Effects of a low-protein, high-fructose corn syrup diet on skeletal muscle and bone in young adult mice: a pilot study

Abstract

[Purpose]

This study aimed to examine the effects of chronic consumption of a low-protein diet combined with 10% high-fructose corn syrup (HFCS) on skeletal muscle and bone health in mice.

[Methods]

Seven-week-old male C57BL/6 mice were fed either a normal diet or a low-protein diet supplemented with 10% HFCS for 12 weeks. Gene expression in skeletal muscle was analyzed by real-time PCR, and bone microarchitecture was evaluated using micro-CT.

[Results]

Mice fed the low-protein diet supplemented with HFCS exhibited reduced body weight and lower gastrocnemius, heart, and femur weights. In the gastrocnemius muscle, genes related to muscle growth, glucose transport, and mitochondrial regulation were significantly downregulated, whereas no significant changes were observed in the soleus muscle. Additionally, trabecular bone volume fraction and number were significantly reduced, whereas cortical bone thickness remained unchanged.

[Conclusion]

Chronic intake of a low-protein diet supplemented with HFCS was associated with altered skeletal muscle metabolic gene expression, with potential differences between muscle types and changes in trabecular bone microarchitecture, suggesting potential adverse effects of combined nutritional stress on musculoskeletal health.

INTRODUCTION

Skeletal muscle and bone health are fundamental determinants of physical function, metabolic regulation, and quality of life [1]. The growth, maintenance, and functional integrity of these tissues depend heavily on adequate nutritional support, particularly sufficient protein intake, which is essential for muscle protein synthesis, mitochondrial function, and bone remodeling [2,3]. Conversely, protein deficiency has been shown to induce skeletal muscle atrophy through the disruption of anabolic signaling and mitochondrial metabolism, while also accelerating bone loss by impairing bone formation and structural integrity [4,5].

In parallel with protein insufficiency, modern dietary patterns are increasingly characterized by excessive consumption of added sugars, especially fructose-rich sweeteners such as high-fructose corn syrup (HFCS) [6]. Chronic fructose overconsumption is associated with metabolic dysregulation, including insulin resistance, oxidative stress, and low-grade inflammation in metabolically active tissues, including skeletal muscle, liver, and adipose tissue [7-9]. Importantly, contemporary diets are often defined not by a single nutritional imbalance but by the coexistence of excessive simple sugar consumption and relatively low protein density, particularly in energy-dense, low-cost dietary patterns [6].

Despite growing evidence that protein deficiency and excessive fructose intake independently impair metabolic health, few studies have systematically investigated their combined effects on skeletal muscle and bone, particularly with respect to muscle type- and bone compartment-specific metabolic responses [8,10-12]. Such combined nutritional stress may exert tissue-specific effects, given the distinct metabolic properties of skeletal muscle fiber types, with oxidative muscles relying predominantly on mitochondrial oxidative phosphorylation and glycolytic muscles depending more heavily on anaerobic glycolysis [13]. Similarly, the trabecular and cortical bone compartments exhibit distinct metabolic activity and responsiveness to nutritional stress, potentially resulting in compartment-specific patterns of bone deterioration [14].

Therefore, the present study examined the effects of chronic consumption of an HFCS-supplemented low-protein diet on skeletal muscle and bone health in young adult mice. By assessing respons-es in metabolically distinct muscles and alterations in trabecular and cortical bone microarchitecture, this study aimed to provide preliminary insights into how combined protein deficiency and excess fructose intake may be associated with changes in musculoskeletal markers.

METHODS

Animals

Seven-week-old male C57BL/6 mice were obtained from Orient Bio Inc. (Gapyeong, South Korea) and housed in a temperature-controlled room (22 ± 2 °C) with a 12:12 h light/dark cycle. The mice were randomly assigned to either a normal diet (CON, n = 3) or a low-protein diet supplemented with 10% HFCS (LPD + HFCS, n = 3). The CON group was fed a standard protein diet (28% protein, Altromin 1414, Germany) and water ad libitum. The LPD + HFCS group was fed a low-protein diet (9% protein, Altromin C1003, Germany) and provided with fresh drinking water containing 10% HFCS daily for 12 weeks. The detailed compositions of the CON and LPD with HFCS supplementation are presented in Table 1. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Seoul National University (SNU-220718-4-5).

Table 1.

Composition of control and low-protein diets with HFCS supplementation

Component	Control diet	Low-protein diet
Energy (kcal/kg)	3,680	3,557
Protein (% kcal)	28	9
Fat (% kcal)	22	13
Carbohydrate (% kcal)	50	78
Crude protein (% wt)	25.3	8.1
Crude fat (% wt)	9.1	5.1
Nitrogen-free extract (% wt)	47.4	70.5
Crude fibre (% wt)	2.4	3.1
Crude ash (% wt)	5.7	5.5
HFCS	-	10% (in drinking water)

Real-Time PCR

The soleus and gastrocnemius muscles were selected to compare muscles with distinct fiber-type compositions and metabolic characteristics. The soleus contains a relatively higher proportion of oxidative fibers, whereas the gastrocnemius is a mixed muscle with relatively greater glycolytic characteristics [15]. Total RNA was extracted from the soleus and gastrocnemius muscles using TRIzol reagent (GeneAll), and cDNA was synthesized using M-MLV reverse transcriptase. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Bioline). The relative expression levels of the target genes were calculated using the ΔΔCt method and normalized to GAPDH as a housekeeping gene. The primer sequences for the target genes are listed in Table 2.

Table 2.

Primer sequences used for real-time PCR

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)
GAPDH	ACCCAGAAGACTGTGGATGG	CACATTGGGGGTAGGAACAC
IGF-1	ACCAAAATGACCGCACCTGC	AACACTCATCCACAATGCCTGTC
GLUT4	AAAAGTGCCTGAAACCAGAG	TCACCTCCTGCTCTAAAAGG
SIRT1	ACGGTATCTATGCTCGCCTTG	GACACAGAGACGGCTGGAAC
PGC-1α	CTGTGTGTCAGAGTGGATTG	GCAGCACACTCTATGTCACT
NRF1	CCCCCGAGGACACTTCTTATGATG	GGCCGTTTCCGTTTCTTCCCTGTT
TFAM	GCTCTACACGCCCCTGGTTTCTGG	TCGCTGTAGTGCCTGCTGCTCCTG
SOD2	GCCTCCCAGACCTGCCTTAC	GTGGTACTTCTCCTCGGTGGCG
TNF-α	CATGAGCACAGAAAGCATGATCCG	AAGCAGGAATGAGAAGAGGCTGAG
IL-6	ATCCAGTTGCCTTCTTGGGACTGA	TAAGCCTCCGACTTGTGAAGTGGT

Micro-CT Analysis

The femurs were fixed in 4% PFA overnight at 4 °C and stored in 70% ethanol until analysis. Cortical and trabecular bones were scanned at 70 kV and 200 μA with pixel sizes of 16 μm and 8 μm, respectively, using a Skyscan 1276 μCT device (Bruker, Kontich, Belgium). Cortical bone thickness was measured at the mid-diaphysis over a length of 1.6 mm (100 slices). Trabecular bone was analyzed within a 1 mm region (125 slices) proximal to the distal femoral growth plate. Femur length was measured using DataViewer, and cortical thickness and trabecular bone parameters were analyzed using CTAn software (Bruker, Kontich, Belgium). The following trabecular parameters were evaluated: bone volume fraction (BV/TV), trabecular separation (Tb.Sp), trabecular number (Tb.N), and trabecular thickness (Tb.Th).

Statistical Analysis

All statistical analyses were performed using GraphPad Prism 9 (La Jolla, CA, USA). Differences between the two groups were analyzed using an unpaired two-tailed Student’s t-test. Data are presented as mean ± SEM. A p-value < 0.05 was considered statistically significant.

RESULTS

Animal Characteristics

A 12-week dietary intervention was performed in sevenweek-old male mice fed either a standard protein diet or a low-protein diet supplemented with 10% HFCS (Figure 1A). Mice in the LPD + HFCS group exhibited significantly lower body weights than those in the CON group from one week after the start of the intervention, and this difference was maintained throughout the study period (Figure 1C). At the end of the experiment, body weight was approximately 14% lower in the LPD + HFCS group than in the CON group (Figure 1C). Representative images of the two groups are shown in Figure 1B. In addition, the weights of the gastrocnemius muscle, heart, and femur were significantly lower in the LPD + HFCS group (Figure 1F-H).

Figure 1. Effects of a low-protein diet supplemented with HFCS on body weight and organ characteristics in mice.

(A) Macronutrient composition of the control (CON) and low-protein diet (LPD). (B) Representative images of mice from the CON and LPD + HFCS groups at the end of the 12-week dietary intervention. (C) Weekly changes in body weight during the experimental period. (D–H) Weights of the soleus muscle, plantaris muscle, gastrocnemius muscle, heart, and femur at the end of the study. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01.

Effects of a Low-Protein Diet Combined with HFCS on Skeletal Muscle

The expression levels of genes related to muscle growth, glucose metabolism, mitochondrial regulation, and inflammatory signaling were examined in the soleus and gastrocnemius muscles. In the gastrocnemius muscle, the LPD + HFCS group showed significant reductions in IGF-1 and GLUT4 expression compared with the CON group (Figure 2A). In addition, genes involved in mitochondrial regulation, including SIRT1, NRF1, and SOD2, were significantly downregulated, whereas TNF-α and IL-6 expression was not significantly affected by the dietary intervention (Figure 2B, C). In contrast, no significant differences in the expression of these genes were observed in the soleus muscle between the groups (Figure 2D–F).

Figure 2. Effects of a low-protein diet supplemented with HFCS on gene expression in skeletal muscle.

(A–C) In the gastrocnemius muscle, expression levels of IGF-1 and GLUT4 (A), mitochondrial regulatory genes, including SIRT1, PGC-1α, NRF1, TFAM, and SOD2 (B), and inflammatory markers TNF-α and IL-6 (C) are shown. (D–F) Corresponding gene expression levels in the soleus muscle. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01.

Bone Microstructural Changes Induced by a Low-Protein, HFCS Diet

Cortical and trabecular bone parameters were analyzed using micro-CT to assess bone microstructure. Femur length showed a reduction in the LPD + HFCS group that approached statistical significance compared with the CON group (Figure 3A, p = 0.05). Cortical bone thickness was not significantly affected by the low-protein diet supplemented with HFCS (Figure 3B). In contrast, the LPD + HFCS group exhibited significant reductions in trabecular bone volume fraction (BV/TV) and trabecular number (Tb. N), along with an increase in trabecular separation (Tb.Sp), which approached statistical significance (p = 0.05) compared with the CON group (Figure 3D, F, G). Representative images of the cortical and trabecular bone structures are shown in Figure 3C.

Figure 3. Effects of a low-protein diet supplemented with HFCS on femoral bone microarchitecture.

(A) Femur length measured by micro-CT. (B) Cortical bone thickness at the femoral mid-diaphysis. (C) Representative 3D reconstructions of trabecular bone from the distal femur metaphysis (top) and cortical bone from the femoral mid-diaphysis (bottom). (D–G) Trabecular bone parameters, including bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp). Data are presented as mean ± SEM. **p < 0.01.

DISCUSSION

In this pilot study, we observed that chronic consumption of a low-protein diet supplemented with 10% HFCS was accompanied by selective alterations in skeletal muscle gene expression and bone microarchitecture in young adult mice. The primary finding was that combined nutritional stress was associated with lower expression of genes related to anabolic signaling, glucose transport, and mitochondrial regulation in the gastrocnemius muscle, but not in the soleus muscle. In addition, the LPD + HFCS group exhibited adverse changes in trabecular bone microarchitecture without apparent changes in cortical thickness. Taken together, these results suggest that dietary patterns characterized by protein insufficiency and excessive fructose exposure may be linked to detrimental alterations in musculoskeletal markers in a potentially tissue- and compartment-specific manner.

The differential transcriptional patterns observed in the present study are consistent with prior evidence indicating that protein malnutrition preferentially constrains anabolic signaling and metabolic regulation in mixed and glycolytic muscles, whereas oxidative muscles exhibit relative resistance to nutritional stress [4,16]. Under conditions of limited amino acid availability, reductions in IGF-1 signaling have been linked to impaired muscle growth and protein accretion; accordingly, the reduced IGF-1 expression observed in the gastrocnemius may represent a molecular correlate of compromised anabolic capacity [17,18]. Given that IGF-1 and insulin signaling converge on shared Akt-dependent pathways regulating both protein synthesis and glucose transport, the concurrent reduction in IGF-1 and GLUT4 expression may indicate coordinated alterations in anabolic and metabolic gene regulation in the gastrocnemius muscle under combined protein insufficiency and HFCS exposure [19-21]. However, assessment of protein abundance and insulin-stimulated GLUT4 membrane translocation will be required to confirm these functional consequences. In parallel, the coordinated downregulation of mitochondrial regulatory genes, including SIRT1, NRF1, and SOD2, may reflect alterations in nutrient sensing, mitochondrial maintenance, and redox-related gene networks [22]. Given the central role of these pathways in adapting mitochondrial function to energetic demand and redox balance, their downregulation may suggest a constrained metabolic state with reduced adaptive capacity rather than primary mitochondrial dysfunction. Importantly, these transcriptional alterations occurred in the absence of detectable changes in inflammatory markers, suggesting that the observed transcriptional profile is unlikely to reflect inflammation-driven pathology. While inflammatory cytokine signaling has been widely implicated in muscle dysfunction and atrophy in models of obesity and chronic disease, the present findings may indicate a distinct transcriptional response to combined protein insufficiency and fructose exposure [23,24]. Specifically, our data are compatible with the possibility that this dietary context preferentially alters transcripts related to insulin-responsive glucose handling and mitochondrial adaptability in the gastrocnemius rather than producing prominent changes in the measured inflammatory marker transcripts. Although protein insufficiency alone has been shown to suppress anabolic pathways, the selective transcriptional pattern observed here suggests that combined protein insufficiency and HFCS exposure may be associated with changes in metabolic and mitochondrial gene expression beyond those expected from protein deficiency alone [10].

In bone, the preferential impact on trabecular microarchitecture is biologically plausible, given the higher remodeling activity and turnover of trabecular bone relative to cortical bone, rendering it more sensitive to nutritional and metabolic perturbations [25]. Protein insufficiency has been shown to predominantly impair osteoblast anabolic capacity by limiting matrix protein synthesis and attenuating growth factor-mediated signaling, thereby constraining bone formation [26,27]. In our previous study, protein deficiency initiated during early post-weaning development resulted in reductions in both cortical and trabecular microarchitecture, accompanied by shortened femur length, highlighting the vulnerability of bone modeling and longitudinal growth to inadequate protein availability during early life [5]. In contrast, nutritional stress imposed after growth completion may preferentially affect trabecular bone, where remodeling processes predominate and metabolic responsiveness is heightened, as observed in the present study [14,25]. Emerging evidence indicates that excessive fructose intake disrupts trabecular bone remodeling through metabolic and signaling alterations, including suppression of thyroid hormone receptor beta expression and lipid accumulation within bone tissue, which have been linked to impaired osteogenic differentiation of mesenchymal progenitors [28]. Importantly, these fructose-associated effects appear to primarily compromise osteogenic differentiation rather than directly activate osteoclast-mediated resorption. Given that both protein deficiency and excessive fructose intake have been independently linked to impaired osteoblast anabolic capacity and osteogenic differentiation, it is plausible that the trabecular deterioration observed in the present model reflects, at least in part, suppression of bone formation rather than enhanced osteoclast-mediated resorption. However, further mechanistic studies will be required to delineate the molecular pathways linking combined dietary imbalance to compromised skeletal integrity.

The present study has several important limitations. First, the small sample size warrants cautious interpretation of the findings. Although mice were provided ad libitum access to food and fluid, individual food and fluid consumption was not quantified; therefore, potential differences in total energy intake between the groups could not be fully excluded. In addition, because only the CON and LPD + HFCS groups were included, the independent effects of low-protein intake and HFCS consumption could not be distinguished. This study is also limited by its reliance on transcript-level analyses; therefore, the observed mRNA expression changes should be interpreted as proxy markers that may not necessarily reflect protein abundance or functional outcomes. Future studies with larger cohorts incorporating direct monitoring of food and fluid intake, pair-feeding designs, separate dietary intervention groups such as low-protein-only and HFCS-only groups, protein-level measurements, and direct functional evaluations of muscle and bone will be required to clarify the specific dietary effects and confirm the physiological significance of the observed changes. Despite these limitations, the present study provides preliminary evidence that combined low-protein intake and chronic HFCS exposure may be associated with selective alterations in gastrocnemius metabolic/mitochondrial gene expression and trabecular bone microarchitecture.