Skip to main content
NCBI home page
The Plant Pathology Journal logoLink to The Plant Pathology Journal
. 2026 Sep 14;42(5):712–725. doi: 10.5423/PPJ.OA.06.2026.0090

Nationwide Survey Using Real-Time PCR in 2024 and 2025 Supports the Absence of Xylella fastidiosa in Korea

In Woong Park 1,†,#, Yejin Park 1,†,#, Yong Ho Shin 2,†,#, Boyoung Kim 3,†,#, Byeongsam Kang 4,†,#, Myoungjoon Kim 1, Jiwon Lee 1, Minho Chung 1, Geonhui Cho 1, LeeSeul Kim 1, Sumin Jeon 1, Serim Lee 1, Jun Yub Lee 1, Jihui Hwang 1, Jun-Yeong Seo 1, Soobin Yang 1, Zar Zar Soe 2, Hyun Jin Sim 2, Boknam Jung 4, Su-hyun Lee 4, Jeong-Eun Kim 4, Jonghyun Shin 4,*, Jae Hoon Lee 1,3,5,*, Yong-Chull Jeun 2,*, Chang-Sik Oh 1,3,5,*
PMCID: PMC13655604  PMID: 42706733

Abstract

Xylella fastidiosa is a plant-pathogenic bacterium that causes severe diseases in economically important crops, such as citrus and grapevine, thereby posing a significant threat to global agriculture. Although X. fastidiosa has not yet been reported in Korea, the increase in international trade and its presence in neighboring countries highlight the necessity of continued surveillance. The objective of this study was to verify the absence of X. fastidiosa in Korea and to establish a reliable diagnostic framework through a nationwide survey conducted in 2024 and 2025. The sampling design was generated using the RiBESS+ statistical model to ensure the reliability of the survey results. Host plants, including grapevines (Vitis vinifera), mandarin oranges (Citrus unshiu), and cherry blossoms (Prunus yedoensis), were selected and sampled from urban and agricultural areas throughout the country for a nationwide survey. Genomic DNA was extracted from plant petioles and analyzed using real-time PCR with an optimized primer set (XF16S-F/R). Over a period of two years, a total of 2,314 samples were collected, exceeding the required sample size of 843 per year. X. fastidiosa was not detected in any of the collected and tested samples. These results confirm the absence of X. fastidiosa in Korea throughout the study period with high statistical confidence. This study provides evidence confirming the absence of X. fastidiosa in Korea and proposes a standardized methodology for future surveillance and early detection of other invasive prohibited quarantine pests.

Keywords: grapevine, mandarin orange, nationwide survey, real-time PCR, X. fastidiosa

Xylella fastidiosa is a significant plant-pathogenic bacterium with an extensive host range of at least 304 genera and 679 species, including economically important crops such as grapevine, olive, citrus, and peach (Loureiro et al., 2023; Trkulja et al., 2022; Wells et al., 1987). X. fastidiosa consists of six subspecies, including X. fastidiosa subsp. fastidiosa, X. fastidiosa subsp. multiplex, X. fastidiosa subsp. pauca, X. fastidiosa subsp. sandyi, X. fastidiosa subsp. morus, and X. fastidiosa subsp. tashke (Denancé et al., 2019; Marcelletti and Scortichini, 2016; Randall et al., 2009; Su et al., 2016). However, the genotype information of X. fastidiosa subsp. tashke needs to be confirmed. In addition, X. taiwanensis has been identified as a novel species causing pear leaf scorch in Taiwan, exhibiting characteristics similar to those of X. fastidiosa (Su et al., 2016).

X. fastidiosa colonizes in the host xylem vessels and inhibits water transport (Rapicavoli et al., 2018). This pathogen is transmitted by insect vectors such as the sharpshooter and the spittlebug, which feed on xylem sap from host plants (Cornara et al., 2019). The glassy-winged sharpshooter (GWSS) (Homalodisca vitripennis) and the spittlebug (Philaenus spumarius) are well known to be major insect vectors (Krugner et al., 2019; Loureiro et al., 2023).

X. fastidiosa is currently distributed across 21 countries, primarily in North America, South America, Europe, the Middle East, and Asia, according to the European and Mediterranean Plant Protection Organization (EPPO) Global Database (https://gd.eppo.int/). However, the number of affected countries is likely to increase if comprehensive investigations are conducted in countries that have reported the absence of the pathogen but are considered unreliable. X. fastidiosa causes multiple diseases, including Pierce’s disease (PD) in grapevines, olive quick decline syndrome (OQDS) in olive trees, citrus variegated chlorosis in citrus trees, and phony peach disease (PPD) in peach trees. These diseases result in significant economic losses. For example, PD is causing considerable economic losses to California’s grape-related industries. As of 2014, the annual losses surpassed $104 million, comprising $48 million in PD-related management activities and $56 million in production losses (Tumber et al., 2014). In 2013, Italy experienced a significant outbreak of the OQDS, which resulted in considerable losses as approximately one million trees across ten thousand hectares became infected (Martelli et al., 2016). It is hypothesized that X. fastidiosa was introduced via imported coffee plants from foreign countries (Scortichini and Cesari, 2019). Recently, walnut leaf scorch occurred in China due to X. fastidiosa (Guo et al., 2024).

The detection of X. fastidiosa in neighboring countries is regarded as a potential threat in Korea. Moreover, several potential insect vectors of X. fastidiosa have been reported to be found in Korea, including the large froghopper (Aphrophora pectoralis), the green leafhopper (Cicadella viridis), and Bothrogonia ferruginea (Kim et al., 2006; Nozawa and Ohgushi, 2002; Seo et al., 2022). Therefore, X. fastidiosa is classified as a prohibited quarantine pest due to its potential to pose a significant threat to the grapevine and citrus industries in Korea upon introduction, and consequently, it is subject to stringent control measures.

In 2024, Korea exported a total of 4,789 tons of grapes and 3,404 tons of mandarin oranges, with export volumes increasing gradually each year, according to Korea Agricultural Trade Information (https://www.kati.net). In this aspect, it is essential to provide evidence that X. fastidiosa is not present in the host plants surveyed in Korea to facilitate access to the global market. Furthermore, the expansion of international trade entails an elevated risk of introducing X. fastidiosa from abroad, thereby necessitating the implementation of preventive measures to mitigate the risk of outbreak.

In this study, we conducted a nationwide survey to demonstrate the presence or absence of X. fastidiosa within the country from 2024 to 2025. For this purpose, real-time PCR analysis was performed using genomic DNA extracted from plant samples collected from X. fastidiosa host plants across the country. Ultimately, we attempted to establish a foundational framework for diagnostic methods to cope with the invasion of X. fastidiosa from foreign countries and dissemination within the country.

Materials and Methods

Bacterial strains and growth conditions

X. fastidiosa subsp. fastidiosa NCPPB 4432 strain was cultured at 28°C for fourteen days in PD2 medium (bacto-tryptone 4 g/L, soy peptone 2 g/L, trisodium citrate 1 g/L, disodium succinate 1 g/L, hemin chloride stock solution 10 mL [0.1%/in 0.05 N NaOH], MgSO4·7H2O 1 g/L, K2HPO4 1.5 g/L, and bovine serum albumin fraction five 2 g/L). Xanthomonas campestris pv. campestris KACC 19135 strain was cultured at 28°C for two days in LB medium (tryptone 10 g/L, NaCl 5 g/L, and yeast extract 5 g/L).

Estimation of the required sample size

The required sample size was calculated using RiBESS+, a statistical model provided by the European Food Safety Authority (EFSA) (Lázaro et al., 2020) (Table 1). The grapevine (Vitis vinifera), mandarin orange (Citrus unshiu), and cherry blossom (Prunus yedoensis) were selected as host plants for detecting X. fastidiosa presence. The number of host plants planted across the country was estimated using information from the Ministry of Data and Statistics (MODS) for 2023 and an open public data source (data.go.kr). The estimated number of planted grapevines and mandarin oranges was based on information about the cultivated area (in hectares) and the number of trees cultivated per hectare, as provided by the MODS and the Rural Development Administration of Korea.

Table 1.

Statistically estimated sample numbers required for surveying the presence of X. fastidiosa in South Korea

Zone Number of host plants Number of samples
Location Host plants Estimated number of trees Confidence levels
Level Real-time PCR (0.68) Conventional PCR (0.57)
1 2 3 0.99 0.95 0.99 0.95
1 Country Urban Seoul Cherry blossom 51,297 23 5 27 6
Incheon Cherry blossom, grapevine 241,830 106 22 127 26
Daejeon Cherry blossom, grapevine 182,161 80 16 96 20
Sejong Cherry blossom, grapevine 116,960 52 11 62 13
Western Gyeonggi-do Grapevine 1,021,410 404 81 482 96
Chungcheongnam-do Grapevine 569,390 225 45 269 54
Chungcheongbuk-do Grapevine 1,196,980 473 95 564 113
Eastern Gangwon-do Grapevine 145,500 439 88 524 105
Southwestern Jeonbuk-do Grapevine 391,880 28 6 33 7
Subtotal 3,917,408 1,830 369 2,184 440
2 Country Urban Gwangju Cherry blossom, grapevine 21,579 10 2 12 3
Southwestern Jeollanam-do Grapevine, mandarin orange 90,210 7 2 8 2
Jeju-do Mandarin orange 15,343,460 1,067 214 1,273 255
Subtotal 15,455,249 1,084 218 1,293 260
3 Country Urban Busan Cherry blossom, grapevine 67,388 30 6 36 8
Daegu Cherry blossom, grapevine 273,338 120 24 143 29
Ulsan Cherry blossom, grapevine 48,439 22 5 26 6
Southeastern Gyeongsangnam-do Grapevine 219,220 34 7 41 9
Gyeongsangbuk-do Grapevine 6,939,380 1,067 214 1,273 254
Subtotal 7,547,765 1,273 256 1,519 306
Total 4,187 843 4,996 1,006
Open in a new tab

According to the EFSA guidelines, the host plants were divided into three levels for the target population. Level 1 is the survey area: Korea. Level 2 comprises land use categories such as an urban area and four agricultural areas. Level 3 consists of epidemiological units that categorize the cities and provinces. The required sample sizes were calculated using RiBESS+ at level 2. Level 2 comprises five groups: the urban area including the metropolitan cities (Seoul, Incheon, Daejeon, Sejong, Gwangju, Busan, Daegu, and Ulsan); the eastern region (Gangwon-do); the western region (Gyeonggi-do, Chungcheongnam-do, and Chungcheongbuk-do); the southeastern region (Gyeongsangnam-do and Gyeongsangbuk-do); and the southwestern region (Jeollanam-do, Jeonbuk-do, and Jeju-do). Four parameters were used for the RiBESS+: target confidence of freedom, population size, test sensitivity, and design prevalence. The value of target confidence of freedom in level 2 was obtained using the formula below (Lázaro et al., 2020):

CL=1-Πi=1n(1-CLi)

This formula used the number of groups (n), confidence level of the survey with groups (CLi), and overall confidence level of the survey (CL). Based on the formula, the values of target confidence of freedom were calculated as 0.45 and 0.95 when CL was supposed to be 0.95 and 0.99, respectively. Population size used the estimated number of host plants in five groups. Test sensitivity was set at 0.57 and 0.68 for conventional PCR and real-time PCR, respectively. The values of design prevalence were applied to urban and agricultural areas at rates of 0.01 and 0.004, respectively. The eastern region used the value of 0.01 because Gangwon-do is not a major grapevine production area.

The calculated sample numbers by the RiBESS+ were distributed by the ratio of host plants in the regions, based on confidence levels of 0.95 and 0.99 for conventional PCR and real-time PCR (Table 1). The prediction of detection method accuracy was utilized the validation data that are provided by the EPPO database (https://dc.eppo.int/validation_data/validationlist).

Sample collection and storage

The leaves of X. fastidiosa host plants were collected intensively between June and October, following the EPPO guidelines, when plant growth is most active (EPPO, 2023). Four leaves were collected from symptomless plants, whereas five leaves were collected from symptomatic plants. The parks in urban areas and farms in agricultural areas were major locations to collect both cherry blossom and grapevine and mandarin orange samples from at least three individual trees. For cherry blossoms, leaves were collected sequentially from the middle of the tree upward. In cases of grapevine and mandarin orange, samples were obtained from the outer parts of the canopy rather than the central parts to minimize any adverse effects on fruit quality and the trees themselves. Each sample collected was sealed separately in a plastic bag and transported to the laboratory at 4–10°C. The samples were kept at 4°C and processed for genomic DNA (gDNA) extraction within one week. The information, such as photos, location, and GPS address of sampled trees, was documented in preparation for positive detection results of X. fastidiosa.

gDNA extraction from bacteria and plant samples

X. fastidiosa subsp. fastidiosa NCPPB 4432 and X. campestris pv. campestris KACC 19135 strains were cultured in 5 mL of PD2 and LB broth medium at 28°C with 250 rpm for almost two weeks and two days, respectively. The gDNA of bacteria was extracted using AccuPrep Genomic DNA Extraction Kit (Bioneer, Daejeon, Korea). The gDNA from plant samples was extracted from leaf petioles. The 12–16 petioles of cherry blossom and mandarin orange from symptomless leaves were pooled for gDNA extraction because of their small size, while the petioles from the symptomatic leaves were used for gDNA extraction individually. In the case of grapevine, gDNA extraction was performed without pooling because the size of the grapevine petiole is larger than other host plants.

The gDNA of cherry blossom was isolated using modified cetyltrimethylammonium bromide (CTAB) method (Lee et al., 2024). The petioles were cut, and 0.15 g was transferred to a Lysing matrix A tube (MP biomedicals, Irvine, CA, USA). The liquid nitrogen treatment was applied if the petioles were not easily ground using the homogenizer. The petioles, along with the CTAB extraction solution (Biosesang, Yongin, Korea), were ground using FastPrep-24TM 5G homogenizer (MP biomedicals). The homogenized tissue after adding β-Mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA) was incubated for an hour at 65°C. A solution of UltraPureTM phenol: chloroform: isoamyl alcohol (25:24:1) (Invitrogen, Carlsbad, CA, USA) was put in the tube, which was then centrifuged at 13,000 rpm for 15 min. The supernatant was transferred to a new microtube, followed by the addition of cold isopropanol (Duksan Pure Chemical Co., Ltd., Ansan, Korea). The DNA pellet was washed with 70% ethanol (Samchun Pure Chemical Co., Ltd, Pyeongtaek, Korea). The isolated gDNA was eluted using sterilized distilled water.

The gDNA from the grapevine and mandarin orange samples was isolated using the HiGene Genomic DNA prep kit (Biofact, Daejeon, Korea). The 0.15 g of petioles was mixed with lysis buffer in the Lysing matrix A using the homogenizer. The gDNA was isolated according to the manufacturer’s instructions.

The extracted gDNA was verified by the electrophoresis with a 0.8% of agarose gel (Genetbio, Daejeon, Korea) and ChemiDocTM XRS+ with Image LabTM software (Bio-Rad, Hercules, CA, USA). The concentration of gDNA was also measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

Real-time polymerase chain reaction (PCR)

The real-time PCR method was selected to detect X. fastidiosa in plant samples. SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) was used. The total reaction volume was adjusted to 20 μL. A volume of 1 μL of each specific forward and reverse primer for detecting X. fastidiosa was added (Table 2). The 1 μL of extracted gDNA (approximately 80 ng for grapevine and citrus and 200 ng for cherry blossom) from the host plants was used as a template. The 50 ng gDNA of X. fastidiosa subsp. fastidiosa NCPPB 4432 and sterilized distilled water were used as positive and negative controls, respectively. The polymerase activation step was conducted at 95°C for 3 min. A total of 30 reaction cycles were performed, each consisting of denaturation step at 95°C for 3 sec, followed by an annealing and extension step at 60°C for 40 sec. The real-time PCR was performed in technical duplicates with gDNA from each plant sample using the following instruments: CFX96TM Real-Time System with C1000TM Thermal Cycler (Bio-Rad), QuantStudio 1 (QS1) Real-Time PCR system (Thermo Fisher Scientific) and CFX Opus 96 Real-Time PCR system (Bio-Rad). The results were analyzed using CFX manager version 3.1 (Bio-Rad), Design & Analysis 2 version 2.8.0 (Thermo Fisher Scientific), and CFX MAESTRO version 2.2 (Bio-Rad) software.

Table 2.

Specific primer sets for the detection of X. fastidiosa in plant samples

Set Primer name Nucleotide sequence (5′-3′) References
1 XF16S-F CGGCAGCACGTTGGTAGTAA Li et al., 2013
XF16S-R CCGATGTATTCCTCACCCGTC
2 XF-F CACGGCTGGTAACGGAAGA Harper et al., 2010
XF-R GGGTTGCGTGGTGAAATCAAG
3 C06Xf-bamA-F CCAACCCGTTTTTCACCGACAATG Chen et al., 2019
C06Xf-bamA-R GCGCCGATGACCCAAGAGACAGT
4 C03Xf-gyrB-F CGGCGCGACGATTTTCACT Chen et al., 2019
C03Xf-gyrB-R ACATTGTTTCTTGGTAGGCATCAGTCC
5 XrDf1 GGCTCATCCAATCGCACAA Ito and Chiaki, 2021
D-XrDr2 CGGACGGCAGCACAITGGTAIIIIIACCATGG
6 XrDf1 GGCTCATCCAATCGCACAA Ito and Chiaki, 2021
XLr4 CGGACGGCAGCACRKTGGT
Open in a new tab

Results

Establishment of the survey procedure for X. fastidiosa.

A nationwide survey of X. fastidiosa distribution was conducted according to the established workflow (Fig. 1). Leaves from host plants, including cherry blossom, grapevines, and mandarin oranges, were collected from the urban and agricultural areas. The gDNA was extracted from the petioles of these leaves. Real-time PCR was subsequently conducted using the isolated gDNA and specific primer sets targeting X. fastidiosa. Based on the real-time PCR results, it is determined that the target bacterium is not present in the samples if the signal does not appear in the same number of cycles as the positive control. However, the real-time PCR is repeated when positive or inconclusive results are obtained. If a positive result is obtained, plant samples should be recollected from the same trees using the previously recorded information on the sampling locations. The plant samples are considered infected with X. fastidiosa if the recollected samples also show positive. Subsequently, the pathogen should be isolated from the samples for identification and epidemiological analysis.

Fig. 1.

Fig. 1

Open in a new tab

Workflow diagram for the detection of X. fastidiosa in host plants. This workflow was modified from one in the EPPO diagnostic standard PM 7/24 (5).

Determination of the examination method for detecting X. fastidiosa.

The required sample size for the survey was obtained using RiBESS+, a statistical model supported by EFSA (Table 1). Real-time PCR was selected as the most effective method for detecting X. fastidiosa in samples. At a confidence level of 0.95, this method was more accurate than conventional PCR and requires fewer samples. Six primer sets specific to X. fastidiosa, which are optimal for the real-time PCR method, were examined (Table 2, Fig. 2). First, the XF-16S-F/R and XF-F/R primer sets were tested (Fig. 2A). These primers are recommended by the International Standard for Phytosanitary Measures (ISPM) for detecting X. fastidiosa by real-time PCR (FAO, 2024; Harper et al., 2010; Li et al., 2013). The primer set XF16S-F/R was more sensitive than the XF-F/R set against the same concentration of X. fastidiosa gDNA. Furthermore, real-time PCR was performed using the gDNA of X. campestris pv. campestris, a plant-pathogenic bacterium within Xanthomonadaceae family that includes X. fastidiosa, to minimize the risk of a false positive result (Table 3). Consequently, the XF16S-F/R set exhibited over 30 Ct value with 50 ng of X. campestris pv. campestris gDNA, compared to the same amount of X. fastidiosa gDNA. This indicates a low risk of a false positive result against the gDNA of X. campestris pv. campestris. Moreover, based on these results, the threshold for a positive result was determined as a Ct value below 30.

Fig. 2.

Fig. 2

Open in a new tab

The primer selection for the real-time PCR to monitor the presence of X. fastidiosa in host plant samples. (A) The sensitivity test of two X. fastidiosa specific primer sets using X. fastidiosa NCPPB 4432 gDNA. (B) The sensitivity test of other specific primer sets. Plant DNAs with different concentrations of X. fastidiosa NCPPB 4432 strain were used for the test. qPCR results were analyzed by QuantStudio 1 (QS1) Real-Time PCR system (Thermo Fisher Scientific).

Table 3.

Ct value of each primer set from the real-time PCR using X. fastidiosa gDNA

Bacterial strains Primer set Amount of genomic DNA for template (ng)
5 × 101 5 × 10−3 5 × 10−6 5 × 10−9 Distilled water
Ct value
X. fastidiosa XF-F/XF-R 11.38 (±0.15) 22.02 (±0.38) 33.16 (±1.56) ND ND
XF16S-F/XF16S-R 9.78 (±0.05) 20.68 (±0.02) 31.67 (±0.47) 36.75 ND
Xanthomonas campestris pv. campestris XF-F/XF-R 33.85 (±0.18) 37.67 38.6 ND ND
XF16S-F/XF16S-R 34.24 (±0.40) 36.9 ND ND ND
Open in a new tab

ND, not detected.

In order to minimize the risk of a false positive in the absence of X. fastidiosa, four additional primer sets, C06Xf-bamA-F/R, C03Xf-gyrB-F/R, XrDf1/D-XrDr2, and XrDf1/XLr4, were tested using the extracted gDNA of cherry blossom petioles mixed with the different concentration of X. fastidiosa (Fig. 2B) (Chen et al., 2019; Ito and Chiaki, 2021). The XF16S-F/R primer set showed high amplification efficiency for X. fastidiosa and minimal non-specific amplification, and none of the primer sets showed higher Ct values than XF16S-F/XF16S-R using the gDNA that were not mixed with X. fastidiosa (Table 4). Overall, the XF16S-F/R primer set was finally selected for detecting X. fastidiosa in the plant samples, and the result showing a Ct value below 30 was considered as a positive result.

Table 4.

Ct value of each primer set from the real-time PCR using plant samples with X. fastidiosa

Primer set Amount of genomic DNA for template (ng) Bacterial concentration (CFU/mL) No X. fastidiosa
Only X. fastidiosa w/ground cherry blossom sample
5 × 101 2 × 105 2 × 103 2 × 10
Ct value
XF16S-F 9.382 22.235 27.976 30.543 32.773
XF16S-R (±0.037) (±0.522) (±0.616) (±0.520) (±3.201)
C06Xf-bamA-F 9.47 22.34 27.34 29.20 29.83
C06Xf-bamA-R (±0.08) (±0.22) (±0.10) (±0.24) (±0.30)
C03Xf-gyrB-F 8.82 22.13 26.87 27.56 27.81
C03Xf-gyrB-R (±0.27) (±0.28) (±0.32) (±0.19) (±0.23)
XrDf1 8.80 21.54 27.31 31.86 31.99
D-XrDr2 (±0.05) (±0.11) (±0.17) (±0.54) (±0.18)
XrDf1 8.34 21.17 23.84 23.54 24.24
XLr4 (±0.10) (±0.31) (±0.29) (±0.42) (±0.04)
Open in a new tab

The collection of the host plant samples from the subdivided regions in Korea

In order to investigate the distribution of X. fastidiosa in Korea, the country was divided into three zones for the survey (Fig. 3). The Zone 1 comprises the four urban areas (Seoul, Incheon, Daejeon, and Sejong) and five agricultural areas (Gyeonggi-do, Chungcheongnam-do, Chungcheongbuk-do, Gangwon-do, and Jeonbuk-do). The Zone 2 consists of one urban area (Gwangju) and two agricultural areas (Jeollanam-do and Jeju-do). The Zone 3 includes the three urban areas (Busan, Daegu, and Ulsan) and two agricultural areas (Gyeongsangnam-do and Gyeongsangbuk-do). The samples were collected in 2024 and 2025 (Fig. 4).

Fig. 3.

Fig. 3

Open in a new tab

The sampling locations and the number of samples collected in 2024 and 2025. (A) The sampling locations of each zone. The red and blue dots indicate the years in which samples were collected at the sites, respectively. (B) The number of samples for each year. The graphs display the number of samples collected each month from three zones. The map was obtained from the National Geographic Information Institute in Korea.

Fig. 4.

Fig. 4

Open in a new tab

The representative collected sample photos of each X. fastidiosa host plant. Cherry blossom (A), grapevine (B), and mandarin orange (C) are major target host plants. The top panels show the collection sites, which were parks or farmlands. The bottom panels display the representative symptomless and symptomatic leaf samples collected from host plants.

In Zone 1, cherry blossom samples were collected from 21 urban locations in 2024 (Fig. 3A). The grapevine samples were collected from 94 locations in agricultural areas during the same period. In total, 69 cherry blossom trees and 405 grapevine trees were surveyed. The monthly collection totals were 41 in May, 16 in June, 85 in July, 180 in August, 80 in September, and 72 in October. In 2025, cherry blossom samples were collected from 20 urban locations and 76 trees. Grapevine samples were also obtained from 98 locations in agricultural areas and 403 trees. In 2025, the monthly collection totals were 43 in June, 12 in July, 133 in August, 205 in September, and 86 in October (Fig. 3B). Consequently, samples were collected from 115 sites and 474 trees in 2024, and from 118 sites and 479 trees in 2025.

In Zone 2, mandarin orange samples were collected from 60 and 64 locations in agricultural areas in 2024 and 2025, respectively (Fig. 3A). Three urban locations were visited to collect cherry blossom samples in 2025. The monthly collected sample numbers were 80 in May, 60 in July, 60 in August, 40 in September, and 60 in October in 2024. In 2025, the monthly collection totals were 15 in April, 55 in May, 60 in June, 70 in July, 60 in August, and 75 in September (Fig. 3B). Overall, samples were collected from 60 sites and 300 trees in 2024, and from 67 sites and 335 trees in 2025.

In Zone 3, samples from 40 cherry blossom trees at 40 urban locations and from 302 grapevine trees at 85 agricultural locations, respectively, were collected in 2024 (Fig. 3A). The monthly number of samples was 4 in May, 21 in June, 22 in July, 36 in August, 181 in October, and 78 in November (Fig. 3B). In 2025, sampling at 7 urban and 89 agricultural locations were conducted. A total of 28 cherry blossoms and 356 grapevines were surveyed. The monthly collection totals were 24 in April, 52 in May, 108 in June, 136 in July, 36 in September, and 28 in October. In total, samples were collected from 125 sites and 342 trees in 2024, and from 96 sites and 384 trees in 2025. Taken together, more samples were collected and used for real-time PCR testing with a confidence level of 0.95 than the originally estimated 843 samples per year (389 for Zone 1, 218 for Zone 2, and 256 for Zone 3) by RiBESS+.

No evidence of X. fastidiosa presence in the host plant samples

The gDNA was isolated from the leaf petioles of samples collected from 953 trees in Zone 1, 635 trees in Zone 2, and 726 trees in Zone 3 for detection of X. fastidiosa by real-time PCR (Fig. 5). The real-time PCR was conducted using the extracted gDNA of the cherry blossom, grapevines, and mandarin oranges with the specific primer set (Fig. 6). In Zone 1, no targeted pathogen was detected in the samples, except for the gDNA of X. fastidiosa NCPPB 4432 used as a positive control, among the 474 and 479 samples collected in 2024 and 2025, respectively. Similar to Zone 1, the X. fastidiosa was not detected in any of the 300 and 335 samples collected in 2024 and 2025, respectively, in Zone 2. During the same periods, in Zone 3, no positive results for X. fastidiosa were obtained from any of 342 and 384 samples collected in 2024 and 2025. Overall, based on our results of the nationwide survey for two years, X. fastidiosa was not detected in the surveyed 2,314 samples, which exceeded the number estimated by RiBESS+ (Table 5), and it should be considered as prohibited quarantine pathogen in Korea.

Fig. 5.

Fig. 5

Open in a new tab

The extraction of genomic DNA (gDNA) from the representative leaf samples of host plants. All gDNAs were confirmed by electrophoresis on a 0.8% agarose gel after extraction. This figure shows representative results of gDNA extracted from 0.15g of the petioles of cherry blossom (A), grapevine (B), and mandarin orange (C), using either CTAB method or HiGene Genomic DNA prep kit (Biofact). The white arrows indicate the gDNA of cherry blossom.

Fig. 6.

Fig. 6

Open in a new tab

The results of real-time PCR with the collected host plant samples, cherry blossom (A), grapevine (B), and mandarin orange (C). The left and right panels indicate the amplification and melting peak graphs, respectively. X. fastidiosa NCPPB 4432 gDNA and sterilized distilled water were used as positive (blue arrow) and negative controls, respectively. Results in A and B were analyzed using the CFX96TM Real-Time System with C1000TM Thermal Cycler (Bio-Rad), and results in C were analyzed using the CFX Opus 96 (Bio-Rad).

Table 5.

Results of nationwide survey for X. fastidiosa in Korea in 2024 and 2025

Zone Location Host plants Number of required samples (95% CL) Number of collected samples Detection result of X. fastidiosa
Negative Positive
2024 2025 2024 2025 2024 2025
1 Seoul Cherry blossom 5 19 21 19 21 0 0
Incheon Cherry blossom 22 22 22 22 22 0 0
Daejeon Cherry blossom 16 16 21 16 21 0 0
Sejong Cherry blossom 11 12 12 12 12 0 0
Gyeonggi-do Grapevine 81 94 82 94 82 0 0
Chungcheongnam-do Grapevine 45 50 51 50 51 0 0
Chungcheongbuk-do Grapevine 95 94 115 94 115 0 0
Gangwon-do Grapevine 88 152 140 152 140 0 0
Jeonbuk-do Grapevine 6 15 15 15 15 0 0
2 Gwangju Cherry blossom 2 0 15 0 15 0 0
Jeollanam-do Mandarin orange 2 5 15 15 15 0 0
Jeju-do Mandarin orange 214 295 305 295 305 0 0
3 Busan Cherry blossom 6 7 8 7 8 0 0
Daegu Cherry blossom 24 37 28 37 28 0 0
Ulsan Cherry blossom 5 8 8 8 8 0 0
Gyeongsangnam-do Grapevine 7 53 40 53 40 0 0
Gyeongsangbuk-do Grapevine 214 237 300 237 300 0 0
Total 843 1,116 1,198 1,116 1,198 0 0
Open in a new tab

CL, confidence level.

Discussion

This study investigated the presence or absence of X. fastidiosa in Korea for two years (2024–2025). The country was divided into three regions, and a total of 2,314 samples were tested using real-time PCR on host plants, including cherry blossom, grapevine, and citrus trees. Many countries regularly conduct nationwide surveys for X. fastidiosa to prevent economic losses of important crops and associated industries. Italy, which experienced OQDS in 2013, is currently conducting systematic monitoring of X. fastidiosa. The samples were categorized based on variety, age, and soil management practices. The samples were analyzed using ELISA and quantitative real-time PCR (Scortichini and Cesari, 2019). In 2020, the survey on the current status of PPD was conducted in USA. Meteorological and Geographical data, as well as biological information such as the age and height of symptomatic trees, were compiled from the research areas to identify correlations. The study suggested that PPD remains a threat to the region and that early detection of symptoms and removal of affected trees are necessary (Johnson et al., 2023). Morocco is under high risk to the spread of the pathogen because of its Geographical position, which requires continuous trade with Europe. Therefore, a comprehensive survey was conducted from 2020 to 2021 to mitigate losses in the olive, almond, and citrus industries. The survey revealed the necessity of rapid and continuous monitoring (El Handi et al., 2022). In 2019, Korea was divided into seven regions, and a total of 15 surveillance surveys were conducted to investigate the presence of X. fastidiosa. The pathogen was absent from all the samples analyzed. Based on these results, it was concluded that X. fastidiosa was not present in the country at that time (Lee et al., 2020). In contrast to the 2019 survey, which examined only 540 grapevine samples collected from six provinces (Gyeonggi-do, Chungcheongnam-do, Chungcheongbuk-do, Jeonbuk-do, Gyeongsangbuk-do, and Gangwon-do), our study analyzed 2,314 samples collected nationwide from three host plants, which were calculated using RiBESS+ statistical model. Our two-year survey, which utilized a larger sample size than previous research, supported that the pathogen remains absent in the country.

Several different methods have been used for detection of X. fastidiosa outbreaks. Before the 2000s, electron microscopy was also used for testing (Leu and Su, 1993). Since then, however, ELISA, PCR, and DNA sequencing have predominantly been employed (Choueiri et al., 2023; Olawole et al., 2022). Among these methods, real-time PCR is recommended for diagnosing asymptomatic plants due to its high sensitivity and ability to provide rapid results compared to conventional PCR (Ito and Chiaki, 2021). Although loop-mediated isothermal amplification (LAMP) PCR is portable and facilitates real-time diagnosis at cultivation and quarantine areas, it is less sensitive than real-time PCR (Harper et al., 2010; Luchi et al., 2023). Recent advancements in recombinase polymerase amplification-based diagnostic kits have facilitated the straightforward detection of X. fastidiosa without the need for specialized technical expertise (Cesbron et al., 2023). Lab-on-a-Chip diagnostic methods have been developed and are used to provide rapid and low-cost results compared to conventional ELISA and real-time PCR analyses (Chiriacò et al., 2018). Furthermore, numerous studies have employed unmanned aerial vehicles to detect X. fastidiosa infections, facilitated by advancements in related technologies (Castrignanò et al., 2020; Di Nisio et al., 2020). So far, research on X. fastidiosa in Korea has only focused on developing specific primers for LAMP PCR (Kim et al., 2021). However, compared to other countries, research on X. fastidiosa remains limited.

As global climate change progresses, the habitat of insect vectors of X. fastidiosa is also undergoing alteration. The risk of introducing X. fastidiosa is gradually increasing due to change in the distribution of its insect vectors (Bosso et al., 2016; Yoon and Lee, 2023). The pathogen proliferates within the xylem vessels of host plants and is transmitted by sap-sucking insects, including GWSS and spittlebugs. Consequently, once introduced, the pathogen disseminates rapidly and is difficult to control. Since most domestic grape and citrus cultivation environments consist of greenhouses and high-density plantings, X. fastidiosa is anticipated to spread extremely rapidly if introduced into Korea. Therefore, as exemplified by Corsica (Cruaud et al., 2018), which borders Italy, where OQDS occurred in 2015, there is an increasing need for preventive measures based on predictions of the distribution of insect vectors in Korea and neighboring countries. Recent research has increasingly employed software such as CLIMEX and the Maximum Entropy model to predict the migration of pests and pathogens in response to climate change (Byeon et al., 2018). Incorporating these models into the National Crop Pest Management System is essential for generating projections concerning the potential introduction and spread of X. fastidiosa vectors within the domestic environment. Furthermore, since X. fastidiosa can be mechanically transmitted through pruning shears, it is imperative to establish guidelines for equipment disinfection (Krell et al., 2007).

According to the Korea Agency of Education, Promotion and Information Service in Food, Agriculture, Forestry and Fisheries (https://www.maps.or.kr), the average annual volume of grape imports in South Korea has reached approximately 31 million kg between 2023 and 2025. The primary exporting countries are Chile, Australia, Peru, and the United States. Notably, the annual average imports from the United States and Peru are four million and six million kg, respectively. As X. fastidiosa is present in these two countries, there is a significant risk of the pathogen being introduced into Korea, thereby necessitating increased surveillance and vigilance.

A nationwide outbreak of fire blight caused by the prohibited quarantine pest Erwinia amylovora emerged in 2015 in Korea and continues to inflict severe damage to this day (Park et al., 2016). Despite extensive efforts to control the disease, complete eradication has remained unattainable. A single major outbreak of a disease caused by a novel pathogen leads to sustained economic losses that persist over time rather than cease immediately. Therefore, the implementation of appropriate preventive measures and continuous vigilance is urgently required. This study supports the absence of X. fastidiosa in Korea. The real-time PCR method employed in this study is anticipated to be applicable for the quarantine and epidemiological investigation of X. fastidiosa in the future. Furthermore, the research design and methodologies utilized in this project are expected to be applicable to other prohibited quarantine pathogens and pests that may be introduced from abroad.

Footnotes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was supported by Animal and Plant Quarantine Agency, Republic of Korea (No. PQ20241B007-SP).

References

  1. Bosso L., Di Febbraro M., Cristinzio G., Zoina A., Russo D. Shedding light on the effects of climate change on the potential distribution of Xylella fastidiosa in the Mediterranean basin. Biol. Invasions. 2016;18:1759–1768. [Google Scholar]
  2. Byeon D. H., Jung S., Lee W. H. Review of CLIMEX and MaxEnt for studying species distribution in South Korea. J. Asia-Pac. Biodivers. 2018;11:325–333. [Google Scholar]
  3. Castrignanò A., Belmonte A., Antelmi I., Quarto R., Quarto F., Shaddad S., Sion V., Muolo M. R., Ranieri N. A., Gadaleta G. Semi-automatic method for early detection of Xylella fastidiosa in olive trees using UAV multispectral imagery and geostatistical-discriminant analysis. Remote Sens. 2020;13:14. [Google Scholar]
  4. Cesbron S., Dupas E., Jacques M.-A. Evaluation of the AmplifyRP XRT+ kit for the detection of Xylella fastidiosa by recombinase polymerase amplification. PhytoFrontiers. 2023;3:225–234. [Google Scholar]
  5. Chen C., Bock C. H., Brannen P. M. Novel primers and sampling for PCR detection of Xylella fastidiosa in peach. Phytopathology. 2019;109:307–317. doi: 10.1094/PHYTO-11-18-0439-FI. [DOI] [PubMed] [Google Scholar]
  6. Chiriacò M. S., Luvisi A., Primiceri E., Sabella E., De Bellis L., Maruccio G. Development of a lab-on-a-chip method for rapid assay of Xylella fastidiosa subsppauca strain CoDiRO. Sci. Rep. 2018;8:7376. doi: 10.1038/s41598-018-25747-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Choueiri E., Abou Kubaa R., Valentini F., Yaseen T., El Sakka H., Gerges S., La Notte P., Saponari M., Elbeaino T., El Moujabber M. First report of Xylella fastidiosa on almond (Prunus dulcis) in Lebanon. J. Plant Pathol. 2023;105:1157–1157. [Google Scholar]
  8. Cornara D., Morente M., Markheiser A., Bodino N., Fereres A., Redak R. A., Perring T. M., Lopes J. R. S. An overview on the worldwide vectors of Xylella fastidiosa. Entomol. Gen. 2019;39:157–181. [Google Scholar]
  9. Cruaud A., Gonzalez A.-A., Godefroid M., Nidelet S., Streito J.-C., Thuillier J.-M., Rossi J.-P., Santoni S., Rasplus J.-Y. Using insects to detect, monitor and predict the distribution of Xylella fastidiosa: a case study in Corsica. Sci. Rep. 2018;8:15628. doi: 10.1038/s41598-018-33957-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Denancé N., Briand M., Gaborieau R., Gaillard S., Jacques M.-A. Identification of genetic relationships and subspecies signatures in Xylella fastidiosa. BMC Genomics. 2019;20:239. doi: 10.1186/s12864-019-5565-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Di Nisio A., Adamo F., Acciani G., Attivissimo F. Fast detection of olive trees affected by Xylella fastidiosa from UAVs using multispectral imaging. Sensors. 2020;20:4915. doi: 10.3390/s20174915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. El Handi K., Hafidi M., Sabri M., Frem M., El Moujabber M., Habbadi K., Haddad N., Benbouazza A., Abou Kubaa R., Achbani E. H. Continuous pest surveillance and monitoring constitute a tool for sustainable agriculture: Case of Xylella fastidiosa in Morocco. Sustainability. 2022;14:1485. [Google Scholar]
  13. European and Mediterranean Plant Protection Organization (EPPO) PM 7/24 (5) Xylella fastidiosa. EPPO Bulletin. 2023;53:205–276. [Google Scholar]
  14. Food and Agriculture Organization of the United Nations (FAO) DP 25: Xylella fastidiosa. IPPC Secretariat; Rome, Italy: 2024. International Standard for Phytosanitary Measures (ISPM) 27: Diagnostic protocols for regulated pests. [Google Scholar]
  15. Guo T., Wang S., Pan C., Sattar A., Xing C., Hao H., Zhang C. Evidence of the involvement of Xylella fastidiosa in the occurrence of walnut leaf scorch in Xinjiang, China. Plant Dis. 2024;108:3648. [Google Scholar]
  16. Harper S. J., Ward L., Clover G. Development of LAMP and real-time PCR methods for the rapid detection of Xylella fastidiosa for quarantine and field applications. Phytopathology. 2010;100:1282–1288. doi: 10.1094/PHYTO-06-10-0168. [DOI] [PubMed] [Google Scholar]
  17. Ito T., Chiaki Y. Two new superior primer pairs for universal detection of Xylella spp. in conventional PCR and TaqMan quantitative real-time PCR. J. Microbiol. Methods. 2021;189:106321. doi: 10.1016/j.mimet.2021.106321. [DOI] [PubMed] [Google Scholar]
  18. Johnson K. A., Bock C. H., Vinson E. L., Brannen P. M. Prevalence and distribution of Phony Peach Disease (caused by Xylella fastidiosa) in the United States. Plant Dis. 2023;107:326–334. doi: 10.1094/PDIS-03-22-0653-RE. [DOI] [PubMed] [Google Scholar]
  19. Kim S.-T., Jung M.-P., Kim H.-S., Shin J.-H., Lim J.-H., Kim T.-W., Lee J.-H. Insect fauna of adjacent areas of DMZ in Korea. J. Ecol. Environ. 2006;29:125–141. [Google Scholar]
  20. Kim S., Park Y., Kim G. Development of Diagnostic Technology of Xylella fastidiosa Using Loop-Mediated Isothermal Amplification and PCR Methods. Res. Plant Dis. 2021;27:38–44. [Google Scholar]
  21. Krell R. K., Boyd E. A., Nay J. E., Park Y.-L., Perring T. M. Mechanical and insect transmission of Xylella fastidiosa to Vitis vinifera. Am. J. Enol. Vitic. 2007;58:211–216. [Google Scholar]
  22. Krugner R., Sisterson M. S., Backus E. A., Burbank L. P., Redak R. A. Sharpshooters: a review of what moves Xylella fastidiosa. Austral Entomol. 2019;58:248–267. [Google Scholar]
  23. Lázaro E., Parnell S., Vicent Civera A., Schans J., Schenk M., Schrader G., Cortiñas Abrahantes J., Zancanaro G., Vos S. Guidelines for statistically sound and risk-based surveys of Xylella fastidiosa. EFSA Support. Publ. 2020;17:1873E. [Google Scholar]
  24. Lee S. I., Lee H.-J., Kwak Y.-S. Genetic variation of Monilinia fructicola population in Korea. Plant Pathol. J. 2024;40:205–217. doi: 10.5423/PPJ.OA.01.2024.0017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lee Y., Choi O., Kang B., Kim S., Kim J., Choi J., Lee J. W., Nam J. H., Park H. J., Choi Y. J., Kim D.-W., Park Y.-S., Choi Y.-J., Lee J. S., Kim B., Lee J. D., Park S.-Y., Kim G. H., Kim Y., Jung S. Y., Lee Y., Jeon Y., Kim H., Kwon H., Kim J., Shin Y. H., Jeun Y. C. 2019 Monitoring reports about nine high risk plant pathogens in South Korea. J. Agric. Life Sci. 2020;54:17–23. [Google Scholar]
  26. Leu L. S., Su C. C. Isolation, cultivation, and pathogenicity of Xylella fastidiosa, the causal bacterium of pear leaf scorch disease in Taiwan. Plant Dis. 1993;77:642–646. [Google Scholar]
  27. Li W., Teixeira D. C., Hartung J. S., Huang Q., Duan Y., Zhou L., Chen J., Lin H., Lopes S., Ayres A. J. Development and systematic validation of qPCR assays for rapid and reliable differentiation of Xylella fastidiosa strains causing citrus variegated chlorosis. J. Microbiol. Methods. 2013;92:79–89. doi: 10.1016/j.mimet.2012.10.008. [DOI] [PubMed] [Google Scholar]
  28. Loureiro T., Mesquita M. M., Dapkevicius M. L. E., Serra L., Martins Â, Cortez I., Poeta P. Xylella fastidiosa: A Glimpse of the Portuguese Situation. Microbiol. Res. 2023;14:1568–1588. [Google Scholar]
  29. Luchi N., Migliorini D., Pecori F., Santini A. Real-time portable LAMP assay for a rapid detection of Xylella fastidiosa in-field. In: Foroud N. A., Neilson J. A. D., editors. Plant-Pathogen Interactions. Springer; New York, NY, USA: 2023. pp. 51–60. [DOI] [PubMed] [Google Scholar]
  30. Marcelletti S., Scortichini M. Genome-wide comparison and taxonomic relatedness of multiple Xylella fastidiosa strains reveal the occurrence of three subspecies and a new Xylella species. Arch. Microbiol. 2016;198:803–812. doi: 10.1007/s00203-016-1245-1. [DOI] [PubMed] [Google Scholar]
  31. Martelli G. P., Boscia D., Porcelli F., Saponari M. The olive quick decline syndrome in south-east Italy: a threatening phytosanitary emergency. Eur. J. Plant Pathol. 2016;144:235–243. [Google Scholar]
  32. Nozawa A., Ohgushi T. Life-history and oviposition preference of the willow spittlebug Aphrophora pectoralis (Homoptera: Aphrophoridae) Entomol. Sci. 2002;5:203–208. [Google Scholar]
  33. Olawole O. I., Uribe P., Rodriguez N. A., Gonzalez C. F., Ong K. L. First report of Bacterial Leaf Scald of plum caused by Xylella fastidiosa in Texas. Plant Dis. 2022;106:3198. [Google Scholar]
  34. Park D. H., Yu J-G, Oh E-J, Han K-S, Yea M. C., Lee S. J., Myung I.-S., Shim H. S., Oh C.-S. First report of fire blight disease on Asian pear caused by Erwinia amylovora in Korea. Plant Dis. 2016;100:1946–1946. [Google Scholar]
  35. Randall J. J., Goldberg N. P., Kemp J. D., Radionenko M., French J. M., Olsen M. W., Hanson S. F. Genetic analysis of a novel Xylella fastidiosa subspecies found in the southwestern United States. Appl. Environ. Microbiol. 2009;75:5631–5638. doi: 10.1128/AEM.00609-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rapicavoli J., Ingel B., Blanco-Ulate B., Cantu D., Roper C. Xylella fastidiosa: an examination of a re-emerging plant pathogen. Mol. Plant Pathol. 2018;19:786–800. doi: 10.1111/mpp.12585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Scortichini M., Cesari G. An evaluation of monitoring surveys of the quarantine bacterium Xylella fastidiosa performed in containment and buffer areas of Apulia, southern Italy. Appl. Biosaf.-J. Am. Biol. Saf. Assoc. 2019;24:96–99. doi: 10.1177/1535676019845738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Seo S.-Y., Hong H.-H., Im H.-T. Pollinator and pollination mechanism of Impatiens furcillata (Balsaminaceae) in Korea. Korean J. Pl. Taxon. 2022;52:207–213. [Google Scholar]
  39. Su C.-C., Deng W.-L., Jan F.-J., Chang C.-J., Huang H., Shih H.-T., Chen J. Xylella taiwanensis sp. nov., causing pear leaf scorch disease. Int. J. Syst. Evol. Microbiol. 2016;66:4766–4771. doi: 10.1099/ijsem.0.001426. [DOI] [PubMed] [Google Scholar]
  40. Trkulja V., Tomić A., Iličić R., Nožinić M., Milovanović T. P. Xylella fastidiosa in Europe: From the introduction to the current status. Plant Pathol. J. 2022;38:551–571. doi: 10.5423/PPJ.RW.09.2022.0127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tumber K. P., Alston J. M., Fuller K. Pierce’s disease costs California $104 million per year. Calif. Agric. 2014;68:20–29. [Google Scholar]
  42. Wells J. M., Raju B. C., Hung H.-Y., Weisburg W. G., Mandelco-Paul L., Brenner D. J. Xylella fastidiosa gen. nov., sp. nov: gram-negative, xylem-limited, fastidious plant bacteria related to Xanthomonas spp. Int. J. Syst. Evol. Microbiol. 1987;37:136–143. [Google Scholar]
  43. Yoon S., Lee W.-H. Spatial analysis of climatic and dispersion characteristics of Xylella fastidiosa outbreak by insect vectors. J. Asia-Pac. Entomol. 2023;26:102011. [Google Scholar]

Articles from The Plant Pathology Journal are provided here courtesy of The Korean Society of Plant Pathology

RESOURCES