Skip to main content
NCBI home page
World Journal of Otorhinolaryngology - Head and Neck Surgery logoLink to World Journal of Otorhinolaryngology - Head and Neck Surgery
. 2026 Oct 11:10.1002/wjo2.70167. Online ahead of print. doi: 10.1002/wjo2.70167

TGF‐β1 Induced Methylation to Regulate SOCS3 Expression in Abnormal Activation of Vocal Fold Fibroblasts

Hai‐Zhou Wang 1, An‐Qi Zhao 1, Xue‐Yan Li 1, Rong Hu 1, Wen Xu 1,✉
PMCID: PMC13655563  PMID: 42865706

ABSTRACT

Objective

To investigate the effect of TGF‐β1 on vocal fold fibroblasts (VFFs) phenotype and the expression of DNA methyltransferase 1 (DNMT1), and to reveal the putative mechanism by which TGF‐β1 regulates SOCS3 and its potential role in abnormal VFFs activation after vocal fold injury.

Methods

The normal VFFs group (Control), injured VFFs group (Injured), normal VFFs+TGF‐β1 group (Control+TGF‐β1), and injured VFFs+TGF‐β1 group (Injured+TGF‐β1) were set, and 5‐aza, a DNA methyltransferase inhibitor that reduces DNMT1 protein levels via covalent trapping and degradation, was added to block DNA methylation. Methylation‐specific PCR (MSP) was used to detect the methylation level of the SOCS3 promoter. The methylation level of the SOCS3 promoter, and the protein and mRNA expressions of Type I collagen (COL1), α‐smooth muscle actin (α‐SMA), DNMT1, SOCS3, JAK2, and STAT3 were detected before and after the addition of TGF‐β1 and 5‐aza.

Results

Compared to the Control group, the expressions of COL1, α‐SMA, and DNMT1 were elevated in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups. After 5‐aza addition, no significant changes occurred in the Control group; however, the above markers were significantly decreased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups. The methylation level of the SOCS3 promoter was significantly increased, and SOCS3 expression was markedly downregulated in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups, while the SOCS3 promoter was not significantly methylated in the Control group. After 5‐aza addition, the methylation level of the SOCS3 promoter was significantly decreased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups, and concomitantly, SOCS3 mRNA and protein expression were significantly upregulated. The expressions of JAK2 and STAT3 were significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups, whereas a significant decrease was observed after adding 5‐aza, with the changes positively correlated with SOCS3 upregulation.

Conclusion

TGF‐β1 is proposed to promote abnormal activation of VFFs, which may be associated with DNA methylation‐mediated regulation of SOCS3. Specifically, TGF‐β1 may downregulate SOCS3 expression via DNMT1‐mediated promoter DNA methylation, and this process is speculated to participate in abnormal VFFs activation by relieving the inhibitory effect of SOCS3 on the JAK2/STAT3 signaling pathway.

Keywords: DNA methylation, fibroblast, SOCS3, TGF‐β1, vocal fold injury

TGF‐β1 increases DNMT1?mediated SOCS3 promoter hypermethylation to repress SOCS3 expression. Loss of SOCS3‐dependent inhibition de‐represses JAK2‐STAT3 signaling and drives abnormal activation of vocal fold fibroblasts, contributing to vocal fold fibrosis.

graphic file with name WJO2-9999-0-g004.webp

1. Introduction

Vocal‐fold fibroblasts (VFFs) are abnormally activated when the vocal folds experience inflammation and trauma. Unregulated deposition of the extracellular matrix can lead to vocal‐fold fibrosis and scarring, which can cause vocal impairment [1, 2]. Myofibroblasts are a specialized subtype of fibroblasts that affect the production and rearrangement of proteins in the extracellular matrix during the remodeling phase of wound healing [3]. Moreover, they disappear via apoptotic mechanisms during tissue repair. Myofibroblasts can cause fibrotic lesions in different organs and tissues, including the liver, kidneys, and lungs, despite their short lifespan [4, 5, 6, 7]. Hence, inhibiting abnormal activation of fibroblasts into myofibroblasts is key to preventing abnormal fibrosis.

Transforming growth factor‐β1 (TGF‐β1) is the core mediator of abnormal fibroblast activation [8]. In damage repair studies, TGF‐β1 is reportedly activated when target organs experience trauma and inflammation [4, 9, 10]. TGF‐β1 regulates cell transformation, proliferation, and apoptosis through signal transduction and plays an important role in the synthesis of extracellular matrix and wound repair [11]. Some studies have indicated that VFFs stimulated by exogenous TGF‐β1 have cellular phenotypes similar to those of vocal‐fold scar fibroblasts [12, 13]. During vocal‐fold injury and fibrosis, the expression of collagen and fibronectin is increased. TGF‐β1 is involved in the regulation of vocal‐fold fibrosis. The TGF‐β1 pathway plays a very important role in fibrosis in almost all tissues and is affected by its upstream and downstream signaling pathways. The JAK/STAT signaling pathway is the common pathway of many cytokines and growth factors signaling. As an upstream pathway of TGF‐β1, the JAK/STAT signaling pathway can interact with TGF‐β1 to participate in fibrosis [14, 15].

The JAK/STAT signaling pathway is regulated by various growth factors and hormones. The cytokine signaling suppressor protein SOCS3 can inhibit the signaling pathways of various cytokines and is a key regulator of the JAK/STAT signaling pathway [16, 17]. In skin fibrosis, the expression of SOCS3 is downregulated; that is, the JAK2/STAT3 signaling pathway is activated. The inactivation of SOCS3 can reduce the threshold of STAT3 activation and activate STAT3, which may directly promote the autonomous activation of fibroblasts [10].

Current research on cytokine regulation focuses on the regulation of cell‐related gene expression. Epigenetic regulation is a method that can modify a gene without changing the DNA sequence of the target gene. This method is more conducive in regulating gene expression [18, 19, 20]. DNA methylation methods are widely used to study tumors, development, and cell differentiation. TGF‐β1 has been reported to regulate the expression of DNA methyltransferase through epigenetic regulation and alters the methylation levels of downstream genes. It affects the expression of related genes, which further may regulate fibroblast activation [21, 22]. However, the regulatory mechanism of TGF‐β1 on SOCS3 and its effect on fibrosis in the process of abnormal activation of VFFs remains unclear.

In this study, we investigated the effect of TGF‐β1 on the phenotype of VFFs and expression of DNA methyltransferase 1 (DNMT1) in vitro, and attempted to reveal the putative regulatory mechanism by which TGF‐β1 modulates SOCS3 and its potential role in abnormal VFFs activation after vocal‐fold injury.

2. Materials and Methods

2.1. Vocal‐Fold Injury

Animal experiments were performed in accordance with the regulations of the Peking University Animal Care and Use Committee (LSC‐ZhangY‐1) and license permit: 1116012800123. Forty adult male Sprague–Dawley (SD) rats weighing 300–350 g were used, with five rats in each group. Twenty rats underwent unilateral vocal‐fold injury using procedures described in an earlier study [23]. The epithelium and lamina propria on one side of the vocal folds were removed under a microscope until the thyroarytenoid muscle was exposed under a laryngoscope. One week after the injury, the rats were sacrificed, and the larynges were harvested for the primary Injured VFFs culture. Similarly, the larynges were harvested from uninjured SD rats, forming the normal Control group.

2.2. Cell Culture

Control group (normal VFFs): VFFs culture methods have been described in previous studies [23]. The vocal fold tissue was excised after general anesthesia in normal SD rats, dissociated, and treated with 7.5 mg/mL Type I collagenase (Gibco, USA) at 37°C for 1 h. After washing with phosphate‐buffered saline, cells were supplemented with Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and 1% penicillin–streptomycin (Sigma‐Aldrich, USA) and incubated at 37°C and 5% CO2‐saturated humidity. The medium was changed every 1–2 days. When the cells were 80%–90% confluent at the bottom of the culture dish, 0.25% trypsin was used for digestion and passage. Cells at passages 2–4 were used in subsequent experiments. Injured VFFs at passages 2–4 were used in subsequent experiments, which have been confirmed to maintain stable fibrotic activation phenotypes during in vitro passage without significant attenuation [23, 24].

Injured group (injured VFFs): 1 week after vocal‐fold injury, the vocal fold tissue of injured SD rats was excised and injured VFFs were cultured in the same manner as that employed for the Control group.

Experimental group design: Four basic experimental groups were established for in vitro VFFs culture: (1) Control: normal VFFs without any treatment; (2) Injured: VFFs isolated from rat vocal fold injury models; (3) Control+TGF‐β1: normal VFFs treated with exogenous TGF‐β1; (4) Injured+TGF‐β1: injured VFFs treated with exogenous TGF‐β1. For methylation inhibition experiments, 5‐aza was added to each basic group, designated as Control+5‐aza, Injured+5‐aza, Control+TGF‐β1 + 5‐aza and Injured+TGF‐β1 + 5‐aza, respectively.

2.3. Immunohistochemistry

Tissue samples were fixed, dehydrated, infiltrated, and embedded in paraffin, and the tissue was sectioned at 4 μm thickness using a Leica RM2016 Cryostat (Leica Microsystems Inc., Bannockburn, IL). After deparaffinization and rehydration, sections were routinely stained with H&E.

IHC staining was performed as follows: Sections were rehydrated, repaired, and endogenous peroxidase activity was blocked by 3% H2O2 and nonspecific binding was blocked with 3% BSA in 0.3% Tween‐20/PBS. Tissue sections were then incubated with the corresponding primary antibodies (TGF‐β1: Sigma, USA; COL1, DNMT1: Proteintech, USA; α‐SMA: Bioss, CHN; SOCS3, Abcam, UK) in blocking buffer overnight at 4°C. Sections were rinsed and then incubated in HRP‐conjugated secondary goat anti‐rabbit antibody (DAKO, DK) for 1 h at room temperature. Sections were rinsed again and incubated in diaminobenzidine reagent (Thermo Fisher Scientific, Waltham, MA, USA) at room temperature. Sections were then rinsed in dH2O, counterstained with hematoxylin, dehydrated, cleared, mounted, and cover‐slipped. Finally, the image of corresponding multiple (20×) was captured in the scanning software (CV/SV, CHN).

2.4. Cellular Immunofluorescence Staining

After the cells in the bottom chamber had been prepared by fixation, permeabilization, and blocked, they were incubated overnight with primary antibodies at 4°C. Subsequently, the cells were incubated with the secondary antibodies for 1 h in the dark at room temperature. Nuclei were stained with 4′,6‐diamidino‐2‐phenylindole (Sigma‐Aldrich) for 10 min. The following primary and secondary antibodies were used: anti‐Type I collagen antibody (Abcam, cat: ab260043, 1:250), anti‐α‐smooth muscle actin (SMA) antibody (Abcam, cat: ab124964, 1:250), and secondary antibody (Jackson, cat:711‐585‐152, 1:300). All images were observed and captured under the same conditions.

2.5. Western Blot

The cells were digested to collect the cell pellets, and 150 μL of the prepared lysis buffer was added to each sample, which was then lysed on ice for 30 min. Subsequently, the samples were centrifuged at 12,000 rpm at 4°C for 15 min. The total protein concentrations were determined using the BCA protein assay kit (Thermo Fisher Scientific). Electrophoresis gel was prepared, and 100 μg of total cell protein was loaded per well. After transferring the proteins to membranes, the membranes were blocked with TBST containing 5% skimmed milk powder for 1 h after transfer, and the corresponding primary antibodies diluted with blocking solution were added (SOCS3, Abcam, UK; DNMT1, JAK2, STAT3: Proteintech, USA; p‐JAK, p‐STAT3: Abmart, CHN) and incubated overnight at 4°C. After washing off the primary antibody, the secondary antibody was added, incubated at room temperature for 1 h, and then developed for color exposure. The gray value was determined using the ImageJ software (National Institutes of Health, USA) for analysis.

2.6. Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR)

Total RNA was extracted using a total RNA extraction kit (Cat: DP419; Tiangen). After purification using an RNeasy kit (Qiagen, CA, USA), reverse transcription was performed to generate cDNA using a RevertAid First Strand cDNA Synthesis kit (Thermo Scientific). Reaction conditions: predenaturation at 95°C for 30 s, denaturation at 95°C for 15 s, annealing at 60°C for 1 min, for a total of 45 cycles. The primers listed in Table 1 were used for quantitative PCR analysis and data collection using the ABI 7900HT qPCR system. The standard curve method was used to calculate the relative expression of mRNA, which was normalized to the internal reference gene β‐actin.

Table 1.

Primer sequences of qRT‐PCR.

Primer Sequence
SOCS3_F CTCAAGACCTTCAGCTCCAA
SOCS3_R GGTCACTCTGCAGCGAAAA
JAK2_F GAGCGAAGATCCAGGACTATC
JAK2_R CCACTGAATTCCACCGTTT
STAT3_F TGCCAATTGTGATGCCTC
STAT3_R CCACTTGGTCCCAGGTTC
α‐SMA_F GGCTTTGCTGGTGATGATG
α‐SMA_R CGTTATAGAAGGAGTGGTGCC
COL1A1‐F CCTCAAGATGTGCCACTCTG
COL1A1‐R CTCCAAACCAGACATGCTTC
Dnmt1‐F CCAGATACCTACCGGTTATTCG
Dnmt1‐R TCCTTTAACTGCAGCTGAGGC
β‐Actin_F CCCATCTATGAGGGTTACGC
β‐Actin_R TTTAATGTCACGCACGATTTC
Open in a new tab

Abbreviation: qRT‐PCR, quantitative real‐time polymerase chain reaction.

2.7. Methylation‐Specific PCR (MSP)

DNA was extracted using the phenol/chloroform method, and 2 μg of DNA was treated with sodium bisulfite. A DNA purification kit was used for purification. The SOCS3 promoter region‐specific methylation PCR primer sequences were 5′‐TTGGTGGTGAACGTCGTGC‐3′ (methylation upstream primer) and 5′‐CCCCCTCGCACTAAATACGT‐3′ (methylation downstream primer). The SOCS3 promoter region methylation PCR primer specificity of the sequence was 5′‐ AGTTGGTGGTGAATGTTGTGT‐3′ (unmethylated upstream primer) and 5′‐CAAACTCTAAAAACTCACTACAACTCCA‐3′ (unmethylated downstream primer). The PCR reaction conditions were as follows: predenaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles. Approximately 5 μL of PCR amplification products were detected by electrophoresis on a 1% agarose gel.

2.8. Statistical Analyses

All data were presented as means ± standard errors. Differences between groups were assessed by one‐way analysis of variance with Tukey's test for pairwise multiple comparisons to compare gene expression in each group. A probability value of p < 0.05 was regarded as statistically significant. GraphPad Prism version 7 (GraphPad Software Inc., CA, USA) was used for statistical analyses and graphing.

3. Results

3.1. Both TGF‐β1 and DNMT1 Affect the Phenotypeon of VFF

To clarify the progressive regulatory relationship, we first compared phenotypic differences between control and injured VFFs, and then examined the effects of exogenous TGF‐β1 stimulation. The expression of TGF‐β1 was significantly increased in the Injured group compared with the Control group (Figure 1A). After injury and exogenous TGF‐β1 stimulation, the protein and mRNA expression of COL1 and α‐SMA were significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups compared to the Control group; the expression of TGF‐β1 in the Control+TGF‐β1 and Injured+TGF‐β1 groups was higher than that in the Injured group (Figures 1, 2, 3, 4).

Figure 1.

Figure 1

Open in a new tab

Immunohistochemical detection of TGF‐β1, collagen Type I, α‐SMA, DNMT1, and SOCS3. Bar: 50 μm. *p < 0.05; **p < 0.01. These results show the initial phenotypic and molecular changes at the starting point of the TGF‐β1‐centered regulatory axis in vocal fold injury. (A) Compared with the Control group, TGF‐β1 expression in the Injured group was significantly increased (p = 0.0016). (B) Compared with the Control group, the expression of Type I collagen in the Injured group was significantly increased (p = 0.0129). (C) Compared with the Control group, α‐SMA expression was increased in the Injured group (p = 0.0628). (D) Compared with the Control group, the expression of DNMT1 in the Injured group was significantly increased (p = 0.0165). (E) Compared with the Control group, SOCS3 expression in the Injured group was significantly decreased (p = 0.0129).

Figure 2.

Figure 2

Open in a new tab

Cellular immunofluorescence detection of collagen Type I (COL1). Blue: DAPI (nuclear staining); green: COL1. Bar: 50 μm. ***p < 0.001; ****p < 0.0001. This figure reflects the progressive activation phenotype of vocal fold fibroblasts along the molecular regulatory cascade. Compared with the Control group, the expression of Type I collagen was increased in the Injured, Control+TGF‐β1 and Injured+TGF‐β1 groups (p = 0.0001, p = 0.0001, p = 0.0001). The expression of COL1 in the Control+TGF‐β1 and Injured+TGF‐β1 groups was significantly higher than that in the Injured group (p = 0.0001, p = 0.0001), with no significant difference between the two TGF‐β1‐treated groups (p = 0.1630). After adding 5‐aza, there was no significant change in the Control+5‐aza group (p = 0.1328), while COL1 expression in the Injured+5‐aza, Control+TGF‐β1 + 5‐aza, and Injured+TGF‐β1 + 5‐aza groups was significantly decreased compared with that before 5‐aza addition (p = 0.0001, p = 0.0001, p = 0.0001). The Injured+5‐aza and Control+TGF‐β1 + 5‐aza groups were basically consistent with the Control group (p = 0.2350, p = 0.9999), while the Injured+TGF‐β1 + 5‐aza group was still higher than the Control group (p = 0.0001).

Figure 3.

Figure 3

Open in a new tab

Cellular immunofluorescence detection of α‐SMA. Blue: DAPI (nuclear staining); green: α‐SMA. Bar: 50 μm. **p < 0.01; ****p < 0.0001. These data further verify the enhanced activation of VFFs induced by injury and TGF‑β1 in the mechanistic axis. Compared with the Control group, the expression of α‐SMA was significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups (p = 0.0001, p = 0.0001, p = 0.0001). The expression of α‐SMA in the Control+TGF‐β1 and Injured+TGF‐β1 groups was significantly higher than that in the Injured group (p = 0.0001, p = 0.0001), with no significant difference between the two TGF‐β1‐treated groups (p = 0.1209). After the addition of 5‐aza, the Control+5‐aza group had no significant change in α‐SMA expression (p = 0.9744), while the expression in the Injured+5‐aza, Control+TGF‐β1 + 5‐aza, and Injured+TGF‐β1 + 5‐aza groups was significantly decreased compared with that before 5‐aza addition (p = 0.0001, p = 0.0001, p = 0.0001). The Injured+TGF‐β1 + 5‐aza group was higher than the Control+TGF‐β1 + 5‐aza and Injured+5‐aza groups (p = 0.0127, p = 0.05).

Figure 4.

Figure 4

Open in a new tab

QRT‐PCR detection of mRNA levels of COL‐1, α‐SMA, DNMT1, JAK2 and STAT3. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. This panel presents the key molecular events in the TGF‑β1–DNMT1–SOCS3–JAK2/STAT3 signaling axis. (A) COL1 mRNA levels were increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups compared with the Control group (p = 0.0001, p = 0.0001, p = 0.0001). The Injured+TGF‐β1 and Control+TGF‐β1 groups had higher COL1 mRNA levels than the Injured group (p = 0.0121, p = 0.0253). After adding 5‐aza, the COL1 mRNA level in the Control+5‐aza group was decreased (p = 0.0080), while the Injured+5‐aza, Control+TGF‐β1 + 5‐aza, and Injured+TGF‐β1 + 5‐aza groups showed a significant decrease (p = 0.0001, p = 0.0001, p = 0.0001). The Injured+5‐aza group was basically consistent with the Control group (p = 0.9994). (B) Compared with the Control group, α‐SMA mRNA levels were increased in the Injured, Control+TGF‐β1 and Injured+TGF‐β1 groups (p = 0.0003, p = 0.0001, p = 0.0001). The Control+TGF‐β1 and Injured+TGF‐β1 groups had higher α‐SMA mRNA levels than the Injured group (p = 0.0003, p = 0.0001), with no significant difference between the two (p = 0.2808). After adding 5‐aza, the Control+5‐aza group had no significant change (p = 0.6763), while the other three groups showed a significant decrease (p = 0.0003, p = 0.0001, p = 0.0001). The Injured+5‐aza group was consistent with the Control group (p = 0.9999). (C) Compared with the Control group, DNMT1 mRNA levels were significantly increased in the Injured, Control+TGF‐β1 and Injured+TGF‐β1 groups (p = 0.0335, p = 0.0001, p = 0.0001), with a significant positive correlation between TGF‐β1 level and DNMT1 mRNA expression. The Control+TGF‐β1 and Injured+TGF‐β1 groups had higher DNMT1 mRNA levels than the Injured group (p = 0.0001, p = 0.0001), and the Injured+TGF‐β1 group was slightly higher than the Control+TGF‐β1 group (p = 0.0353). After adding 5‐aza, the Control+5‐aza group had no significant change (p = 0.8906), while the other three groups showed a decrease (p = 0.0510, p = 0.0011, p = 0.0001). (D) Compared with the Control group, SOCS3 mRNA levels were significantly decreased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups (p = 0.0001, p = 0.0001, p = 0.0001), with no significant difference among the three groups (p = 0.6992, p = 0.9999, p = 0.7652). After adding 5‐aza, the Control+5‐aza group had a significant decrease (p = 0.0001), while the other three groups showed a significant increase (p = 0.0001, p = 0.0001, p = 0.0004) but were still lower than the Control group (p = 0.0001, p = 0.0200, p = 0.0001). (E) Compared with the Control group, JAK2 mRNA levels were significantly increased in the Injured, Control+TGF‐β1 and Injured+TGF‐β1 groups (p = 0.0004, p = 0.0001, p = 0.0008). The Control+TGF‐β1 group was higher than the Injured and Injured+TGF‐β1 groups (p = 0.0268, p = 0.0144), with no significant difference between the latter two (p = 0.9999). After adding 5‐aza, the Control+5‐aza group had no significant change (p = 0.9995), while the other three groups showed a significant decrease (p = 0.0091, p = 0.0001, p = 0.0111), with no significant difference among them (p = 0.7575, p = 0.9999, p = 0.6336). (F) Compared with the Control group, STAT3 mRNA levels were significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups (p = 0.0010, p = 0.0001, p < 0.0001). The Injured+TGF‐β1 and Control+TGF‐β1 groups were higher than the Injured group (p = 0.1145, p = 0.1798). After adding 5‐aza, the Control+5‐aza group had no significant change (p = 0.9941), while the other three groups showed a significant decrease (p = 0.0001, p = 0.0001, p = 0.0001) and were consistent with the Control group (p = 0.7678, p = 0.9312, p = 0.5050). Note: 5‐aza induces mild but significant SOCS3 mRNA reduction in normal Control VFFs (Control+5‐aza), which results from disrupted physiological basal methylation homeostasis of the SOCS3 promoter and does not induce fibrotic phenotypic alterations. In contrast, 5‐aza significantly restores SOCS3 transcription in pathologically activated VFFs with severe SOCS3 promoter hypermethylation.

The protein and mRNA expression of DNMT1 were significantly upregulated in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups compared to the Control group, with a significant positive correlation between TGF‐β1 and DNMT1 expression (p <0.01). The mRNA levels of DNMT1 in the Control+TGF‐β1 and Injured+TGF‐β1 groups were significantly higher than those in the Injured group, with no significant differences observed between the Control+TGF‐β1 and Injured+TGF‐β1 groups (Figures 1D, 4C, and 5A). Combined with previous studies demonstrating that TGF‐β1 directly modulates DNMT1 activity in fibrotic models [21, 25]. These results confirmed that both vocal fold injury and TGF‐β1 contribute to VFFs activation in a progressive manner. These results suggest a putative positive regulatory causal relationship between TGF‐β1 and DNMT1 in VFFs. Consistent with the upregulated endogenous TGF‐β1 detected in injured vocal fold tissue (Figure 1A), exogenous TGF‐β1 stimulation alone fully recapitulated all fibrotic molecular alterations observed in injured VFFs. Moreover, the Injured+TGF‐β1 group exhibited aggravated fibrotic signatures compared with the single Injured group, indicating that endogenous TGF‐β1 produced by injured fibroblasts forms a positive feedback loop with exogenous TGF‐β1 to amplify pathological activation, indirectly supporting the essential pro‐fibrotic function of injury‐derived endogenous TGF‐β1.

Figure 5.

Figure 5

Open in a new tab

WB (Western blot) detection of protein levels of DNMT1, SOCS3, JAK2 and STAT3. *p < 0.05; **p < 0.01; ***p < 0.001; **** p < 0.001. These results demonstrate the complete regulatory cascade in a stepwise manner. (A) Compared with the Control group, DNMT1 protein expression was significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups (p = 0.0001, p = 0.0001, p = 0.0001). The Control+TGF‐β1 and Injured+TGF‐β1 groups were higher than the Injured group (p = 0.1022, p = 0.0001). After adding 5‐aza, DNMT1 protein levels were decreased in all groups (p = 0.0178, p = 0.0001, p = 0.0001, p = 0.0001), with the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups still higher than the Control group, and no significant difference among the three (p = 0.3908, p = 0.3477, p = 0.9999). (B) Compared with the Control group, SOCS3 protein expression was significantly decreased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups (p = 0.0003, p = 0.0001, p = 0.0001), with no significant difference among the three (p = 0.0604, p = 0.9993, p = 0.1538). After adding 5‐aza, the Control+5‐aza group had a decreased SOCS3 expression (p = 0.0023), while the Injured+5‐aza, Control+TGF‐β1 + 5‐aza, and Injured+TGF‐β1 + 5‐aza groups showed a significant increase (p = 0.0001, p = 0.0001, p = 0.0001) and were higher than the Control group. The Control+TGF‐β1 + 5‐aza and Injured+TGF‐β1 + 5‐aza groups were lower than the Injured+5‐aza group (p = 0.0001, p = 0.0027). (C) Compared with the Control group, JAK2 protein expression was significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups (p = 0.0002, p = 0.0001, p = 0.0001). The Injured+TGF‐β1 and Control+TGF‐β1 groups were higher than the Injured group (p = 0.0002, p = 0.0001). After adding 5‐aza, the Control+5‐aza group had no significant change (p = 0.9948), while the other three groups showed a significant decrease (p = 0.0603, p = 0.0294, p = 0.001). The Control+TGF‐β1 + 5‐aza group was higher than the Injured+5‐aza and Injured+TGF‐β1 + 5‐aza groups (p = 0.0004, p = 0.0030), with no significant difference between the latter two (p = 0.9654). (D) Compared with the Control group, STAT3 protein expression was increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups (p = 0.0212, p = 0.0001, p = 0.0001). The Control+TGF‐β1 and Injured+TGF‐β1 groups were higher than the Injured group (p = 0.0001, p = 0.0001), with no significant difference between the two (p = 0.7771). After adding 5‐aza, the Control+5‐aza, Injured+5‐aza, Control+TGF‐β1 + 5‐aza, and Injured+TGF‐β1 + 5‐aza groups all showed a decrease compared with before addition (p = 0.0002, p = 0.0043, p = 0.0010, p = 0.0004), with the Control+TGF‐β1 + 5‐aza and Injured+TGF‐β1 + 5‐aza groups still higher than the Control group (p = 0.0001, p = 0.0001).

To investigate the role of methylation in VFFs activation, DNMT1 protein levels were inhibited by 5‐aza, a methyltransferase inhibitor that exerts its effect via covalent trapping and degradation of DNMT1 [26]. After the addition of 5‐aza, the DNMT1 protein and mRNA levels in the Control group were not significantly changed, whereas those in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups were significantly decreased. No significant differences were observed between the Control+TGF‐β1 and Injured+TGF‐β1 groups, but both groups showed a higher DNMT1 expression than the Injured group before 5‐aza treatment. These results indicated that 5‐aza effectively reduced DNMT1 protein levels in activated VFFs (Figures 4C and 5A). Concurrently, the COL1 and α‐SMA protein levels in the Control group were not significantly changed after 5‐aza treatment; in contrast, the protein and mRNA expression levels in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups were significantly decreased compared to the pretreatment values, with the downregulation of DNMT1 positively correlated with the reduction of fibrotic markers (p < 0.001). These data demonstrate that 5‐aza does not alter the resting fibrotic phenotype of normal VFFs despite minor fluctuations in basal SOCS3 transcription. These results suggest that the activation phenotype of fibroblasts was significantly inhibited after methylation inhibition (Figures 2, 3, 4).

3.2. TGF‐β1 Is Speculated to Regulate SOCS3 Expression by Inducing Promoter Methylation

Based on the above phenotypic changes, we further explored the epigenetic regulation of SOCS3 by DNA methylation. To investigate the role of SOCS3 in VFFs activation, we first detected SOCS3 expression across Control, Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups. SOCS3 mRNA and protein were markedly reduced in all three activated groups with no obvious intergroup differences (Figures 1E, 4D, and 5B). Notably, 5‐aza exerted distinct effects on resting and activated VFFs. In normal Control VFFs, 5‐aza did not alter COL1 and α‐SMA levels, indicating no fibrotic transformation. However, SOCS3 mRNA was slightly reduced in the Control+5‐aza group (p = 0.0001). Physiologically, the SOCS3 promoter carries mild basal methylation to maintain cytokine homeostasis; broad‐spectrum demethylation by 5‐aza disturbs this balance and slightly suppresses basal SOCS3 transcription. This mild decline fails to activate JAK2/STAT3 or collagen production, so VFFs remain quiescent. By contrast, Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups showed severe SOCS3 hypermethylation induced by elevated DNMT1. 5‐Aza markedly relieved this hypermethylation and restored SOCS3 transcription, yet SOCS3 levels in these groups were still significantly lower than those of untreated Control VFFs (p < 0.05).

MSP revealed that the SOCS3 promoter was not significantly methylated in the Control group, while the methylation levels of the SOCS3 promoter in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups were significantly higher than those of the Control group (Figure 6). After the addition of 5‐aza, the methylation levels of SOCS3 in the three groups decreased significantly, and concomitantly, SOCS3 mRNA and protein expression were markedly upregulated (p < 0.001), which is consistent with the basic principle that DNA demethylation promotes gene transcription. These results suggest that injury and TGF‐β1 stimulation may inhibit SOCS3 expression by inducing SOCS3 promoter methylation.

Figure 6.

Figure 6

Open in a new tab

MSP (methylation‐specific PCR) detection of methylation changes of the SOCS3 promoter. Groups: Control, Injured, Control+TGF‐β1, Injured+TGF‐β1 (untreated); Control+5‐aza, Injured+5‐aza, Control+TGF‐β1 + 5‐aza, Injured+TGF‐β1 + 5‐aza (5‐aza treated). M: methylated; U: unmethylated. This figure reveals the critical epigenetic regulatory node in the TGF‑β1–DNMT1–SOCS3 axis. No significant methylation of the SOCS3 promoter was observed in the Control group. The methylation levels of the SOCS3 promoter in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups were significantly higher than those in the Control group. After the addition of 5‐aza, the methylation level of the SOCS3 promoter was significantly decreased in the Injured+5‐aza, Control+TGF‐β1 + 5‐aza, and Injured+TGF‐β1 + 5‐aza groups, while there was no significant change in the Control+5‐aza group.

Western blot and qRT‐PCR revealed that SOCS3 protein and mRNA levels were significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups after the addition of 5‐aza. The Control+TGF‐β1 group did not significantly differ from the Injured+TGF‐β1 group, both of which had higher SOCS3 protein and mRNA levels than the Injured group (Figures 4D and 5B). These results indicate that the inhibition of methylation could reverse the SOCS3 methylation process induced by injury and TGF‐β1 stimulation, and thus restore SOCS3 expression. This stepwise analysis revealed that promoter hypermethylation is responsible for SOCS3 downregulation in activated VFFs.

3.3. TGF‐β1‐induced Methylation Is Proposed to Regulate SOCS3 Expression Through the JAK2/STAT3 Pathway in Abnormal VFFs Activation

Finally, we investigated the downstream JAK2/STAT3 signaling pathway to complete the regulatory axis. Our previous studies had showed that injury and TGF‐β1 stimulation may activate the JAK2/STAT3 signaling pathway and promote abnormal fibrosis via VFFs. To investigate the role of SOCS3, we compared the expression levels of JAK2 and STAT3 in the Control, Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups. A clear molecular cascade was observed in activated VFFs: the protein and mRNA levels of JAK2 and STAT3, as well as their phosphorylation levels, were significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups, and this activation was closely associated with SOCS3 downregulation (p < 0.001). After the addition of 5‐aza, the expression and phosphorylation of JAK2 and STAT3 were significantly decreased, and this inhibition was synchronized with the restoration of SOCS3 expression and the reversal of VFFs fibrotic phenotype (p < 0.001). These results suggest that TGF‐β1 may inhibit SOCS3 expression through methylation, thereby relieving the inhibitory effect of SOCS3 on JAK2/STAT3 and activating the signaling pathway, which is speculated to participate in the abnormal activation of VFFs (Figures 4E,F and 5C,D). This regulatory pattern is consistent with the classic relationship that SOCS3 is a key negative feedback inhibitor of JAK2/STAT3 signaling [9, 10]. Taken together, these sequential results demonstrate the complete regulatory cascade in a logical order.

4. Discussion

In tissue and organ fibrosis, TGF‐β1 is considered the core mediator that stimulates fibroblast activation. It can play a role in promoting fibrosis in the lungs, liver, kidneys, skin, and other organs [4, 8, 9, 10, 14]. The expression of TGF‐β1 is significantly increased after vocal fold injury [24], accompanied by active fibroblast proliferation and disordered deposition of collagen‐based extracellular matrix [2, 3]. The addition of exogenous TGF‐β1 also leads to the activation of fibroblasts and enhanced secretion of Type I collagen [27]. In our study, increased expression of COL1 and α‐SMA was observed in Control VFFs after the addition of exogenous TGF‐β1 and in Injured VFFs, with concurrent transformation of fibroblasts into myofibroblasts. These results suggest that TGF‐β1 plays a key role in the progression of fibrosis after vocal‐fold injury, although the specific molecular mechanism by which TGF‐β1 activates VFFs remains to be fully elucidated.

In this study, the expression of DNMT1 protein and mRNA was significantly increased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups compared to the Control group, with a significant positive correlation between TGF‐β1 and DNMT1 expression. Consistent with the findings in pulmonary and renal fibrosis [21, 25], these results support that TGF‐β1 is a putative upstream regulator of DNMT1 in VFFs abnormal activation. Recent studies of fibrosis in other tissues and organs have confirmed this process. In 2014, Watson et al. [28] found that targeted inhibitors of DNMT or siRNA could effectively inhibit the occurrence and development of fibrosis in the study of cardiac fibroblasts. In 2015, Neveu et al. [25] found that TGF‐β1 induced methylation of the thymocyte differentiation antigen 1 promoter in lung fibroblasts. However, the DNMT inhibitor 5‐AZA significantly downregulated the expression of fibrotic genes α‐SMA and COL‐1 and prevented collagen deposition. In 2019, Xue et al. [21] found that TGF‐β1 epigenetically regulates the expression of DNA methyltransferase, changes the methylation level of downstream genes, and regulates the activation of kidney fibroblasts. In a 2020 study on skin fibrosis, Dees et al. [10] found that the activation phenotype of skin fibroblasts could be reversed, and skin fibrosis could be reduced in mice by inhibiting the TGF‐β1‐induced methylation process. In 2024, Liang et al. [29] reported that inhibition of DNMT expression can reverse liver fibrosis caused by metabolic‐associated fatty liver disease. In line with our experimental design, multiple classic epigenetic fibrosis studies first constructed signaling axes via exogenous TGF‐β1 gain‐of‐function cell culture assays, and then separately performed TGF‐β1 neutralizing antibody/inhibitor loss‐of‐function validation either in follow‐up in vitro tests or in subsequent independent in vivo animal work [9, 10]. Gain‐of‐function cytokine stimulation is a standard preliminary strategy to verify whether TGF‐β1 is sufficient to drive fibrotic phenotypes in early mechanistic exploration. Furthermore, in our study, after the addition of 5‐aza, which reduces DNMT1 protein levels via covalent trapping and degradation, the expression of COL1 and α‐SMA was significantly downregulated in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups. The downregulation of DNMT1 was positively correlated with the reduction of fibrotic markers, and 5‐aza did not significantly alter normal VFFs, suggesting that the anti‐fibrotic effect of 5‐aza in VFFs is primarily mediated by DNMT1 degradation, rather than non‐specific global demethylation. These results collectively suggest that TGF‐β1 may induce the activation of VFFs and vocal‐fold fibrosis by inducing DNMT1‐mediated methylation.

SOCS3, a negative regulator of cell signal transduction, has received increasing attention in fibrosis‐related diseases. In 2019, Qin et al. [16] showed that SOCS3 could inhibit the development of post‐pancreatitis rats. Moreover, pulmonary fibrosis plays a reparative role. In 2020, Zhang et al. [30] showed that specific small RNA‐targeted inhibition of SOCS could promote the progression of renal fibrosis in mice. Concurrently, a 2020 study by Dees et al. [10] showed that SOCS3 is directly regulated by TGF‐β1. In 2021, Tao et al. [9] reported that the downregulation of SOCS3 promotes the activation of cardiac fibroblasts and collagen deposition, resulting in diabetic myocardial fibrosis. In 2022, Li et al. [31] reported that SOCS3 can improve hypoxia‐induced bladder fibrosis and downregulate fibrosis‐related factors, such as TGF‐β1. In 2024, Tian et al. [32] reported that the upregulation of SOCS3 can effectively alleviate bleomycin‐induced pulmonary and cutaneous fibrosis in mice. In this study, the SOCS3 protein and mRNA levels were significantly decreased in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups compared to the Control group, indicating that TGF‐β1 may directly inhibit the expression of SOCS3. No overt methylation of the SOCS3 promoter was observed in the control group, whereas the methylation level of SOCS3 in the other three groups was significantly increased. When 5‐aza was added, the methylation level of SOCS3 decreased significantly in all the three groups, and concomitantly, SOCS3 expression was markedly upregulated. These results suggest that injury and TGF‐β1 stimulation may inhibit SOCS3 expression by inducing the methylation of the SOCS3 promoter, and the inhibition of methylation can reverse this process and restore SOCS3 expression.

The expression of COL1 and α‐SMA decreased after the addition of 5‐aza, indicating that TGF‐β1 may inhibit the expression of SOCS3 through methylation, thereby activating the VFFs and promoting the progression of vocal‐fold fibrosis. Additionally, the expression of DNMT1 did not change significantly after the addition of 5‐aza in the Control group, indicating that 5‐aza may not significantly affect normal methylation processes while inhibiting abnormal methylation in activated VFFs, which may establish a reference value for future interventions in the abnormal activation of fibroblasts after vocal‐fold injury.

SOCS3 is a key regulator of the JAK2/STAT3 signaling pathway, and as a non‐competitive inhibitor of JAK, it can also induce the degradation of JAK and related cytokine receptors. JAK2/STAT3 is activated by TGF‐β1 and acts on the fibrosis of tissues and organs, whereas the inhibition of JAK2 or STAT3 can improve the activation of fibroblasts and abnormal fibrosis [33, 34, 35, 36, 37]. In this study, the JAK2/STAT3 and phosphorylation levels in the Injured, Control+TGF‐β1, and Injured+TGF‐β1 groups were increased, and the expression of SOCS3 was decreased, indicating that the JAK2/STAT3 signaling pathway may be abnormally activated in the early stage of vocal‐fold injury and under the action of TGF‐β1. After the addition of 5‐aza, the activation of JAK2/STAT3 was significantly inhibited, which was synchronized with the restoration of SOCS3 expression. Although rescue experiments are lacking, the synchronous and interdependent changes of each node in the molecular cascade strongly support the proposed regulatory hierarchy of the TGF‐β1‐methylation–SOCS3–JAK2/STAT3 axis. This axis is consistent with the classic regulatory relationship of the JAK2/STAT3 pathway, further confirming the rationality of our speculation.

Herein, we have reported the putative mechanism by which TGF‐β1 activation regulates SOCS3 through methylation after vocal‐fold injury, thereby activating the JAK2/STAT3 signaling pathway and inducing abnormal activation of VFFs. This provides a reference for exploring the process underlying abnormal fibrosis after vocal‐fold injury and its potential interventions. A limitation of this study is that we did not explore the changes in JAK2/STAT3 expression when SOCS3 alone is changed. After TGF‐β1 regulates SOCS3 through methylation, whether SOCS3 induces fibroblast activation through JAK2/STAT3 requires further investigation.

5. Study Limitations

This study has several limitations that should be acknowledged. First, direct experimental evidence from targeted genetic interventions (e.g., TGF‐β1 neutralization, DNMT1 silencing, or SOCS3 overexpression/knockdown) is lacking, and the putative causal relationships and regulatory hierarchy of the TGF‐β1‐methylation–SOCS3–JAK2/STAT3 axis are deduced primarily from expression correlations and alignment with field‐wide mechanistic consensus, rather than direct experimental validation. Second, 5‐aza is a broad‐spectrum DNA methyltransferase inhibitor, and although its pathology‐specific effect on activated VFFs was observed in this study, the potential non‐specific effects of global demethylation cannot be completely excluded without DNMT1‐specific silencing experiments. Third, this study was conducted solely in in vitro VFFs cultures, and in vivo animal experiments are needed to verify the clinical relevance and physiological significance of the proposed regulatory axis. Future studies will address these limitations by performing targeted genetic intervention experiments and in vivo validation to further confirm the causal relationships of the molecular events identified in this study. Fourth, while injured VFFs maintained activated phenotypes during passages 2–4 in our experiments, gradual phenotypic normalization during prolonged culture cannot be completely excluded. Fifth, the present study did not include a TGF‐β1 inhibition or knockdown group in injured VFFs, which could provide more direct causal evidence. Future studies will add TGF‐β1 neutralizing antibody or siRNA intervention to further verify the upstream regulatory role of TGF‐β1. Sixth, this study lacks an Injured VFFs+TGF‐β1 inhibitor/neutralizing antibody loss‐of‐function group, which cannot directly confirm the necessity of endogenous TGF‐β1 for fibrotic transformation. Follow‐up work will supplement this intervention to further validate TGF‐β1's upstream role.

6. Conclusion

Vocal‐fold injury can activate TGF‐β1 expression. Based on the synchronous molecular changes and alignment with classic signaling pathways, we speculate that TGF‐β1 downregulates SOCS3 expression via DNMT1‐mediated promoter DNA methylation, thereby relieving the inhibitory effect of SOCS3 on the JAK2/STAT3 signaling pathway and activating the pathway. This regulatory process is proposed to participate in the abnormal activation of fibroblasts after vocal‐fold injury, providing a potential epigenetic target for the intervention of vocal fold fibrosis.

Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection, and analysis were performed by An‐Qi Zhao, Hai‐Zhou Wang, and Xue‐Yan Li. The first draft of the manuscript was written by An‐Qi Zhao and Hai‐Zhou Wang. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Ethics Statement

The animal experiments in this study were performed in accordance with the regulations of the Peking University Animal Care and Use Committee (LSC‐ZhangY‐1) and license permit: 1116012800123.

Consent

The authors have nothing to report.

Conflicts of Interest

Professor Wen Xu is a member of World Journal of Otorhinolaryngology – Head & Neck Surgery (WJOHNS) editorial board and is not involved in the peer review process of this article. The other authors declare no conflicts of interest.

Acknowledgments

The authors are appreciative to Professor Yan Zhang (School of Life Sciences, Peking University) for her inspiring thoughts and helpful suggestions regarding the project and the manuscript. This work was supported by programs of the Beijing Natural Science Foundation (7252023).

Wang H.‐Z., Zhao A.‐Q., Li X.‐Y., Hu R., and Xu W., “TGF‐β1 Induced Methylation to Regulate SOCS3 Expression in Abnormal Activation of Vocal Fold Fibroblasts,” World Journal of Otorhinolaryngology ‐ Head and Neck Surgery 0 (2026): 1‐13, 10.1002/wjo2.70167.

Hai‐Zhou Wang and An‐Qi Zhao contributed equally to this work.

Data Availability Statement

Data available within the article.

References

  • 1. Tang S. S., Mohad V., Gowda M., and Thibeault S. L., “Insights Into the Role of Collagen in Vocal Fold Health and Disease,” Journal of Voice 31, no. 5 (2017): 520–527, 10.1016/j.jvoice.2017.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Hu R., Xu W., Ling W., Wang Q., Wu Y., and Han D., “Characterization of Extracellular Matrix Proteins During Wound Healing in the Lamina Propria of Vocal Fold in a Canine Model: A Long‐Term and Consecutive Study,” Acta Histochemica 116, no. 5 (2014): 730–735, 10.1016/j.acthis.2013.12.014. [DOI] [PubMed] [Google Scholar]
  • 3. Darby I. A., Zakuan N., Billet F., and Desmoulière A., “The Myofibroblast, a Key Cell in Normal and Pathological Tissue Repair,” Cellular and Molecular Life Sciences 73, no. 6 (2016): 1145–1157, 10.1007/s00018-015-2110-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Chakraborty D., Šumová B., Mallano T., et al., “Activation of STAT3 Integrates Common Profibrotic Pathways to Promote Fibroblast Activation and Tissue Fibrosis,” Nature Communications 8, no. 1 (2017): 1130, 10.1038/s41467-017-01236-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Guan R., Yuan L., Li J., et al., “Bone Morphogenetic Protein 4 Inhibits Pulmonary Fibrosis by Modulating Cellular Senescence and Mitophagy in Lung Fibroblasts,” European Respiratory Journal 60, no. 6 (2022): 2102307, 10.1183/13993003.02307-2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Bugg D., Bailey L. R. J., Bretherton R. C., et al., “MBNL1 Drives Dynamic Transitions Between Fibroblasts and Myofibroblasts in Cardiac Wound Healing,” Cell Stem Cell 29, no. 3 (2022): 419–433.e10, 10.1016/j.stem.2022.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. An Y., Ren Y., Wang J., et al., “MST1/2 in PDGFRα+ Cells Negatively Regulates TGF‐β‐induced Myofibroblast Accumulation in Renal Fibrosis,” American Journal of Physiology‐Renal Physiology 322, no. 5 (2022): F512–F526, 10.1152/ajprenal.00367.2021. [DOI] [PubMed] [Google Scholar]
  • 8. Meng X., Nikolic‐Paterson D. J., and Lan H. Y., “TGF‐β: The Master Regulator of Fibrosis,” Nature Reviews Nephrology 12, no. 6 (2016): 325–338, 10.1038/nrneph.2016.48. [DOI] [PubMed] [Google Scholar]
  • 9. Tao H., Shi P., Zhao X. D., Xuan H. Y., Gong W. H., and Ding X. S., “DNMT1 Deregulation of SOCS3 Axis Drives Cardiac Fibroblast Activation in Diabetic Cardiac Fibrosis,” Journal of Cellular Physiology 236, no. 5 (2021): 3481–3494, 10.1002/jcp.30078. [DOI] [PubMed] [Google Scholar]
  • 10. Dees C., Pötter S., Zhang Y., et al., “TGF‐β‐induced Epigenetic Deregulation of SOCS3 Facilitates STAT3 Signaling to Promote Fibrosis,” Journal of Clinical Investigation 130, no. 5 (2020): 2347–2363, 10.1172/JCI122462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Walraven M. and Hinz B., “Therapeutic Approaches to Control Tissue Repair and Fibrosis: Extracellular Matrix as a Game Changer,” Matrix Biology 71–72 (2018): 205–224, 10.1016/j.matbio.2018.02.020. [DOI] [PubMed] [Google Scholar]
  • 12. Chang Z., Kishimoto Y., Hasan A., and Welham N. V., “TGF‐β3 Modulates the Inflammatory Environment and Reduces Scar Formation Following Vocal Fold Mucosal Injury in Rats,” Disease Models & Mechanisms 7, no. 1 (2014): 83–91, 10.1242/dmm.013326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Branski R. C., Bing R., Kraja I., and Amin M. R., “The Role of Smad3 in the Fibrotic Phenotype in Human Vocal Fold Fibroblasts,” Laryngoscope 126, no. 5 (2016): 1151–1156, 10.1002/lary.25673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Zhang X., Zhang X., Ge X., and Liu M., “Mangiferin Prevents Hepatocyte Epithelial‐Mesenchymal Transition in Liver Fibrosis via Targeting HSP27‐mediated JAK2/STAT3 and TGF‐β1/Smad Pathway,” Phytotherapy Research 36, no. 11 (2022): 4167–4182, 10.1002/ptr.7549. [DOI] [PubMed] [Google Scholar]
  • 15. Tieyuan Z., Ying Z., Xinghua Z., Huimin W., and Huagang L., “Piceatannol‐Mediated JAK2/STAT3 Signaling Pathway Inhibition Contributes to the Alleviation of Oxidative Injury and Collagen Synthesis During Pulmonary Fibrosis,” International Immunopharmacology 111 (2022): 109107, 10.1016/j.intimp.2022.109107. [DOI] [PubMed] [Google Scholar]
  • 16. Qin M. Z., Qin M. B., Liang Z. H., and Tang G. D., “Effect of SOCS3 on Lung Injury in Rats With Severe Acute Pancreatitis Through Regulating JAK2/STAT3 Signaling Pathway,” European Review for Medical and Pharmacological Sciences 23, no. 22 (2019): 10123–10131, 10.26355/eurrev_201911_19582. [DOI] [PubMed] [Google Scholar]
  • 17. Xu Y., Zhang D., Yang H., et al., “Hepatoprotective Effect of Genistein Against Dimethylnitrosamine‐Induced Liver Fibrosis in Rats by Regulating Macrophage Functional Properties and Inhibiting the JAK2/STAT3/SOCS3 Signaling Pathway,” Frontiers in Bioscience‐Landmark 26, no. 12 (2021): 1572–1584, 10.52586/5050. [DOI] [PubMed] [Google Scholar]
  • 18. Yang L., Liu Y., Sun Y., Huang C., Li J., and Wang Y., “New Advances of DNA/RNA Methylation Modification in Liver Fibrosis,” Cellular Signalling 92 (2022): 110224, 10.1016/j.cellsig.2021.110224. [DOI] [PubMed] [Google Scholar]
  • 19. Xue T., Qiu X., Liu H., et al., “Epigenetic Regulation in Fibrosis Progress,” Pharmacological Research 173 (2021): 105910, 10.1016/j.phrs.2021.105910. [DOI] [PubMed] [Google Scholar]
  • 20. Weiskirchen R., Weiskirchen S., and Tacke F., “Organ and Tissue Fibrosis: Molecular Signals, Cellular Mechanisms and Translational Implications,” Molecular Aspects of Medicine 65 (2019): 2–15, 10.1016/j.mam.2018.06.003. [DOI] [PubMed] [Google Scholar]
  • 21. Xue R., Li Y., Li X., Ma J., An C., and Ma Z., “miR‐185 Affected the EMT, Cell Viability, and Proliferation via DNMT1/MEG3 Pathway in TGF‐β1‐induced Renal Fibrosis,” Cell Biology International 43, no. 10 (2019): 1152–1162, 10.1002/cbin.11046. [DOI] [PubMed] [Google Scholar]
  • 22. Pan X., You H., Wang L., et al., “Methylation of RCAN1.4 Mediated by DNMT1 and DNMT3b Enhances Hepatic Stellate Cell Activation and Liver Fibrogenesis Through Calcineurin/NFAT3 Signaling,” Theranostics 9, no. 15 (2019): 4308–4323, 10.7150/thno.32710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Li X., Wang H., and Xu W., “HGF and bFGF Secreted by Adipose‐Derived Mesenchymal Stem Cells Revert the Fibroblast Phenotype Caused by Vocal Fold Injury in a Rat Model,” Journal of Voice 36, no. 5 (2022): 622–629, 10.1016/j.jvoice.2020.08.023. [DOI] [PubMed] [Google Scholar]
  • 24. Wang H., Li X., Lu J., Jones P., and Xu W., “Prolactin May Serve as a Regulator to Promote Vocal Fold Wound Healing,” Bioscience Reports 40, no. 7 (2020): BSR20200467, 10.1042/BSR20200467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Neveu W. A., Mills S. T., Staitieh B. S., and Sueblinvong V., “TGF‐β1 Epigenetically Modifies Thy‐1 Expression in Primary Lung Fibroblasts,” American Journal of Physiology‐Cell Physiology 309, no. 9 (2015): C616–C626, 10.1152/ajpcell.00086.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Ghoshal K., Datta J., Majumder S., et al., “5‐Aza‐Deoxycytidine Induces Selective Degradation of DNA Methyltransferase 1 by a Proteasomal Pathway That Requires the KEN Box, Bromo‐Adjacent Homology Domain, and Nuclear Localization Signal,” Molecular and Cellular Biology 25, no. 11 (2005): 4727–4741, 10.1128/MCB.25.11.4727-4741.2005. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 27. Li J., Liu Y., Wang Y., and Xu W., “Expression of Tenascin‐C in a Rat Vocal Fold Injury Model and Its Regulation of Fibroblasts,” The Laryngoscope 128, no. 9 (2018): E316–E322, 10.1002/lary.27164. [DOI] [PubMed] [Google Scholar]
  • 28. Watson C. J., Collier P., Tea I., et al., “Hypoxia‐Induced Epigenetic Modifications Are Associated With Cardiac Tissue Fibrosis and the Development of a Myofibroblast‐Like Phenotype,” Human Molecular Genetics 23, no. 8 (2014): 2176–2188, 10.1093/hmg/ddt614. [DOI] [PubMed] [Google Scholar]
  • 29. Liang Y., Jiang X., Zhao X., et al., “Vitamin D Alleviates HFD‐Induced Hepatic Fibrosis by Inhibiting DNMT1 to Affect the TGFβ1/Smad3 Pathway,” iScience 27, no. 12 (2024): 111262, 10.1016/j.isci.2024.111262. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 30. Zhang W., Li X., Tang Y., Chen C., Jing R., and Liu T., “miR‐155‐5p Implicates in the Pathogenesis of Renal Fibrosis via Targeting SOCS1 and SOCS6,” Oxidative Medicine and Cellular Longevity 2020 (2020): 6263921, 10.1155/2020/6263921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Li T., Xing Y., Zhang G., et al., “Circular RNA Plasmacytoma Variant Translocation 1 (CircPVT1) Knockdown Ameliorates Hypoxia‐Induced Bladder Fibrosis by Regulating the miR‐203/Suppressor of Cytokine Signaling 3 (SOCS3) Signaling Axis,” Bioengineered 13, no. 1 (2022): 1288–1303, 10.1080/21655979.2021.2001221. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 32. Tian N., Cheng H., Du Y., et al., “Cannabinoid Receptor 2 Selective Agonist Alleviates Systemic Sclerosis by Inhibiting Th2 Differentiation Through JAK/SOCS3 Signaling,” Journal of Autoimmunity 147 (2024): 103233, 10.1016/j.jaut.2024.103233. [DOI] [PubMed] [Google Scholar]
  • 33. Yang Y., Zhao X., Xu H., et al., “Magnesium Isoglycyrrhizinate Ameliorates High Fructose‐Induced Liver Fibrosis in Rat by Increasing miR‐375‐3p to Suppress JAK2/STAT3 Pathway and TGF‐β1/Smad Signaling,” Acta Pharmacologica Sinica 40, no. 7 (2019): 879–894, 10.1038/s41401-018-0194-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. You X., Jiang X., Zhang C., et al., “Dihydroartemisinin Attenuates Pulmonary Inflammation and Fibrosis in Rats by Suppressing JAK2/STAT3 Signaling,” Aging 14, no. 3 (2022): 1110–1127, 10.18632/aging.203874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Chakraborty K., Chatterjee S., and Bhattacharyya A., “Modulation of CD11c+ Lung Dendritic Cells in Respect to TGF‐β in Experimental Pulmonary Fibrosis,” Cell Biology International 41, no. 9 (2017): 991–1000, 10.1002/cbin.10800. [DOI] [PubMed] [Google Scholar]
  • 36. Jin C., Jiang P., Zhang Z., et al., “Single‐Cell Rna Sequencing Reveals the Pro‐Inflammatory Roles of Liver‐Resident Th1‐like Cells in Primary Biliary Cholangitis,” Nature Communications 15, no. 1 (2024): 8690, 10.1038/s41467-024-53104-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Loscocco G. G. and Guglielmelli P., “Targeted Therapies in Myelofibrosis: Present Landscape, Ongoing Studies, and Future Perspectives,” supplement, American Journal of Hematology 100, no. S4 (2025): 30–50, 10.1002/ajh.27658. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data available within the article.

Articles from World Journal of Otorhinolaryngology - Head and Neck Surgery are provided here courtesy of Chinese Medical Association

RESOURCES