Deciphering the Inflammatory Network in Pediatric Recurrent Tonsillitis: The Role of TRAF6, IRAK1, and miR‐146a‐5p

Abstract

Objective

To investigate the role of TNF receptor‐associated factor 6 (TRAF6), interleukin 1 receptor‐associated kinase 1 (IRAK1), and miR‐146a‐5p expression levels in the pathogenesis of recurrent tonsillitis.

Study Design

Case‐control study.

Setting

The study was conducted at the Department of Otorhinolaryngology, Muğla Training and Research Hospital, a tertiary referral center.

Methods

This study included 60 pediatric patients (aged 2–18 years) who underwent tonsillectomy according to American Academy of Otolaryngology–Head and Neck Surgery guidelines. 30 patients with recurrent tonsillitis were compared with 30 patients with tonsillar hypertrophy. Patients with chronic inflammatory diseases, recent steroid use, PFAPA syndrome, or asymmetric hypertrophy were excluded. Right palatine tonsil tissues were collected intraoperatively, and the mid‐portion was analyzed. Expression levels of TRAF6, IRAK1, and miR‐146a‐5p were quantified using real‐time polymerase chain reaction (qRT‐PCR). In silico analyses evaluated related molecular pathways and target gene interactions.

Results

TRAF6 and IRAK1 mRNA levels were significantly increased in the recurrent tonsillitis group compared with controls (fold change: 1.64 and 1.43; P = .043 and P = .034, respectively), whereas miR‐146a‐5p expression was significantly decreased (2.17‐fold; P = .012). Bioinformatic analysis identified nuclear factor kappa B (NF‐κB), interleukin‐1 (IL‐1), and Toll‐like receptor (TLR) signaling pathways. TRAF6, IRAK1, TLR4, epidermal growth factor receptor (EGFR), IL‐6, and chemokine ligand 8 (CXCL8) were identified as potential miR‐146a‐5p targets.

Conclusion

These findings suggest dysregulation of the TRAF6/IRAK1–miR‐146a‐5p axis in recurrent tonsillitis. While miR‐146a‐5p may represent a potential target within TLR/NF‐κB–related pathways its therapeutic relevance remains speculative and requires validation through functional and translational studies.

Tonsillary diseases, especially recurrent tonsillitis, commonly affect children and young adults. Tonsillectomy is often performed for recurrent infections, airway obstruction, suspected malignancy, or swallowing difficulties. ¹ In children, adenotonsillar hypertrophy can lead to breathing problems, difficulty eating, poor weight gain, snoring, and developmental issues of the face and jaw. ² , ³ Recurrent tonsillitis remains a common indication for tonsillectomy in children; however, obstructive sleep‐disordered breathing, including obstructive sleep apnea, is also a major indication in current clinical practice. ⁴ , ⁵

Inflammation and immune responses in tonsillar tissue underlie recurrent tonsillitis. Host recognition of foreign molecules via toll‐like receptors (TLRs) triggers cytokine‐ and chemokine‐mediated responses, recruiting adaptor proteins such as interleukin‐1 receptor‐associated kinases (IRAKs) and tumor necrosis factor receptor‐associated factors (TRAFs) to activate signaling cascades. This TLR‐mediated cascade, primarily through NF‐κB activation, drives pathogenesis, with key molecules TRAF6 and IRAK1 regulating NF‐κB and controlling pro‐inflammatory gene expression. ⁶ , ⁷ TRAF6 acts as a ubiquitin E3 ligase, facilitating the initiation of transcriptional responses triggered by receptors responding to diverse exogenous and endogenous stimuli. In the TLR/NF‐κB signaling pathway, TRAF6 functions in concert with IRAK1. Moreover, TRAF6 is integral to MyD88‐dependent IL‐1 and TLR signaling pathways. Upon receptor‐ligand binding, IL‐1 receptors and TLRs transmit signals intracellularly via IRAKs ⁸ , ⁹ (Figure 1).

Figure 1.

Role of IRAK1 and TRAF6 in the TLR/IL1‐R signaling pathway and their regulation by miR‐146a‐5p (Created with Biorender.com).

While multiple inflammatory pathways drive recurrent tonsillitis, this study focuses on TRAF6 and IRAK1 as key adaptor proteins in TLR and IL‐1R signaling. ¹⁰ , ¹¹ , ¹² These cascades are critical for NF‐κB activation, a central regulator of pro‐inflammatory gene expression. ¹³ In children, an immature adaptive immune system renders the innate response primary, with TLRs detecting pathogens and recruiting TRAF6 and IRAK1, whose activation triggers NF‐κB‐mediated cytokine and chemokine production, initiating inflammation. ¹⁴ Dysregulation or overactivation of this pathway may lead to recurrent infections in tonsillar tissues, with TRAF6 and IRAK1 serving as key mediators of excessive inflammation.

miR‐146a‐5p is crucial for TLR/NF‐κB‐mediated innate immunity, negatively regulating inflammatory responses. Its expression in helper T cells increases via NF‐κB upon stimulation with microbial components (e.g., LPS) or cytokines (IL‐1β, TNF‐α). ¹⁵ miR‐146a may affect various signaling pathways such as TNF, NF‐κB, MEK‐1/2, and JNK‐1/2 by regulating the activity of adaptor proteins such as IRAK1, IRAK2, and TRAF6. ¹⁶ , ¹⁷

Methods

Study Population

Patients meeting surgical indications and providing written informed consent underwent tonsillectomy at Muğla Training and Research Hospital between 2023 and 2024. Tonsillectomy indications were determined in accordance with the pediatric tonsillectomy guidelines of the American Academy of Otolaryngology–Head and Neck Surgery. ⁵ The recurrent tonsillitis group comprised patients with a clear indication for tonsillectomy based on the established surgical criteria defined by Jack L Paradise et al., including ≥7 episodes in the preceding year, ≥5 episodes per year for two consecutive years, or ≥3 episodes per year for three consecutive years. ¹⁸ The control group consisted of patients without a history of recurrent infection but with a clinical indication for tonsillectomy due to obstructive symptoms related to tonsillar hypertrophy, including respiratory compromise, obstructive sleep apnea, or feeding difficulties persisting for ≥3 months. Thirty patients were included in each group: recurrent tonsillitis and tonsillar hypertrophy without recurrent infections, respectively.

Inclusion criteria comprised patients aged 2–18 years who underwent tonsillectomy and for whom written informed consent was obtained from a parent or legal guardian. In addition, verbal or written assent was obtained from children aged ≥7 years when developmentally appropriate. All consent procedures were conducted in Turkish, which was required for participation.

Exclusion criteria included age <2 or >18 years; tonsillectomy performed for indications other than recurrent tonsillitis or tonsillar hypertrophy; the presence of chronic inflammatory or systemic diseases, including autoimmune disorders (e.g., rheumatoid arthritis, systemic lupus erythematosus), chronic respiratory diseases (e.g., asthma), primary or secondary immunodeficiency, and periodic fever syndromes such as periodic fever, aphthous stomatitis, pharyngitis, and adenitis (PFAPA); recent systemic steroid use (within the past 3 months); and asymmetric tonsillar hypertrophy or suspected malignancy. Upon inclusion, patients’ age, sex, allergy status (including medication, food, and environmental allergies), and tonsil‐related symptoms—such as recurrent infections, snoring, and swallowing difficulties—were recorded in a detailed case follow‐up form. The study protocol was approved by Muğla Sıtkı Koçman University Faculty of Medicine Medical Ethics Committee (7/XIII numbered decision), and written informed consent was taken from all participants.

Sample size estimation was performed using G*Power (version 3.1.9.7). Based on an effect size (Cohen's d) of 0.85 derived from previous literature, ¹⁹ with a significance level (α) of 0.05 and a desired power of 0.85, a minimum of 26 participants per group was required. In the present study, 30 participants were included in each group. Post‐hoc power analysis revealed that, with the achieved sample size, the study had approximately 91.2% power, indicating sufficient statistical strength.

Tissue Collection

To minimize potential interactions, all patients received identical anesthetic drugs. Tonsillectomies were performed by the same senior surgeon using a standard cold dissection technique in the Rose position, targeting the right tonsil. Immediately after excision, specimens were divided into superior, middle, and inferior portions. The middle portion was preserved in RNAlater at –80°C for molecular analysis, while the superior and inferior portions were used for pathological evaluation.

Gene Expression Analysis

Total RNA was isolated from tonsillar tissues (50 mg of tissue) with a Hibrigen Total RNA Isolation kit (Cat. No: MG‐RNA‐01‐250). Total RNA was transcribed into cDNA according to the High‐Capacity A.B.T.™ cDNA Synthesis Kit with RNase Inhibitor. (Cat. No: A.B.T.™, C02‐01‐20) Kit's instructions. The TRAF6, IRAK1, and miR‐146a‐5p were amplified according to the 2X SYBR Green qPCR Mix (Cat. No: NGMM007) reagent kit's instructions under the ABI StepOne™ Real‐Time PCR System. GAPDH for TRAF6 and IRAK1, and U6 for miR‐146a‐5p were used as endogenous controls (Table 1). The relative gene expression was evaluated by the $2^{-\mathrm{\Delta \Delta }{C}_{\mathrm{T}}}$ method and was obtained from at least three independent experiments. ²⁵

Table 1.

TRAF6, IRAK1, miR‐146a‐5p, GAPDH, U6 Genes qPCR Primer Sequences

Gene/RNA	Primer sequences	Reference
TRAF6	F: 5’‐TCTGAAAGTGACTGCTGTGTG‐3’ R: 5’‐ACTGCTTCTCTGAATGCCTAC‐3'	20
IRAK1	F: 5’‐TCAGCTTTGGGGTGGTAGTG‐3’ R: 5’‐TAGATCTGCATGGCGATGGG‐3'	21
miR‐146a‐5p	F: 5’‐ TGAGAACTGAATTCCATGGGTT‐3’ R: 5’‐ GCTGTCAACGATACGCTACGTAAC‐3'	22
GAPDH	F: 5’‐ GAAGGTGAAGGTCGGAGTC‐3’ R: 5’‐ GAAGATGGTGATGGGATTTC‐3'	23
U6	F: 5’‐CTCGCTTCGGCAGCACA‐3’ R: 5’‐AACGCTTCACGAATTTGCGT‐3'	24

In Silico Analysis

Our study design and findings were further supported by several in silico analyses. (Figure 2). In each analysis, the default cut‐offs and parameters were considered. We used the STRING database (https://string-db.org/) to investigate possible interactions between TRAF6 and IRAK1 within the proposed network, with a medium confidence score threshold (0.400) serving as the lower bound for inclusion. ²⁶ It has been discovered that TRAF6 and IRAK1 interact to three different degrees. Furthermore, pathways associated with the identified networks have been found to have functional enrichment, as reported by STRING. Functional enrichment analysis, statistical significance was evaluated using False Discovery Rate (FDR) values corrected for multiple testing by the Benjamini–Hochberg method, as provided by the database.

Figure 2.

Flowchart of in silico analyses to determine the effects of TRAF6, IRAK1 and miR‐146a‐5p in the pathogenesis of recurrent tonsillitis (Created with Biorender.com).

We used DisGeNET (https://www.disgenet.org/home/) to identify genes associated with tonsillitis (C0040425) and searched the list for STRING network members. To measure the strength of the relationship, this tool provides a Gene‐Disease Association (GDA) score ranging from 0 to 1. A score is determined by considering the number of publications that establish the relationship and the diversity and amount of supporting sources. ²⁷

We used miRDB (http://www.mirdb.org/) and miRSystem (http://mirsystem.cgm.ntu.edu.tw/) to predict potential genes. We evaluated interactions between miR‐146a‐5p target genes and proteins in the STRING network and the DisGeNET list. ²⁸ , ²⁹ This allowed us to identify potential miRNA–gene interactions that may be associated with the expression or activity of these proteins and thereby influence the development of recurrent tonsillitis. As part of our investigation, we used miRPathDB v2.0 (https://mpd.bioinf.uni-sb.de/overview.html)) to explore possible associations between miR‐146a‐5p and tonsillitis‐related pathways. ³⁰

Statistical Analysis

To analyze the obtained gene expression data and participants’ demographic data, we used SPSS 22 for Windows (SPSS Inc.). The χ ² test was used for statistics of categorical variables. The normality of the data distribution was assessed using the Shapiro–Wilk test. The Independent Samples t‐test was used to evaluate differences between groups for continuous variables with normal distributions. Pairwise comparisons were performed using the Wilcoxon–Mann–Whitney test for continuous variables with a non‐normal distribution. Continuous variables were presented as mean ± standard deviation for normally distributed data, and as median with interquartile range (IQR) for non‐normally distributed data. If the p‐value was less than 0.05, it was deemed statistically significant. To determine the effect size, Rosenthal's formula was used for the Mann‐Whitney U test, and Cramer's V was calculated for Pearson's χ ² test. Linear regression was used to evaluate the association between a continuous dependent variable and multiple independent variables.

Results

Demographic Data of the Participants

No significant differences were observed between the recurrent tonsillitis and tonsillar hypertrophy groups regarding age, sex, complications, or food allergy (P > .05). Tonsillar hypertrophy was graded using the Brodsky staging system. Right and left tonsil sizes were significantly larger in the hypertrophy (control) group compared to the recurrent tonsillitis (study) group (P < .001). None of the patients had chronic diseases or were on medications, while allergy history was reported in 4 study and 10 control patients (P = .067). The demographic characteristics of the participants are presented in detail (Table 2).

Table 2.

Demographic Data of Participants

Parameters	Recurrent tonsillitis (n = 30)	Tonsillar hypertrophy (n = 30)	P value	Effect size
Age, mean ± SD	7.30 ± 3.04	7.23 ± 3.84	.612*	0.076a
Sex, n (%)
Female	16 (53.33)	19 (63.33)
Male	14 (46.67)	11 (36.67)	.194**	0.168b
Allergy history, n (%)
No	26 (86.67)	20 (66.67)
Yes	4 (13.33)	10 (33.34)	.067**	0.236b
Right tonsil grade, n (%)
Grade 2	21 (70)	4 (13.34)
Grade 3	7 (23.33)	15 (50)
Grade 4	2 (6.67)	11 (36.67)	<.001 **	0.587 b
Left tonsil grade, n (%)
Grade 2	20 (66.67)	3 (10)
Grade 3	9 (30)	12 (40)
Grade 4	1 (3.33)	15 (50)	<.001 **	0.649 b

Note: Allergy history includes medication, food, and environmental allergies. There is no statistically significant difference between groups in age, sex, and allergy history. When groups were compared for tonsillar hypertrophy, there was a statistically significant difference between grade 4 tonsils on both the right and left sides indicated in bold; however, there was no statistically significant difference between grade 2 and 3 tonsils on either side.

Abbreviation: SD, standard deviation.

^a R effect size value.

^b Cramér's V value.

^*Mann‐Whitney U test.

^**Pearson χ ² test.

TRAF6, IRAK1 Genes and miR‐146a‐5p Expression Levels

TRAF6 expression was significantly higher in the recurrent tonsillitis group compared to the tonsillar hypertrophy group (median: 9.81 [IQR: 4.61‐14.67] vs 5.98 [2.88‐9.93]; P = .043, r = 0.26). Similarly, IRAK1 expression levels were significantly elevated in the recurrent tonsillitis group (median: 2.67 [1.89‐3.49] vs 1.86 [1.47‐2.40]; P = .034, r = 0.27). In contrast, miR‐146a‐5p expression was significantly lower in the recurrent tonsillitis group compared to the tonsillar hypertrophy group (median: 3.72 [2.64‐6.81] vs 8.09 [4.86‐14.49]; P = .012, r = −0.32). Differences in TRAF6, IRAK1, and miR‐146a‐5p expression between groups were statistically significant (Table 3, Figure 3).

Table 3.

TRAF6, IRAK1 and miR‐146a‐5p Expression Levels

	Recurrent tonsillitis (n = 30)		Tonsillar hypertrophy (n = 30)
Genes/miRNA	Median [%25‐%75]	Mean ± SD	Median [%25‐%75]	Mean ± SD	P * value	Effect size value**
TRAF6	9.81 [4.61‐14.67]	9.82 ± 5.95	5.98 [2.88‐9.93]	6.28 ± 3.90	.043	0.26
IRAK1	2.67 [1.89‐3.49]	4.11 ± 3.79	1.86 [1.47‐2.40]	2.53 ± 1.97	.034	0.27
miR‐146a‐5p	3.72 [2.64‐6.81]	5.35 ± 4.03	8.09 [4.86‐14.49]	10.51 ± 8.11	.012	−0.32

Abbreviation: SD, standard deviation.

^*Mann‐Whitney U test.

^**R effect size.

Figure 3.

Expression levels of TRAF6, IRAK1, and miR‐146a‐5p in recurrent tonsillitis (n = 30) and tonsillar hypertrophy (n = 30). Median (IQR) values compared by Mann‐Whitney U test showed significance for (A) TRAF6 (P = .043), (B) IRAK1 (P = .034), and (C) miR‐146a‐5p (P = .012).

In Silico Analysis

We identified TRAF6 and IRAK1 protein interaction networks at three possible levels (Table 4). We performed enrichment analysis for each interaction network using the Gene Ontology (GO) and KEGG pathway databases. We have only shown the first two prominent processes in the table. It consisted of a total of 11 genes in the first‐level network analysis (TRAF6‐IRAK1). In the first level network analysis (TRAF6‐IRAK1), “Activation of NF‐kappaB‐inducing kinase activity” and “interleukin‐1‐mediated signaling pathway” were among the terms that enriched cellular processes. According to KEGG analysis, at this level, the “Toll‐like receptor signaling pathway” and “NF‐kappa B signaling pathway” enriched. In the second‐level and third‐level network analyses, inflammation‐related terms were again included, supporting our experimental hypothesis. There were 11 genes at both levels. IL‐17, IL‐1, and TLR signaling pathways were among the enriched terms. Our results show that TRAF6 and IRAK1 genes are effective in inflammation‐related cellular processes.

Table 4.

Functional Enrichments of Networks Based on TRAF6 and IRAK1 Interactions

	Network	Proteins	Network stats	Database	Description	Strengtha	FDRb
1		TRAF6 IRAK1	number of nodes: 2 number of edges: 1 average node degree: 1 avg. local clustering coefficient: 1 expected number of edges: 0 PPI enrichment p‐value: 0.0614	Gene Ontology	GO:0007250 Activation of inverappaB‐inducing kinase activity	3.04	0.0154
					GO:0070498 interleukin‐1‐mediated signaling pathway	2.99
				KEGG Pathways	hsa04620 Toll‐like receptor signaling pathway	2.29	0.0043
					hsa04064NF‐kappa B signaling pathway
2		TRAF6 TRAF5 TIFA UBE2N TAB1 UBE2V1 TLR3 IRAK2 TAB2 TBK1 ECSIT	number of nodes: 11number of edges: 45average node degree: 8.18avg. local clustering coefficient: 0.887expected number of edges:12PPI enrichment p‐value: 8.15e‐14	Gene Ontology	GO:0097400 interleukin‐17‐mediated signaling pathway	2.71	0.0070
					GO: 0007250Activation of NF‐kappaB‐inducing kinase activity	2.6	0.0153
				KEGG Pathways	hsa04620 Toll‐like receptor signaling pathway	1.95	2.95e−07
					hsa04657 IL‐17 signaling pathway	1.90	6.84e−06
3		IRAK1 IRAK2 TRAF6 CHUK TRAPTOLLIP IL1R1 TAB2 IRAK4 MYD88	number of nodes: 11 number of edges: 53 average node degree: 9.64avg. local clustering coefficient: 0.968 expected number of edges: 12 PPI enrichment p‐value: <1.0e‐16	Gene Ontology	GO:0070498 interleukin‐1‐mediated signaling pathway	2.8	2.00e−14
					GO:0002755 MyD88‐dependent toll‐like receptor signaling pathway	2.71	1.31e−11
				KEGG Pathways	hsa04620 ‐ Toll‐like receptor signaling pathway	2.21	6.32e−17
					hsa04064 NF‐kappa B signaling pathway	2.2	6.32e−17
			aStrength: Log10(observed/expected). This measure describes how large the enrichment effect is. It's the ratio between (i) the number of proteins in your network that are annotated with a term and (ii) the number of proteins that we expect to be annotated with this term in a random network of the same size. bFalse Discovery Rate: This measure describes how significant the enrichment is. Shown are p‐values corrected for multiple testing within each category using the Benjamini–Hochberg procedure.

We reported 49 genes associated with recurrent tonsillitis in the DisGeNET database. As reported by miRSystem, 366 target genes were predicted for miR‐146a‐5p. Among these target genes, TRAF6 and IRAK1 were the most highly expressed. When searching the target list for genes in STRING networks, TRAF6 and IRAK1, SMAD, IGSF1, CD79B, CD80, CD86, LTB, CCL5, CCR9, and EDARADD genes were among the target genes for miR‐146a‐5p. These genes were involved in inflammation‐related signaling pathways, including TGFB, Th17 differentiation, TLR, TNF, and NFKB signaling. miRDB predicted a total of 488 targets for miR‐146a‐5p, including TRAF6 and IRAK1 (Target score 100/100). The PRCP gene on the DisGeNET tonsillitis disease list was a target of miR‐146a‐5p in miRDB (Target score 74/100).

We also searched the KEGG database using miRPathDB and identified sixteen pathways through which miR‐146a‐5p may affect genes. Only inflammation‐related interactions with strong experimental evidence for the pathogenesis of recurrent tonsillitis were reported (Table 5). Among the genes of these predicted target pathways, TLR4, EGFR, IL6, and CXCL8 were also identified as tonsillitis‐related genes by DisGeNET.

Table 5.

Results of the Enrichment Analysis KEGG Pathway Database According to miRPathDB for miR‐146a‐5p

Pathway	P value	Targets
Toll‐like receptor signaling pathway	5.86e−6	CCL5, CD80, CXCL8, FADD, IL6, IRAK1, NFKB1, RAC1, STAT1, TLR2, TLR4, TRAF6
NF‐kappa B signaling pathway	9.91e−5	CD40LG, CXCL12, CXCL8, ICAM1, IRAK1, NFKB1, PTGS2TLR4, TRAF6
Chemokine signaling pathway	4.28e−4	CCL5,CXCL12,CXCL8,CXCR4,NFKB1,RAC1,RHOA, ROCK1,SOS1,STAT1
Herpes simplex infection	.003	CCL5, FADD, FAS, IL6, NFKB1, STAT1, TLR2, TRAF6
Cytokine‐cytokine receptor interaction	.005	CCL5, CD40LG,CXCL12,CXCL8,CXCR4,EGFR, FAS,IL6,TGFB1
Influenza A	.005	CCL5, CXCL8,FAS,ICAM1,IL6,NFKB1,STAT1,TLR4
TNF signaling pathway	.005	CASP7, CCL5,FADD, FAS,ICAM1,IL6,NFKB1,PTGS2
FoxO signaling pathway	.007	CCND1,CCND2,EGFR,IL6,SMAD2,SMAD4,SOS1,TGFB1
NOD‐like receptor signaling pathway	.007	CCL5, CXCL8, IL6, NFKB1, TRAF6
RIG‐I‐like receptor signaling pathway	.007	CXCL8, FADD, NFKB1, SIKE1, TRAF6
Notch signaling pathway	.011	LFNG, NOTCH1,NOTCH2,NUMB
PI3K‐Akt signaling pathway	.013	BRCA1,CCND1,CCND2,EGFR,IL6,LAMC2,NFKB1, RAC1,SOS1,TLR2,TLR4
Staphylococcus aureus infection	.020	CFH, ICAM1
TGF‐beta signaling pathway	.022	RHOA, ROCK1,SMAD2,SMAD4,TGFB1
Pathogenic Escherichia coli infection	.029	RHOA, ROCK1,TLR4
MAPK signaling pathway	.044	DUSP1, EGFR, FAS, NFKB1, RAC1, SOS1, TGFB1, TRAF6

Discussion

While the roles of TRAF6, IRAK1, and miR‐146a‐5p in TLR/NF‐κB signaling have been previously described, the novelty of the present study lies in evaluating this regulatory axis specifically in pediatric recurrent tonsillitis and comparing it with tonsillar hypertrophy without clinically defined recurrent infection. Unlike previous studies focusing on isolated components, our study simultaneously examines both upstream regulators (miR‐146a‐5p) and downstream signaling mediators (TRAF6 and IRAK1) within the same clinical context. This integrative approach provides new insights into the potential dysregulation of this pathway in recurrent tonsillitis and highlights its possible role in distinguishing inflammatory versus hypertrophic tonsillar pathology. In this context, our results demonstrated that TRAF6 and IRAK1 expression levels were significantly higher in the recurrent tonsillitis group compared to the tonsillar hypertrophy group (TRAF6: 9.81 vs 5.98, P = .043, r = 0.26; IRAK1: 2.67 vs 1.86, P = .034, r = 0.27), whereas miR‐146a‐5p expression was significantly lower (3.72 vs 8.09, P = .012, r = −0.32).

The modest fold changes observed in this study may reflect the heterogeneity of tonsillar tissue and the clinical nature of the samples. While even moderate alterations in regulatory molecules may have biological relevance, these findings should be interpreted with caution and require further validation.

Although the roles of TRAF6, IRAK1, and miR‐146a‐5p in TLR/NF‐κB signaling are well established, their integrated expression profile in recurrent tonsillitis has not been systematically evaluated. In this study, we identify a coordinated pattern of increased TRAF6 and IRAK1 expression, accompanied by decreased miR‐146a‐5p levels, in pediatric tonsillar tissue, suggesting a context‐specific regulatory imbalance rather than isolated molecular changes.

TRAF6 and IRAK1 are well‐established mediators in inflammatory pathways; previous studies investigating these molecules in inflammatory conditions such as sepsis have reported findings consistent with our results. ³¹ , ³² TRAF6 is also implicated in autoimmune diseases such as systemic lupus erythematosus and rheumatoid arthritis, where increased expression contributes to pathogenesis. ³³ , ³⁴ Similarly, IRAK1 has been implicated in inflammatory responses; in sepsis models, IRAK1 deficiency improves survival, and its silencing attenuates organ injury. ³⁵ , ³⁶ Additionally, IRAK1 has been reported to be upregulated in autoimmune conditions such as systemic lupus erythematosus, with expression levels correlating with disease activity. ³⁷ Consistent with these observations, TRAF6 and IRAK1 expression levels were higher in the recurrent tonsillitis group, supporting their roles as pro‐inflammatory signaling mediators.

miR‐146a suppresses proinflammatory cytokine expression (e.g., TNF, IL‐6, IL‐1β, IL‐2). ³⁸ , ³⁹ In hemoglobin‐induced inflammatory models, miR‐146a attenuates IRAK1/TRAF6‐mediated signaling, reducing proinflammatory responses, consistent with its regulatory role observed in our study. ⁴⁰ Similarly, in other studies, miR‐146a attenuates inflammation by downregulating TRAF6 and IRAK1, ameliorating experimental colitis in ulcerative colitis models, and reducing myocardial injury in sepsis‐induced dysfunction. ⁴¹ , ⁴² Additionally, consistent with previous studies showing that miR‐146a‐5p downregulation is associated with increased oxidative stress, decreased miR‐146a‐5p expression in recurrent tonsillitis may contribute to both enhanced NF‐κB–mediated inflammation and impaired mucosal defense, potentially increasing susceptibility to recurrent infections. ⁴³ , ⁴⁴

Our findings further support this regulatory axis, as the significantly lower miR‐146a‐5p levels in recurrent tonsillitis patients were accompanied by an inverse expression pattern of TRAF6 and IRAK1. Consistent with database predictions (miRDB, miRSystem‐ target score 100/100) and previous reports describing miR‐146a‐5p as a negative regulator of inflammation via targeting TRAF6 and IRAK1, ⁴⁵ , ⁴⁶ , ⁴⁷ these findings are in line with previously reported regulatory relationships. However, causal relationships cannot be established solely from gene expression analysis. The concurrent downregulation of miR‐146a‐5p and upregulation of TRAF6 and IRAK1 may reflect dysregulation of NF‐κB–related pathways, warranting further functional and protein‐level validation.

The findings from this study not only reveal statistically significant differences but also provide important clues about the potential roles of TRAF6, IRAK1, and miR‐146a‐5p in the pathogenesis of recurrent tonsillitis. Changes in the expression levels of these molecules indicate that they effectively regulate the inflammatory response, consistent with previous literature. Our findings suggest that targeting these molecular pathways could lead to the development of new approaches to treat recurrent tonsillitis.

Recurrent tonsillitis in children represents a significant clinical burden due to frequent infections, repeated antibiotic use, and potential early surgical intervention. While this study does not establish therapeutic strategies, the identification of a dysregulated miR‐146a‐5p/TRAF6/IRAK1 axis provides a basis for future targeted approaches to modulate TLR‐mediated inflammation. If validated, such approaches may reduce disease burden and reliance on antibiotics and surgery.

This study has several limitations. The tonsillar hypertrophy group may not represent a completely non‐inflammatory control population, as children with obstructive symptoms may have underlying or prior inflammatory processes even in the absence of clinically apparent recurrent tonsillitis. However, given the high prevalence of upper respiratory tract infections in the pediatric population, some degree of inflammatory exposure is expected in both groups; the key distinction lies in the frequency and cumulative burden of infections, which is substantially higher in the recurrent tonsillitis group. Therefore, any potential overlap is more likely to attenuate the observed differences, suggesting that the reported associations may represent a conservative estimate of the true effect size. Additionally, further investigations, including healthy children who do not meet surgical criteria, are needed to validate these findings. The use of tonsillar hypertrophy as a comparison group was based on ethical and practical considerations, as tonsillar tissue cannot be obtained from completely healthy individuals without a clinical indication. All samples were obtained from patients undergoing tonsillectomy for established clinical reasons, and no procedures were performed for research purposes. Although tonsillar hypertrophy may exhibit some degree of inflammatory activity, it represents a clinically relevant comparison group distinct from recurrent tonsillitis, particularly in the absence of a history of recurrent infection. Moreover, protein‐level confirmation by western blotting or immunohistochemistry was not performed. In addition, functional validation experiments, including dual‐luciferase reporter assays, were not conducted; therefore, although the observed inverse expression pattern and in silico analyses suggest a potential regulatory association, these findings require confirmation at the protein level. Future studies incorporating protein‐level, functional, and cell‐specific analyses are warranted to provide a more comprehensive understanding of their role in recurrent tonsillitis. Although the observed expression differences may be influenced by underlying inflammatory activity, patients with acute infection findings and chronic systemic diseases were excluded to minimize nonspecific inflammatory effects, and a clinically relevant comparison group (tonsillar hypertrophy) was used. While subclinical inflammatory processes cannot be entirely excluded, such effects are expected to be limited and likely distributed across groups; therefore, the findings should be interpreted as context‐dependent associations rather than definitive disease‐specific alterations. As expected, a history of frequent antibiotic use was present in the recurrent tonsillitis group, whereas it was not observed in the tonsillar hypertrophy group; however, the precise timing of recent antibiotic exposure and infection episodes could not be standardized, although this is unlikely to have materially influenced the overall interpretation of the findings. Finally, the absence of histological or immunohistochemical analyses limits the ability to identify the specific cellular sources of IRAK1 and TRAF6 within tonsillar tissue. Future studies incorporating protein‐level and cell‐specific analyses are warranted to provide a more comprehensive understanding of their role in recurrent tonsillitis.

Conclusion

Recurrent tonsillitis is associated with upregulated TRAF6 and IRAK1 and downregulated miR‐146a‐5p, indicating a dysregulated inflammatory response. In silico analysis identified TRAF6, IRAK1, TLR4, IL6, CXCL8, CD80, CD86, and SMAD as key targets in immune and inflammatory pathways contributing to disease pathogenesis. These findings highlight potential molecular targets for therapeutic intervention. Future studies incorporating immunohistochemical and functional analyses are needed to clarify cellular sources and validate miR‐146a‐5p as a potential therapeutic target.

Author Contributions

Omer Faruk Guzel, investigation, resources, writing‐original draft, visualization; Cilem Ozdemir, investigation, writing‐original draft, visualization; Ozan Gokdogan, conceptualizaton, resources, writing‐original draft and editing, supervision, project administration; Tuba Edgunlu, investigation, conceptualizaton, writing—original draft and editing. All authors read and approved the final version of the manuscript.

Disclosures

Competing interests

The authors have no funding, financial relationships, or conflicts of interest to disclose.

Funding source

The research was supported by the Muğla Sıtkı Koçman University Research Support and Funding Office (23/155/01/3/4) for providing the kits and materials used. The funder had no role in the study design, data collection, analysis, interpretation, manuscript preparation, or decision to submit for publication.