, WEs were converted using the mean molecular weight and mean total carbon number of the measured molecular‐species distribution (two carbons per acetyl‐CoA), and succinate was converted on a 1:1 molar basis. In WT cells, total WE accumulation corresponded to approximately 109% of the reference carbon equivalent, whereas succinate accounted for around 5%. In SCSα‐KO cells, the corresponding values were approximately 86% and 12%, whereas in ME‐RNAi cells, they were around 88% and 25%, respectively. Notably, in SCSα‐KO ME‐RNAi cells, total WE accumulation accounted for approximately 78% of the reference carbon equivalent, whereas succinate reached approximately 42%. In strains where the combined values for WEs and succinate exceeded 100%, some carbon likely entered these products through additional metabolic intermediates. Accordingly, this comparison should be interpreted as a relative indicator of carbon allocation rather than a complete carbon balance.

In microbial bioproduction, redirecting carbon flux at metabolic branch points is a common strategy applied to enhance target compound formation (Cheng et al. 2013; Liu et al. 2022; Blankschien et al. 2010). In this context, the observed effects of ME silencing are broadly consistent with the established importance of the malate/pyruvate branch in succinate metabolic engineering. In engineered Escherichia coli , ME has also been targeted for metabolic engineering, including cases in which overexpression enhanced succinate production under aerobic conditions (Lin et al. 2005). Relevant to the present study, simultaneous inactivation of MaeA (NAD+‐dependent ME) and MaeB (NADP+‐dependent ME) improved anaerobic production of malate, fumarate, and succinate in recombinant strains expressing pyruvate carboxylase (Skorokhodova et al. 2018). Together, these studies support the notion that the malate‐to‐pyruvate step strongly influences carbon allocation toward succinate production.

In contrast, the succinate branch point itself may be a more promising engineering target in E. gracilis . In many conventional organisms, SCS functions within the standard TCA cycle and contributes to supplying succinyl‐CoA for growth and biosynthesis, potentially limiting direct engineering of this step (Jenkins and Weitzman 1986; Bridger 1974). However, in E. gracilis , the metabolic context appears different: the species is believed to use a modified TCA cycle involving succinate semialdehyde rather than relying exclusively on the conventional 2‐oxoglutarate dehydrogenase/SCS pathway (Shigeoka et al. 1986; Shigeoka and Nakano 1991; Nakazawa et al. 2017; Tokunaga et al. 1979). Therefore, the present results suggest that the succinate branch point may be more accessible for carbon‐allocation engineering in E. gracilis compared with more conventional systems. These findings also imply that additional nodes associated with anaerobic carbon partitioning may serve as future targets for optimizing the balance between intracellular WE synthesis and extracellular organic acid accumulation.

Overall, targeted modification at anaerobic metabolic branch points redirected carbon allocation toward succinate accumulation in E. gracilis without abolishing WE biosynthesis. SCSα disruption mainly reduced the propionyl‐CoA‐derived contribution to WE synthesis, whereas ME silencing enhanced carbon retention within the fumarate‐to‐succinate pathway. Combined modification produced the greatest increase in succinate while preserving substantial WE synthesis.

5. Conclusion

Targeted modification of anaerobic metabolic branch points increased succinate accumulation in E. gracilis under anaerobic conditions without abolishing WE biosynthesis. SCSα KO and ME silencing each promoted succinate accumulation while maintaining substantial WE production, and their combination produced the most pronounced effect. These findings provide a basis for metabolic engineering strategies aimed at controlling carbon allocation between WEs and succinate during anaerobic metabolism.

Funding

This work was supported by Japan Society for the Promotion of Science (KAKENHI grant no. JP24K01897). Japan Science and Technology Agency, GteX Program Japan (grant no. JPMJGX23B0, SPRING JPMJSP2139).

Supporting information

Figure S1: Changes (Δ) in extracellular organic acids under anaerobic conditions. Changes in extracellular organic acids in the culture supernatant during 48 h of anaerobic incubation were quantified for wild‐type (WT), SCSα‐knockout (KO), ME‐RNAi, and SCSα‐KO ME‐RNAi cultures. (A) Change in extracellular malate content. (B) Change in extracellular fumarate content. (C) Change in extracellular succinate content. Error bars indicate standard deviation (SD; n = 3 independent cultures). Statistical differences among WT, SCSα‐KO, ME‐RNAi, and SCSα‐KO ME‐RNAi were assessed by one‐way ANOVA followed by the Tukey–Kramer HSD test. Different letters indicate significant differences (p < 0.05).

JEU-73-e70134-s001.tif (390.5KB, tif)

Figure S2: Saponified fatty acid and fatty alcohol composition of wax esters in wild‐type (WT) and SCSα‐knockout (KO) cells after anaerobic incubation. Wax esters accumulated after 48 h of anaerobic incubation were saponified, and released fatty acid (FA) and fatty alcohol (FAlc) moieties were quantified. (A) FA composition of saponified wax esters. (B) FAlc composition of saponified wax esters. Values are expressed as percentages of the total FA or FAlc content. Error bars indicate standard deviation (SD; n = 3 independent cultures).

JEU-73-e70134-s003.tif (1.8MB, tif)

Data S1: jeu70134‐sup‐0003‐Supinfo.docx.

JEU-73-e70134-s002.docx (11.8KB, docx)

Acknowledgments

Declaration of Generative AI and AI‐Assisted Technologies in the Writing Process: During the preparation of this work, the authors used ChatGPT to improve language and readability. After using this tool, the authors reviewed and edited the text as required and took full responsibility for the content of this publication.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Blankschien, M. D. , Clomburg J. M., and Gonzalez R.. 2010. “Metabolic Engineering of Escherichia coli for the Production of Succinate From Glycerol.” Metabolic Engineering 12: 409–419. 10.1016/j.ymben.2010.06.002. [DOI] [PubMed] [Google Scholar]
  2. Bligh, E. G. , and Dyer W. J.. 1959. “A Rapid Method of Total Lipid Extraction and Purification.” Canadian Journal of Biochemistry and Physiology 37: 911–917. 10.1139/o59-099. [DOI] [PubMed] [Google Scholar]
  3. Bridger, W. A. 1974. “Succinyl‐CoA Synthetase.” In The Enzymes, edited by Boyer P. D., vol. 10, 3rd ed., 581–606. Academic Press. 10.1016/S1874-6047(08)60150-X. [DOI] [Google Scholar]
  4. Cheng, K.‐K. , Wang G.‐Y., Zeng J., and Zhang J.‐A.. 2013. “Improved Succinate Production by Metabolic Engineering.” BioMed Research International 2013: 538790. 10.1155/2013/538790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chisti, Y. 2007. “Biodiesel From Microalgae.” Biotechnology Advances 25: 294–306. 10.1016/j.biotechadv.2007.02.001. [DOI] [PubMed] [Google Scholar]
  6. Gouveia, L. , and Oliveira A. C.. 2009. “Microalgae as a Raw Material for Biofuels Production.” Journal of Industrial Microbiology & Biotechnology 36: 269–274. 10.1007/s10295-008-0495-6. [DOI] [PubMed] [Google Scholar]
  7. Hodge, J. E. , and Hofreiter B. T.. 1962. “Determination of Reducing Sugars and Carbohydrates.” In Methods in Carbohydrate Chemistry, edited by Whistler R. L. and Wolfrom M. L., vol. 1, 380–394. Academic Press. [Google Scholar]
  8. Hu, Q. , Sommerfeld M., Jarvis E., et al. 2008. “Microalgal Triacylglycerols as Feedstocks for Biofuel Production: Perspectives and Advances.” Plant Journal 54: 621–639. 10.1111/j.1365-313X.2008.03492.x. [DOI] [PubMed] [Google Scholar]
  9. Inui, H. , Miyatake K., Nakano Y., and Kitaoka S.. 1982. “Wax Ester Fermentation in Euglena gracilis .” FEBS Letters 150: 89–93. 10.1016/0014-5793(82)81310-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Inui, H. , Miyatake K., Nakano Y., and Kitaoka S.. 1984. “Fatty Acid Synthesis in Mitochondria of Euglena gracilis .” European Journal of Biochemistry 142: 121–126. 10.1111/j.1432-1033.1984.tb08258.x. [DOI] [PubMed] [Google Scholar]
  11. Iseki, M. , Matsunaga S., Murakami A., et al. 2002. “A Blue‐Light‐Activated Adenylyl Cyclase Mediates Photoavoidance in Euglena gracilis .” Nature 415: 1047–1051. 10.1038/4151047a. [DOI] [PubMed] [Google Scholar]
  12. Jenkins, T. M. , and Weitzman P. D. J.. 1986. “Distinct Physiological Roles of Animal Succinate Thiokinases: Association of Guanine Nucleotide‐Linked Succinate Thiokinase With Ketone Body Utilization.” FEBS Letters 205: 215–218. 10.1016/0014-5793(86)80900-0. [DOI] [PubMed] [Google Scholar]
  13. Karn, R. C. , and Hudock G. A.. 1973. “A Photorepressible Isozyme of Malic Enzyme in Euglena gracilis Strain Z.” Journal of Protozoology 20: 316–320. 10.1111/j.1550-7408.1973.tb00886.x. [DOI] [PubMed] [Google Scholar]
  14. Katayama, R. , Hayashi R., Ueda M., Sakamoto T., and Nakazawa M.. 2026. “Elucidation of Enzymatic Routes Underlying Odd‐Chain Fatty Acid Synthesis and Propionate Assimilation in Euglena gracilis .” Journal of Eukaryotic Microbiology 73: e70078. 10.1111/jeu.70078. [DOI] [PubMed] [Google Scholar]
  15. Koren, L. E. , and Hutner S. H.. 1967. “High‐Yield Media for Photosynthesizing Euglena gracilis Z.” Journal of Protozoology 14, no. Supplement: 17. [Google Scholar]
  16. Lin, H. , Bennett G. N., and San K.‐Y.. 2005. “Metabolic Engineering of Aerobic Succinate Production Systems in Escherichia coli to Improve Process Productivity and Achieve the Maximum Theoretical Succinate Yield.” Metabolic Engineering 7: 116–127. 10.1016/j.ymben.2004.10.003. [DOI] [PubMed] [Google Scholar]
  17. Liu, X. , Zhao G., Sun S., Fan C., Feng X., and Xiong P.. 2022. “Biosynthetic Pathway and Metabolic Engineering of Succinic Acid.” Frontiers in Bioengineering and Biotechnology 10: 843887. 10.3389/fbioe.2022.843887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Nagamine, S. , Oishi R., Ueda M., Sakamoto T., and Nakazawa M.. 2024. “Genome Editing‐Based Mutagenesis Stably Modifies Composition of Wax Esters Synthesized by Euglena gracilis Under Anaerobic Conditions.” Bioresource Technology 410: 131255. 10.1016/j.biortech.2024.131255. [DOI] [PubMed] [Google Scholar]
  19. Nakazawa, M. , Ando H., Nishimoto A., et al. 2018. “Anaerobic Respiration Coupled With Mitochondrial Fatty Acid Synthesis in Wax Ester Fermentation by Euglena gracilis .” FEBS Letters 592: 4020–4027. 10.1002/1873-3468.13276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Nakazawa, M. , Andoh H., Koyama K., et al. 2015. “Alteration of Wax Ester Content and Composition in Euglena gracilis With Gene Silencing of 3‐Ketoacyl‐CoA Thiolase Isozymes.” Lipids 50: 483–492. 10.1007/s11745-015-4010-3. [DOI] [PubMed] [Google Scholar]
  21. Nakazawa, M. , Hayashi R., Takenaka S., et al. 2017. “Physiological Functions of Pyruvate:NADP+ Oxidoreductase and 2‐Oxoglutarate Decarboxylase in Euglena gracilis Under Aerobic and Anaerobic Conditions.” Bioscience, Biotechnology, and Biochemistry 81: 1386–1393. 10.1080/09168451.2017.1318696. [DOI] [PubMed] [Google Scholar]
  22. Nakazawa, M. , Takahashi M., Hayashi R., et al. 2021. “NADPH‐To‐NADH Conversion by Mitochondrial Transhydrogenase Is Indispensable for Sustaining Anaerobic Metabolism in Euglena gracilis .” FEBS Letters 595: 2922–2930. 10.1002/1873-3468.14221. [DOI] [PubMed] [Google Scholar]
  23. Nomura, T. , Yoshikawa M., Suzuki K., and Mochida K.. 2020. “Highly Efficient CRISPR‐Associated Protein 9 Ribonucleoprotein‐Based Genome Editing in Euglena gracilis .” STAR Protocols 1: 100023. 10.1016/j.xpro.2020.100023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Sasaki, H. , Yanagihara Y., Satofuka Y., et al. 2025. “Engineering Anaerobic Electron Flow Through Heterologous Rhodoquinone Synthesis in Model Microbial and Photosynthetic Platforms.” Journal of Bioscience and Bioengineering 140: 14–20. 10.1016/j.jbiosc.2025.04.008. [DOI] [PubMed] [Google Scholar]
  25. Schneider, T. , and Betz A.. 1985. “Waxmonoester Fermentation in Euglena gracilis T. Factors Favouring the Synthesis of Odd‐Numbered Fatty Acids and Alcohols.” Planta 166: 67–73. 10.1007/BF00397387. [DOI] [PubMed] [Google Scholar]
  26. Shigeoka, S. , and Nakano Y.. 1991. “Characterization and Molecular Properties of 2‐Oxoglutarate Decarboxylase From Euglena gracilis .” Archives of Biochemistry and Biophysics 288: 22–28. 10.1016/0003-9861(91)90160-K. [DOI] [PubMed] [Google Scholar]
  27. Shigeoka, S. , Onishi T., Maeda K., Nakano Y., and Kitaoka S.. 1986. “Occurrence of Thiamin Pyrophosphate‐Dependent 2‐Oxoglutarate Decarboxylase in Mitochondria of Euglena gracilis .” FEBS Letters 195: 43–47. 10.1016/0014-5793(86)80126-0. [DOI] [Google Scholar]
  28. Shimada, I. , Nakamura Y., Kato S., et al. 2018. “Catalytic Cracking of Wax Esters Extracted From Euglena gracilis for Hydrocarbon Fuel Production.” Biomass and Bioenergy 112: 138–143. 10.1016/j.biombioe.2018.03.004. [DOI] [Google Scholar]
  29. Skorokhodova, A. Y. , Gulevich A. Y., and Debabov V. G.. 2018. “Inactivation of Malic Enzymes Improves the Anaerobic Production of Four‐Carbon Dicarboxylic Acids by Recombinant Escherichia coli Strains Expressing Pyruvate Carboxylase.” Applied Biochemistry and Microbiology 54: 849–854. 10.1134/S0003683818090065. [DOI] [Google Scholar]
  30. Tokunaga, M. , Nakano Y., and Kitaoka S.. 1979. “Subcellular Localization of the GABA‐Shunt Enzymes in Euglena gracilis Strain Z.” Journal of Protozoology 26: 471–473. 10.1111/j.1550-7408.1979.tb04655.x. [DOI] [PubMed] [Google Scholar]
  31. Tomita, Y. , Yoshioka K., Iijima H., et al. 2016. “Succinate and Lactate Production From Euglena gracilis During Dark, Anaerobic Conditions.” Frontiers in Microbiology 7: 2050. 10.3389/fmicb.2016.02050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Yokota, A. , Hosotani K., and Kitaoka S.. 1982. “Mechanism of Metabolic Regulation in Photoassimilation of Propionate in Euglena gracilis Z.” Archives of Biochemistry and Biophysics 213: 530–537. 10.1016/0003-9861(82)90580-X. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: Changes (Δ) in extracellular organic acids under anaerobic conditions. Changes in extracellular organic acids in the culture supernatant during 48 h of anaerobic incubation were quantified for wild‐type (WT), SCSα‐knockout (KO), ME‐RNAi, and SCSα‐KO ME‐RNAi cultures. (A) Change in extracellular malate content. (B) Change in extracellular fumarate content. (C) Change in extracellular succinate content. Error bars indicate standard deviation (SD; n = 3 independent cultures). Statistical differences among WT, SCSα‐KO, ME‐RNAi, and SCSα‐KO ME‐RNAi were assessed by one‐way ANOVA followed by the Tukey–Kramer HSD test. Different letters indicate significant differences (p < 0.05).

JEU-73-e70134-s001.tif (390.5KB, tif)

Figure S2: Saponified fatty acid and fatty alcohol composition of wax esters in wild‐type (WT) and SCSα‐knockout (KO) cells after anaerobic incubation. Wax esters accumulated after 48 h of anaerobic incubation were saponified, and released fatty acid (FA) and fatty alcohol (FAlc) moieties were quantified. (A) FA composition of saponified wax esters. (B) FAlc composition of saponified wax esters. Values are expressed as percentages of the total FA or FAlc content. Error bars indicate standard deviation (SD; n = 3 independent cultures).

JEU-73-e70134-s003.tif (1.8MB, tif)

Data S1: jeu70134‐sup‐0003‐Supinfo.docx.

JEU-73-e70134-s002.docx (11.8KB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from The Journal of Eukaryotic Microbiology are provided here courtesy of Wiley

RESOURCES