E2F1-Activated lncRNA FTX Promotes Asthma Progression via Regulating the SRSF1/RBPJ Axis

Abstract

Purpose

Long non-coding RNA five prime to Xist (FTX) is considered a regulator for asthma. Therefore, we aimed to explore its more roles and molecular mechanisms in asthma process.

Methods

Serum samples from controls and asthmatics were collected. Asthma mouse models were induced with ovalbumin (OVA), and cell models were established using airway smooth muscle cells (ASMCs) treated with platelet-derived growth factor BB (PDGF-BB). The inspiratory and expiratory airway resistances of mice were examined by measuring airway hyperresponsiveness. The pathological changes of mice lung tissues were observed by hematoxylin & eosin, periodic acid-Schiff, and Masson staining. Serum immunoglobulin E and inflammatory factor levels were detected using an enzyme-linked immunosorbent assay. The CCK-8, Transwell, and flow cytometry were used to assess cell function. FTX, E2F family transcription factor 1 (E2F1), serine rich/arginine splicing factor 1 (SRSF1), and recombination signal binding protein J (RBPJ) levels measured by quantitative real-time-polymerase chain reaction or Western blotting. The relationships among FTX, E2F1, SRSF1, and RBPJ were evaluated by dual-luciferase report, ChIP, RNA pull-down and RIP assay. The effect of FTX/SRSF1 on RBPJ mRNA stability was analyzed by the actinomycin D treatment assay.

Results

Upregulated FTX was detected in asthmatic patients, asthma mice, and PDGF-BB-induced ASMCs. FTX downregulation repressed PDGF-BB-induced ASMCs viability, migration, and inflammation. E2F1 bound to the FTX promoter region to activate its expression, and E2F1 downregulation could repress PDGF-BB-induced ASMCs function via reducing FTX expression. Also, FTX stabilized RBPJ mRNA by interacting with SRSF1. RBPJ overexpression reversed the downregulation effect of FTX knockdown on PDGF-BB-induced ASMCs viability, migration, and inflammation. Meanwhile, E2F1 downregulation alleviated mouse asthma symptoms by inhibiting the FTX/SRSF1/RBPJ pathway.

Conclusions

FTX, transcriptionally activated by E2F1, promoted asthma progression via the the regulation of the SRSF1/RBPJ pathway, thereby providing a possible therapeutic target for asthma treatment that warrants further validation.

INTRODUCTION

Asthma is a disease characterized by airway inflammation, reversible airway obstruction, and increased airway responsiveness to a variety of stimuli,¹,² which has become a serious threat to human health.³ In China, the prevalence rate of asthma is on the rise, with low quality of life and gradually increasing high medical costs.⁴,⁵ Studies have found that airway smooth muscle cells (ASMCs) play an important role in asthma progression.⁶ There is also evidence that ASMCs are involved in airway hyperresponsiveness (AHR), inflammation and remodeling processes in asthmatic patients.⁷ Therefore, an in-depth study of the molecular mechanisms affecting ASMCs function is of great significance for alleviating asthma progression.

Long non-coding RNAs (lncRNAs), with length more than 200 nt, play a crucial role in the occurrence of many human diseases, including asthma.⁸,⁹,¹⁰ LncRNA five prime to Xist (FTX) is the transcription product of the FTX gene located at the X-inactivation center and has been reported to be connected with human disease development.¹¹ Previous studies found that FTX was upregulated in colorectal cancer tissues, and that its knockdown inhibited tumor cell proliferation and metastasis.¹² Huo et al.¹³ revealed that FTX expression was elevated in lung adenocarcinoma, which could enhance cell proliferation and migration through targeting the miR-335-5p/NUCB2 axis. In asthma, our previous studies have reported that FTX may increase expression in platelet-derived growth factor BB (PDGF-BB)-induced asthma cell models, and that its downregulation could repress PDGF-BB-induced ASMCs proliferation and migration through the miR-590-5p/JAK2 axis.¹⁴ Therefore, we believe that FTX has the potential to be a therapeutic target for asthma, and its underlying molecular mechanism deserve to be further elucidated.

The E2F family transcription factors consist of 8 genes in mammals, and transcriptional activity of E2F family members can regulate cell cycle progression.¹⁵ E2F family transcription factor 1 (E2F1) is a transcriptional activator and has been confirmed to mediate the transcription of lncRNA.¹⁶ For example, E2F1-induced lncRNA KDM4A-AS1 enhanced hepatocellular carcinoma cell proliferation, migration, and epithelial-mesenchymal transition (EMT).¹⁷ Yang et al.¹⁸ found that the E2F1-mediated upregulation of lncRNA BAIAP2-AS1 contributed to the malignant phenotypes of hepatocellular carcinoma cells. Furthermore, Liu et al.¹⁹ demonstrated that E2F1 was involved in regulating asthma progression. Using the JASPER software, we found that E2F1 had multiple binding sites in the FTX promoter region. However, whether E2F1 influences asthma progression by transcriptionally regulating FTX needs to be further elucidated.

Serine rich/arginine splicing factor 1 (SRSF1) is an important regulator of gene expression and belongs to the SR protein family.²⁰ A previous study revealed that downregulation of SRSF1 suppressed ASMCs proliferation to regulate asthma progression.²¹ Recombination signal binding protein J (RBPJ) is a transcription factor in mammals,²² and it has been found that RBPJ can regulate basophil immunomodulatory function in asthma mouse models.²³ Reportedly, lncRNA combined with SRSF1 to maintain downstream gene stability.²⁴ In this study, the StarBase software predicted a potential interaction between FTX and SRSF1, and further analysis showed that FTX could regulate RBPJ mRNA stability by interacting with SRSF1. However, whether FTX affects asthma progression by regulating SRSF1/RBPJ axis is still unclear.

Here, we showed that E2F1-induced FTX upregulation promoted asthma progression by regulating the SRSF1/RBPJ axis. These findings provide new insights into understanding pathological mechanisms and developing therapeutic strategies for asthma.

MATERIALS AND METHODS

Clinical sample collection

A total of 15 asthmatic patients and 15 normal controls were selected from our hospital records. The peripheral bloods of asthmatic patients and normal controls were collected for obtaining serum samples. Information from all participants is provided in Supplementary Table S1. This research was approved by Longgang Central Hospital with the consent of the subjects (approval No. 2025ECYJ079).

Construction of asthma mice model

As previously described,²⁵ male BALB/c mice (n = 6 per group) were intraperitoneally injected with 20 g of full Freund adjuvant (Sigma-Aldrich, St. Louis, MO, USA) mixed with 1 mg of aluminum hydroxide (Sigma-Aldrich) on days 0, 7 and 14. Subsequently, the mice were exposed to 1% ovalbumin (OVA; Sigma-Aldrich) aerosol for 7 days consecutively starting on day 15. Control mice were given normal saline instead (n = 6). In the OVA+sh-NC and OVA+sh-E2F1 group, mice were intravenously injected with 100 μL of lentivirus sh-E2F1/sh-NC via the tail vein 30 minutes before the establishment of OVA mouse model. Blood samples and bronchoalveolar lavage fluid (BALF) were harvested by cardiac puncture and tracheal cannulation, respectively. Finally, mice were sacrificed and lung tissues were harvested for further analysis. Animal study was approved by Longgang Central Hospital (approval No. 2025-087).

AHR measurement

As described by Gao et al.,²⁶ all mice were anesthetized using 50 mg/kg pentobarbital sodium within 24 hours after the last OVA exposure. The inspiratory and expiratory resistances were evaluated using the AniRes2005 Pulmonary Function System (Bestlab, Beijing, China).

Enzyme-linked immunosorbent assay (ELISA)

According to the instructions of each commercial kit (Abcam, Cambridge, MA, USA), the levels of immunoglobulin E (IgE; ab157736), tumor necrosis factor-α (TNF-α; ab208348 for mice and ab181421 for humans), interleukin (IL)-1β (ab197742 for mice and ab214025 for humans), and IL-6 (ab222503 for mice and ab178013 for humans) were measured, respectively.

Histopathological staining

Lung tissue samples were fixed with 4% paraformaldehyde and then embedded to prepare paraffin sections. After that, the 4 μm sections were dewaxed, hydrated, and washed. For hematoxylin & eosin (H&E) staining, sections were stained with 0.5% H&E solution (Beyotime, Shanghai, China). For Periodic acid-Schiff staining, sections were oxidized with a periodic acid solution and stained with Schiff’s reagent and hematoxylin (Beyotime). For Masson staining, the sections were stained with hematoxylin, ponceau-acid magenta, and bright green staining solution (Beyotime). Finally, the sample was dehydrated, sealed with a neutral gum sheet, and then photographed under a microscope.

Isolation and culture of ASMCs

In agreement with our previous reports,¹⁴ ASMCs were isolated from healthy segments of the main trachea in patients undergoing pneumonectomy. Isolated airway smooth muscle bundles were cut into pieces and cultured in Dulbecco’s Modified Eagle’s Medium containing 20% fetal bovine serum and 1% penicillin/streptomycin. For establishing asthma models in vitro, ASMCs were induced with 25 ng/mL PDGF-BB (Sigma-Aldrich) to mimic the asthma-like condition, with untreated ASMCs as the control group.

Quantitative real-time-polymerase chain reaction (qRT-PCR)

Total RNAs were isolated from serum samples, lung tissues, and AMSCs using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and then synthesized into cDNA using the cDNA Synthesis kit (Takara, Tokyo, Japan). SYBR Green (Takara) was used to perform PCR amplification with specific primers (Table). The 2^−ΔΔCt method was used to analyze the relative expression of FTX, E2F1, SRSF1, and RBPJ. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a reference.

Table. Primer sequences used for quantitative real-time-polymerase chain reaction.

Name		Forward (5′-3′)	Reverse (5′-3′)
Human
	FTX	CGGCGATTCTGGAGAGGTTG	GGCATCACCTCCTGGTTGAA
	E2F1	ACGCTATGAGACCTCACTGAA	TCCTGGGTCAACCCCTCAAG
	SRSF1	ATGTCGGGAGGTGGTGTGATTC	TGTTCCACGGCCGCTTCGAG
	RBPJ	CTACCCGCTGCGACTCTCTA	GGTCACTGGGCTAACGACAA
	GAPDH	GGTGAAGGTCGGTGTGAACG	CTCGCTCCTGGAAGATGGTG
Mouse
	FTX	CCCCAATCTTGTAGCAATCCTG	TCTCTCTATCATCCCAAACAGCG
	E2F1	GAGAAGTCACGCTATGAAACCTC	CCCAGTTCAGGTCAACGACAC
	SRSF1	GTGGAAGCTGGCAGGACTTA	AGGCAGTTTCTCCCTCGTGA
	RBPJ	GCCTGTTGTGACAGGGAAGTT	GATACACACAAGGAGGAGGGC
	GAPDH	TGACCTCAACTACATGGTCTACA	CTTCCCATTCTCGGCCTTG

FTX, five prime to Xist; E2F1, E2F family transcription factor 1; SRSF1, serine rich/arginine splicing factor 1; RBPJ, recombination signal binding protein J; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Cell transfection

ASMCs were transfected with the small interfering RNA against FTX/E2F1 (si-FTX/si-E2F1), pcDNA overexpression vectors of FTX/E2F1/SRSF1/RBPJ (pc-FTX/pc-E2F1/pc-SRSF1/pc-RBPJ), and their negative controls (si-NC or pc-NC) (synthesized by RiboBio, Guangzhou, China) using Lipofectamine 2000 (Invitrogen).

CCK8 assay

According to the instructions of the CCK8 Kit (Dojindo, Kumamoto, Japan), ASMCs were cultured on 96-well plates for 48 hours and then incubated with 10 µL of CCK8 reagent. Microplate readers were used to evaluate absorbance at 450 nm to assess cell viability.

Transwell assay

ASMCs were seeded into the upper of 24-well Transwell chambers (Corning Inc., Corning, NY, USA) with serum-free medium, and the lower chamber was added with completed medium. After 24 hours, migrated cells were fixed, stained, and counted using a microscope.

Western blot (WB) analysis

Proteins were isolated from serum samples, lung tissues and AMSCs by RIPA buffer (Beyotime), separated by 10% SDS-PAGE gel and transferred onto polyvinylidene difluoride membranes. The membranes were blocked with 5% skimmed milk and incubated with primary antibodies (all from Abcam), including anti-matrix metalloproteinase-1 (MMP1) (ab137332, 1/2,500), anti-matrix metalloproteinase-9 (MMP9) (ab76003, 1/1,000), anti-Bcl-2 (ab182858, 1/2,000), anti-Bax (ab32503, 1/1,000), anti-E2F1 (ab245308, 1/1,000), anti-SRSF1 (ab38017, 1/10,000), anti-RBPJ (ab180588, 1/1,000), or anti-GAPDH (ab9485, 1/2,500) overnight. After being treated with secondary antibody (ab205718, 1/50,000, Abcam) for 1 hour, protein signals were visualized using ECL reagent (Beyotime).

Flow cytometry

ASMCs were collected and re-suspended with binding buffers. Subsequently, cells were stained with Annexin V-FITC and PI (Sigma-Aldrich) for 15 minutes in the dark. FACScalibur flow cytometer with the CellQuest Pro software was used to analyze cell apoptosis rate.

Dual-luciferase reporter assay

The JASPER software predicted that E2F1 had 2 binding sites in the FTX promoter region. The wild-type (WT), mutated site 1 (M1), and mutated site 2 (M2) sequences of the FTX promoter region were cloned into the pGL3-basic vector. ASMCs were transfected with the above-mentioned vectors and the si-NC/si-E2F1/pc-NC/pc-E2F1 using Lipofectamine 2000. After 48 hours, cells were collected for detecting luciferase activity by Dual-Luciferase Reporter Assay Kit (Beyotime).

ChIP assay

ASMCs were cross-linked with 1% formaldehyde, lysed with RIPA buffer, and sonicated to DNA fragments using the Magna ChIP A/G Kit (Millipore, Billerica, MA, USA). Afterward, fragments were incubated with Protein A/G Agarose and anti-E2F1 (ab245308, Abcam) or anti- immunoglobulin G (IgG) (ab172730, Abcam) to obtain immunoprecipitated DNA. Finally, qRT-PCR was performed to detect FTX enrichment.

RNA pull-down assay

Bio-FTX sense/Bio-FTX anti-sense probes (Roche, Basel, Switzerland) were incubated with Streptavidin Agarose Resin (Pierce, Rockford, IL, USA). Then, the lysates of AMSCs were incubated with Agarose Resin, and the supernatants were collected for detecting SRSF1 protein levels by WB analysis.

RIP assay

ASMCs were lysed with lysis buffer, and cell lysates were incubated overnight with anti-SRSF1 (ab38017, Abcam) or anti-IgG (ab172730, Abcam) pre-coated with Protein A/G Agarose for 4 hours. Subsequently, purified RNA was collected to analyze FTX and RBPJ enrichment by qRT-PCR.

Assessment of mRNA stability

ASMCs were transfected with si-NC/si-FTX/pc-NC/pc-SRSF1 for 48 hours and then treated with Actinomycin D solution (Sigma-Aldrich) for indicated time points (0, 2, 4, and 6 hours). At each time point, cells were collected to detect RBPJ mRNA expression by qRT-PCR.

Statistical analysis

To evaluate the normality of the data more objectively, the Shapiro-Wilk normality test was performed to determine that the data were normally distributed. Data were expressed as mean ± standard deviation using GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). Differences were compared using Student’s t-test (for two groups) or analysis of variance with Tukey’s post hoc test (for multiple groups). P < 0.05 was considered statistically significant.

RESULTS

FTX is upregulated in asthmatic patients, mice, and PDGF-BB-induced ASMCs

Compared with normal controls, serum FTX expression was upregulated in asthmatic patients (Fig. 1A). To further investigate, we constructed asthma mouse models in vivo. Through analyzing, we confirmed that inspiratory resistance, expiratory resistance, and serum IgE level were significantly enhanced in OVA-induced asthmatic mice (Fig. 1B and C). Furthermore, abnormal lung morphology, thickening of airway walls, and infiltration of inflammatory cells were observed in OVA-induced asthmatic mice by H&E staining (Fig. 1D). The above-mentioned information indicated the successful establishment of asthma mouse models. After that, we detected the high FTX expression in the lung tissues of OVA-induced asthma mice (Fig. 1E). Additionally, PDGF-BB-induced ASMCs were used to establish asthma cell models in vitro, and we confirmed that FTX expression was elevated in PDGF-BB-treated ASMCs (Fig. 1F). These dates showed that high FTX expression might be associated with asthma progression.

Fig. 1. Expression of FTX in asthmatic patients, mouse models, and cell models. (A) FTX expression was tested with qRT-PCR in the serum of normal controls and asthmatic patients. (B) Inspiratory and expiratory resistances were examined by hyperresponsiveness detection in control mice and OVA-induced asthma mice. (C) Serum IgE level was assessed by an enzyme-linked immunosorbent assay in control mice and OVA-induced asthmatic mice. (D) Representative images of hematoxylin & eosin stained lung tissue and detection of inflammation scores. (E, F) qRT-PCR was used to measure FTX expression in the lung tissues of OVA-induced asthmatic mice or control mice, and airway smooth muscle cells treated with or without platelet-derived growth factor BB.

FTX, five prime to Xist; qRT-PCR, quantitative real-time-polymerase chain reaction; OVA, ovalbumin; IgE, immunoglobulin E.

^***P < 0.001.

FTX downregulation inhibits PDGF-BB-induced ASMCs viability, migration, and inflammation

Next, loss-of-functional experiments were performed to investigate the role of FTX in asthma. After transfection of si-FTX, FTX expression was reduced in ASMCs (Fig. 2A). Furthermore, si-FTX transfection could decrease FTX expression in PDGF-BB-induced ASMCs (Fig. 2B). Functional assay results showed that FTX knockdown reduced viability and migration in PDGF-BB-induced ASMCs (Fig. 2C and D). Moreover, silencing of FTX lowered the protein levels of airway remodeling markers MMP1 and MMP9 in PDGF-BB-induced ASMCs (Fig. 2E). In addition, si-FTX promoted apoptosis rate and pro-apoptosis marker Bax level, while suppressed anti-apoptosis marker Bcl-2 levels in PDGF-BB-induced ASMCs (Fig. 2F and G). Meanwhile, knockdown of FTX repressed the levels of inflammatory cytokines (TNF-α, IL-1β, and IL-6) in PDGF-BB-induced ASMCs (Fig. 2H). The above-mentiond data revealed that FTX might promote asthma progression.

Fig. 2. Effects of si-FTX on PDGF-BB-induced ASMCs function. (A) FTX expression was detected using qRT-PCR in ASMCs transfected with si-NC/si-FTX. (B-H) ASMCs were transfected with si-NC/si-FTX and treated with PDGF-BB. (B) FTX expression was examined by qRT-PCR. Cell viability and migration were measured by CCK8 assay (C) and Transwell assay (D). (E) MMP1 and MMP9 protein levels were examined using WB analysis. (F) Flow cytometry was performed to evaluate cell apoptosis rate. (G) Bcl-2 and Bax protein levels were tested by WB analysis. (H) TNF-α, IL-1β and IL-6 levels were assessed using an enzyme-linked immunosorbent assay.

FTX, five prime to Xist; PDGF-BB, platelet-derived growth factor BB; ASMC, airway smooth muscle cell; qRT-PCR, quantitative real-time-polymerase chain reaction; NC, negative control; MMP1, matrix metalloproteinase-1; MMP9, matrix metalloproteinase-9; WB, Western blotting; TNF-α, tumor necrosis factor-α; IL-1B, interleukin-1β; IL-6, interleukin-6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

E2F1 activates FTX transcription

By qRT-PCR and WB analysis, we found that E2F1 mRNA and protein levels were upregulated in the serum of asthma patients, the lung tissues of OVA-induced asthma mice, and PDGF-BB-induced ASMCs (Fig. 3A-F). Pearson correlation analysis revealed that E2F1 expression was positively correlated with FTX expression in asthma patients’ serum (Fig. 3G). Moreover, the JASPER software predicted that there had 2 binding sites of the E2F1 in FTX promoter regions (Fig. 3H). To perform further experiments, we constructed the si-E2F1 and pc-E2F1 vector to decrease and increase E2F1 mRNA and protein expression in ASMCs, respectively (Fig. 3I and J). The detection of FTX expression suggested that FTX expression could be reduced by si-E2F1 and promoted by pc-E2F1 in ASMCs, respectively (Fig. 3K). Dual-luciferase reporter assay results showed that si-E2F1 or pc-E2F1 could markedly inhibit or enhance the luciferase activities of FTX-WT and FTX-M1 vectors, while had not effect on that of the FTX-M2 vector (Fig. 3L and M), indicating that E2F1 mainly bound to the site 2 of FTX promoter region. ChIP assay confirmed that the enrichment of FTX was increased by anti-E2F1 at site 2 (Fig. 3N). The above results suggested that E2F1 could promote FTX expression by activating its transcription.

Fig. 3. E2F1 regulated FTX transcription and expression. (A-F) E2F1 mRNA and protein levels were detected with qRT-PCR and WB analysis in the serum of asthmatic patients and normal controls, the lung tissues of control mice and OVA-induced asthmatic mice, and ASMCs treated with or without PDGF-BB. (G) The correlation between E2F1 and FTX expression was measured by Pearson correlation analysis in asthma patients’ serum. (H) The binding sites of E2F1 in FTX promoter regions were predicted by the JASPER software. (I, J) E2F1 mRNA and protein levels were tested using qRT-PCR and WB analysis in ASMCs transfected with si-NC/si-E2F1/pc-NC/pc-E2F1. (K) qRT-PCR was used to check FTX expression in ASMCs transfected with si-NC/si-E2F1/pc-NC/pc-E2F1. Dual-luciferase reporter assay (L, M) and ChIP assay (N) were performed to verify the interaction between E2F1 and FTX.

E2F1, E2F family transcription factor 1; FTX, five prime to Xist; qRT-PCR, quantitative real-time-polymerase chain reaction; WB, western blot; OVA, ovalbumin; ASMC, airway smooth muscle cell; PDGF-BB, platelet-derived growth factor BB; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; WT, wild-type; M1, mutated site 1; M2, mutated site 2; IgG, immunoglobulin G.

^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

E2F1 knockdown suppresses viability, migration and inflammation of PDGF-BB-induced ASMCs by reducing FTX expression

To investigate whether E2F1 regulated asthma progression by FTX, we performed rescue experiments. FTX expression was increased in ASMCs transfected with pc-FTX vector (Fig. 4A). Then, PDGF-BB-induced ASMCs were co-transfected with si-E2F1 and pc-FTX vector. The transfection of pc-FTX vector abolished the decreasing effect of si-E2F1 on FTX expression in PDGF-BB-induced ASMCs (Fig. 4B). E2F1 knockdown suppressed viability and migration, as well as MMP1 and MMP9 protein expression in PDGF-BB-induced ASMCs, while these effects could be abrogated by pc-FTX (Fig. 4C-E). Moreover, E2F1 silencing could promote apoptosis rate, increase Bax level and reduce Bcl-2 level in PDGF-BB-induced ASMCs, while FTX overexpression eliminated above effects (Fig. 4F and G). Meanwhile, pc-FTX reversed the si-E2F1-mediated the repression effect on TNF-α, IL-1β and IL-6 levels in PDGF-BB-induced ASMCs (Fig. 4H). Taken together, we concluded that E2F1 facilitated asthma progression by increasing FTX expression.

Fig. 4. Effects of si-E2F1 and pc-FTX on PDGF-BB-induced ASMC function. (A) FTX expression was tested by qRT-PCR in ASMCs transfected with pc-NC/pc-FTX. (B-H) ASMCs were transfected with si-NC/si-E2F1/pc-NC/pc-FTX and treated with PDGF-BB. (B) qRT-PCR was used to detect FTX expression. CCK8 assay (C) and Transwell assay (D) were performed to measure cell viability and migration. (E) MMP1 and MMP9 protein levels were checked with WB analysis. (F) Cell apoptosis rate was evaluated by flow cytometry. (G) Bcl-2 and Bax protein levels were assessed using WB analysis. (H) TNF-α, IL-1β and IL-6 levels were examined using an enzyme-linked immunosorbent assay.

E2F1, E2F family transcription factor 1; FTX, five prime to Xist; PDGF-BB, platelet-derived growth factor BB; ASMC, airway smooth muscle cell; qRT-PCR, quantitative real-time-polymerase chain reaction; NC, negative control; MMP1, matrix metalloproteinase-1; MMP9, matrix metalloproteinase-9; WB, western blot; TNF-α, tumor necrosis factor-α; IL-1B, interleukin-1β; IL-6, interleukin-6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

FTX maintains RBPJ mRNA stability by binding with SRSF1

Starbase software predicted a potential combination between FTX and SRSF1. Also, SRSF1 mRNA and protein levels were markedly enhanced in the serum of asthma patients, the lung tissues of OVA-induced asthma mice, and PDGF-BB-induced ASMCs (Fig. 5A-F). In asthma patients’ serum, we observed the positive correlation between FTX and SRSF1 expression (Fig. 5G). To further confirm the interaction between them, we performed RNA pull-down assay and RIP assay. As shown in Fig. 5H and I, SRSF1 could be pulled down by Bio-FTX sense, and FTX enrichment was significantly increased in the anti-SRSF1 group. In ASMCs, FTX knockdown markedly decreased SRSF1 mRNA and protein expression (Fig. 5J and K). Moreover, RIP assay found that RBPJ was obviously enriched by anti-SRSF1 (Fig. 5L), confirming the interaction between SRSF1 and RBPJ. Next, we examined RBPJ expression in the serum of asthma patients, the lung tissues of OVA-induced asthma mice, and PDGF-BB-induced ASMCs, and confirmed that RBPJ mRNA and protein levels were significantly elevated (Fig. 5M-R). Interestingly, SRSF1 expression was positively correlated with RBPJ expression in asthma patients’ serum (Fig. 5S). Then, we constructed pc-SRSF1 vector to enhance SRSF1 expression in ASMCs (Fig. 5T). Further analysis revealed that FTX knockdown could reduce RBPJ mRNA and protein expression in ASMCs, while these effects were reversed by SRSF1 overexpression (Fig. 5U and V). Through Actinomycin D treatment assay, we determined that the si-FTX-mediated inhibitory effect on the half-life of RBPJ mRNA was reverted by pc-SRSF1 (Fig. 5W). This evidence indicated that FTX interacted with SRSF1 to promote RBPJ mRNA stability.

Fig. 5. FTX regulates the SRSF1/RBPJ axis. (A-F) qRT-PCR and WB analysis were used to test SRSF1 mRNA and protein expression in the serum of asthmatic patients/ normal controls, the lung tissues of control mice/OVA-induced asthmatic mice, and ASMCs treated with or without PDGF-BB. (G) The correlation between FTX and SRSF1 expression in asthmatic patients’ serum was evaluated by Pearson correlation analysis. The interaction between FTX and SRSF1 was assessed using RNA pull-down assay (H) and RIP assay (I). (J, K) SRSF1 mRNA and protein levels were detected using qRT-PCR and WB analysis in ASMCs transfected with si-NC/si-FTX. (L) The interaction between SRSF1 and RBPJ was measured by RIP assay. (M-R) RBPJ mRNA and protein levels were examined with qRT-PCR and WB analysis in the serum of asthmatic patients/normal controls, the lung tissues of control mice/OVA-induced asthmatic mice, and ASMCs treated with or without PDGF-BB. (S) Pearson correlation analysis was used to assess the correlation between SRSF1 and RBPJ expression in asthmatic patients’ serum. (T) SRSF1 expression was examined by qRT-PCR in ASMCs transfected with pc-NC/pc-SRSF1. (U, V) RBPJ mRNA and protein levels were checked using qRT-PCR and WB analysis in ASMCs transfected with si-NC/si-FTX/pc-NC/pc-SRSF1. (W) Actinomycin D assay was used to assess RBPJ mRNA stability in ASMCs transfected with si-NC/si-FTX/pc-NC/pc-SRSF1.

FTX, five prime to Xist; SRSF1, serine rich/arginine splicing factor 1; RBPJ, recombination signal binding protein J; qRT-PCR, quantitative real-time-polymerase chain reaction; WB, western blot; OVA, ovalbumin; ASMC, airway smooth muscle cell; PDGF-BB, platelet-derived growth factor BB; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IgG, immunoglobulin G.

^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

FTX regulates RBPJ expression to mediate PDGF-BB-induced ASMCs function

Following, we studied whether FTX affected asthma progression by mediating RBPJ expression. RBPJ mRNA and protein levels were elevated in ASMCs transfected with pc-RBPJ vector (Fig. 6A and B). In PDGF-BB-induced ASMCs, pc-RBPJ abolished the reducing effect of si-FTX on RBPJ mRNA and protein expression (Fig. 6C and D). The results of rescue experiment showed that RBPJ overexpression reverted si-FTX-mediated the repression effects on viability, migration, MMP1 and MMP9 levels in PDGF-BB-induced ASMCs (Fig. 6E-G). Besides, the enhancing effect of FTX knockdown on apoptosis rate and Bax level, as well as the inhibiting effect on Bcl-2 level, could be abolished by RBPJ overexpression in PDGF-BB-induced ASMCs (Fig. 6H and I). Meanwhile, the decreased TNF-α, IL-1β and IL-6 levels caused by FTX silencing in PDGF-BB-induced ASMCs could be abrogated by pc-RBPJ (Fig. 6J). These experimental data suggested that FTX increases RBPJ expression to promote asthma progression.

Fig. 6. Effects of si-FTX and pc-RBPJ on PDGF-BB-induced ASMCs function. (A, B) RBPJ mRNA and protein levels were measured using qRT-PCR and WB analysis in ASMCs transfected with pc-NC/pc-RBPJ. (C-J) ASMCs were transfected with si-NC/si-FTX/pc-NC/pc-RBPJ and treated with PDGF-BB. (C, D) qRT-PCR and WB analysis were used to test RBPJ mRNA and protein expression. CCK8 assay (E) and Transwell assay (F) were used to check cell viability and migration. (G) MMP1 and MMP9 protein levels were examined using WB analysis. (H) Flow cytometry was performed to assess cell apoptosis rate. (I) Bcl-2 and Bax protein levels were evaluated by WB analysis. (J) TNF-α, IL-1β and IL-6 levels were examined by an enzyme-linked immunosorbent assay.

FTX, five prime to Xist; RBPJ, recombination signal binding protein J; PDGF-BB, platelet-derived growth factor BB; ASMC, airway smooth muscle cell; qRT-PCR, quantitative real-time-polymerase chain reaction; WB, western blot; NC, negative control; MMP1, matrix metalloproteinase-1; MMP9, matrix metalloproteinase-9; TNF-α, tumor necrosis factor-α; IL-1B, interleukin-1β; IL-6, interleukin-6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

Interference of E2F1 alleviates asthma symptoms in mice models by inhibiting the FTX/SRSF1/RBPJ axis

To further verify our conclusion, we performed animal study. Our data revealed that inspiratory resistance, expiratory resistance and serum IgE level were significantly decreased in OVA+sh-E2F1 group (Fig. 7A and B). H&E staining found that E2F1 downregulation significantly improved lung tissue morphology and reduced inflammation score in OVA-induced asthma mice (Fig. 7C). Besides, E2F1 knockdown ameliorated airway goblet cell hyperplasia and fibrosis of lung tissue in OVA-induced asthma mice (Fig. 7D and E). Additionally, sh-E2F1 inhibited TNF-α, IL-1β and IL-6 levels in the lung tissues and BALF of OVA-induced asthma mice (Fig. 7F and G). In the lung tissues of the OVA+sh-E2F1 group, we observed decreased FTX expression as well as E2F1, SRSF1, and RBPJ protein levels (Fig. 7H and I). Collectively, we demonstrated that E2F1 promoted asthma progression through the FTX/SRSF1/RBPJ axis.

Fig. 7. Effects of E2F1 knockdown on asthma progression in mice. Mice were grouped into control, OVA, OVA+sh-NC, and OVA+sh-E2F1 groups. (A) Inspiratory and expiratory resistances were measured by hyperresponsiveness detection in mice. (B) Serum IgE level was tested using ELISA. (C-E) Representative images of hematoxylin & eosin staining, PAS staining, and Masson staining. (F-G) ELISA was used to test TNF-α, IL-1β and IL-6 levels in lung tissues and BALF of mice. (H) FTX expression in mice lung tissues was measured using quantitative real-time-polymerase chain reaction. (I) E2F1, SRSF1 and RBPJ protein levels in mice lung tissues were evaluated by western blot (n = 6).

E2F1, E2F family transcription factor 1; OVA, ovalbumin; NC, negative control; IgE, immunoglobulin E; ELISA, enzyme-linked immunosorbent assay; PAS, periodic acid-schiff; TNF-α, tumor necrosis factor-α; IL-1B, interleukin-1β; IL-6, interleukin-6; BALF, broncho alveolar lavage fluid; FTX, five prime to Xist; SRSF1, serine rich/arginine splicing factor 1; RBPJ, recombination signal binding protein J; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

DISCUSSION

The transition of the ASMC phenotype from a proliferative to a contractile state during asthma attacks shows the role of ASMC plasticity in asthma pathophysiology.²⁷ It has been reported that excessive proliferation and the migration of ASMCs directly lead to airway remodeling in asthma.²⁸ In addition, more and more studies have revealed that the molecular mechanism regulating ASMCs is very important for understanding the pathogenesis of asthma.²⁹,³⁰,³¹ In this study, we confirmed that the E2F1/FTX/SRSF1/RBPJ axis might play important role in asthma progression.

Previous studies have investigated the abnormal expression of FTX in various diseases. It was reported that FTX levels were upregulated in glioma specimens and that patients with high FTX expression had poor overall survival and progression-free survival.³² FTX expression was elevated in gastric cancer tissues, which facilitated cancer malignant progression via targeting miR-215 to enhance SIVA1 expression.³³ Wang et al.³⁴ reported that FTX promoted nephroblastoma progression by activating the PI3K/AKT pathway. At present, there are few studies on FTX roles in asthma. Our previous studies have clarified that FTX was highly expressed in PDGF-BB-induced ASMCs and that it played a key role in regulating ASMC proliferation, migration, and apoptosis.¹⁴ Consistent with the result of previous research,¹⁴ our study showed that FTX expression was increased in asthma patients, OVA-induced asthma mice, and PDGF-BB-induced ASMCs. Furthermore, we determined that FTX knockdown suppressed PDGF-BB-induced ASMCs viability, migration, and inflammation, suggesting that FTX might aggravate asthma progression.

Xu et al.³⁵ found that 9 genes, including E2F1, might play an important role in the onset of childhood asthma through high-throughput screening. Another study showed that miR-106b-5p inhibited TGF-β1-induced pulmonary fibrosis and EMT to alleviate asthma process by negatively regulating the E2F1/SIX1 axis.¹⁹ As a transcriptional activator, E2F1 can regulate multiple lncRNAs to mediate human disease progression. Previous studies found that E2F1-induced upregulation of MNX1-AS1 enhanced colorectal adenocarcinoma cell proliferation, migration, and invasion.³⁶ The E2F1-mediated overexpression of LINC00668 was associated with the poor prognosis of gastric cancer, which could promote cell proliferation.³⁷ Furthermore, E2F1-responsive SLC16A1-AS1 promoted bladder cancer metabolic reprogramming and aggressive phenotypes.³⁸ In our study, the JASPER software predicted the binding sites of E2F1 in the FTX promoter region, and further revealed that E2F1 transcriptionally activated FTX by binding to its promoter region. Importantly, we confirmed the high E2F1 expression in asthmatic patients and OVA-induced asthmatic mice, as well as in PDGF-BB-induced ASMCs. Functional experiments suggested that FTX overexpression eliminated the repressing effect of E2F1 downregulation on PDGF-BB-induced ASMC viability, migration, and inflammation. Importantly, E2F1 downregulation could alleviate asthma symptoms in mouse models by reducing FTX expression. These results indicated that E2F1-induced upregulation of FTX promotes asthma symptoms.

SRSF1 expression had been shown to be upregulated in the ASMCs of asthmatic horses, suggesting that it could serve as a target for asthma.³⁹ Guo et al.²¹ revealed that SRSF1 was overexpressed in OVA-induced mice and IgE-induced ASMCs, and its downregulation relieved asthma process by inhibiting ASMCs proliferation. Through the StarBase software, we confirmed that there were binding sites between FTX and SRSF1. It has been reported that lncRNA BBOX1-AS1 promoted cancer progression through recruiting SRSF1 to stabilize EFNB2 mRNA,⁴⁰ suggesting that lncRNA participated in disease progression by interacting with SRSF1 to regulate mRNA stability. RBPJ was considered a regulator of asthma, whose deficiency affected the immunomodulatory function of basophils to regulate asthma progression.²³ In this study, we found that FTX interacted with SRSF1, thereby maintaining the mRNA stability of RBPJ. Consistent with the expression pattern of FTX, SRSF1 and RBPJ were upregulated in asthmatic patients as well as murine and cellular models. Further rescue experiments revealed that RBPJ overexpression could abolish the suppressive effect of FTX downregulation on PDGF-BB-induced ASMC viability, migration, and inflammation, confirming the existence of the FTX/SRSF1/RBPJ axis in asthma. Another animal study showed that E2F1 downregulation decreased FTX/SRSF1/RBPJ expression to alleviate asthma symptoms in mice, further verifying the important role of the E2F1/FTX/SRSF1/RBPJ axis in asthma.

However, this study has some limitations. This study only analyzed the expression of key factors; however, whether the changes in E2F1/FTX/SRSF1/RBPJ expression levels in asthma are related to disease classification and severity has not been explored. In the future, a clearer description of the asthma phenotype and severity and, where possible, an exploration of associations between E2F1/FTX/SRSF1/RBPJ levels and key clinical parameters will better contextualize and reduce the risk of overinterpretation of biomarker signals. The models used (OVA BALB/c model and PDGF-BB-ASMC system) and the conclusions obtained can only preliminarily identify some asthma endotypes and cannot fully reproduce the complex airway environment. In the future, other models (e.g., nonallergic or non-T2 asthma, and other airway diseases) will be needed to determine disease specificity. Although we constructed an OVA model to clarify the role of sh-E2F1, it reflects a systemic rather than cell-specific gene knockdown. In the future, further construction of specific cellular gene knockout models is needed to clarify that E2F1 acts through ASMCs. Although this study identified RBPJ as an important molecular target, its downstream signaling pathways have not been defined. In the future, it is necessary to explore the downstream signaling pathways of RBPJ (such as Notch) to further improve the conclusion.

To sum up, our study suggests a potential molecular mechanism for the regulation of asthma progression. Our results pointed out that E2F1-induced overexpression of FTX promoted PDGF-BB-induced ASMC viability, migration, and inflammation via regulating SRSF1/RBPJ axis. These findings suggest that the targeted inhibition of the E2F1/FTX/SRSF1/RBPJ axis may be an important strategy to alleviate asthma, thereby providing a putative regulatory axis for developing the potential therapeutic targets for asthma.

SUPPLEMENTARY MATERIAL

Supplementary Table S1

The characteristics of clinical samples