Bovine milk-derived osteopontin attenuates hyperoxia-induced lung injury associated with NLRP3 inflammasome regulation in neonatal mice with bronchopulmonary dysplasia

Abstract

Background

Bronchopulmonary dysplasia (BPD) is a major complication of prematurity, and effective preventive strategies remain limited. This study aimed to investigate the protective effect of osteopontin (OPN) supplementation on hyperoxia (Hyp)-induced BPD and its underlying mechanisms.

Methods

Newborn mice were randomly assigned to Control, Hyp, and Hyp + OPN groups. From postnatal day 0 (P0) to P14, mice were exposed to 21% or 75% O₂. The Hyp + OPN group received OPN (300 mg/kg) daily by gavage. Lung structure was assessed by hematoxylin and eosin (H&E) staining, mean linear intercept (MLI), and radial alveolar count (RAC). Cell proliferation and angiogenesis were evaluated by detecting Ki67 and CD31, respectively. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and Western blotting were used to analyze markers of inflammation, oxidative stress, and nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) inflammasome-related molecules. The number of TUNEL-positive cells was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL).

Results

Hyp exposure significantly inhibited body weight gain in newborn mice, leading to simplified alveolar structure, thickened alveolar septa, and impaired pulmonary vascular development. These changes were reflected by increased MLI, decreased RAC, reduced Ki67-positive cells, and fewer CD31-positive vessels. Hyp also induced a heightened inflammatory response, elevated oxidative stress levels, and increased expression of NLRP3 inflammasome-related molecules, accompanied by an increased number of TUNEL-positive cells. OPN intervention partially restored body weight, alleviated hyperoxia-induced lung pathological changes, improved morphometric parameters (decreased MLI and increased RAC), enhanced cell proliferation and vascular-associated changes, and reduced inflammation, oxidative stress, NLRP3 inflammasome activation, and the number of TUNEL-positive cells.

Conclusions

Exogenous bovine milk-derived OPN supplementation alleviates hyperoxia-induced lung injury, partially improves alveolar and vascular-associated changes, reduces inflammatory responses and oxidative stress levels, and is associated with reduced expression of NLRP3 inflammasome-related molecules in a neonatal mouse model of hyperoxia-induced BPD. These findings support the potential of OPN supplementation as a candidate intervention strategy for BPD prevention and management.

Highlight box.

Key findings

• Bovine milk-derived osteopontin (OPN) supplementation alleviated hyperoxia-induced lung injury in neonatal mice, accompanied by improved alveolar and vascular-associated changes and reduced inflammation, oxidative stress, and expression of NLRP3 inflammasome-related molecules.

What is known and what is new?

• Hyperoxia-induced oxidative stress and inflammation contribute importantly to bronchopulmonary dysplasia (BPD), and OPN has recognized immunomodulatory and tissue-protective properties.

• This study provides experimental evidence that exogenous bovine milk-derived OPN supplementation attenuates hyperoxia-induced BPD-like lung injury in neonatal mice and is associated with reduced expression of NLRP3 inflammasome-related molecules.

What is the implication, and what should change now?

• These findings support further investigation of bovine milk-derived OPN as a potential nutritional intervention for BPD, while additional preclinical and clinical studies are required to establish its efficacy and underlying mechanisms.

Introduction

Bronchopulmonary dysplasia (BPD) is the most common and severe respiratory complication in preterm infants (1). It is also a major cause of long-term respiratory dysfunction, neurodevelopmental impairment, and even death in this population (2). With advances in perinatal medicine, the survival rate of very preterm infants has enhanced significantly, but the incidence of BPD has risen year by year (3). Currently, the core pathological features of BPD have shifted from traditional airway fibrosis and smooth muscle hyperplasia to arrested alveolar development and impaired pulmonary microvascular angiogenesis (4). No specific preventive or therapeutic measures are available, and clinical management remains largely symptomatic and supportive, placing a heavy medical burden on families and society (5).

Exposure to high concentrations of oxygen is one of the key risk factors for the development and progression of BPD (6). Lung tissues of preterm infants are immature at birth, and these infants often require mechanical ventilation and high oxygen support to sustain life (7). However, sustained hyperoxia (Hyp) exposure can induce oxidative stress imbalance and excessive inflammatory cascades in the lung tissue (8). These events subsequently lead to alveolar epithelial cell injury and apoptosis, as well as arrested alveolar and microvascular development, ultimately resulting in BPD-like pathological changes (9). Previous research has confirmed that the nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) inflammasome is a hub mediating innate immune inflammatory responses (10). The NLRP3 inflammasome can be activated by danger signals such as Hyp-induced reactive oxygen species (ROS) (11). Upon activation, it recruits the apoptosis-associated speck-like protein containing a CARD (ASC) and activates cysteinyl aspartate specific proteinase 1 (caspase-1) (12). This process facilitates the release of pro-inflammatory cytokines interleukin-1β (IL-1β), amplifying the inflammatory response and inducing apoptosis (13). Thus, the NLRP3 inflammasome has a crucial role in the pathogenesis of BPD (14). Targeting the NLRP3 inflammasome pathway to inhibit Hyp-induced lung inflammation and oxidative stress damage represents an important research direction for BPD prevention and treatment.

Osteopontin (OPN) is a highly glycosylated secreted phosphoprotein widely distributed in various tissues and body fluids, including milk, kidney, and bone (15). Breast milk is an important source of OPN (16). The concentration of OPN in breast milk is much higher than that in conventional infant formula, and its abundance is highest in colostrum, making it one of the core active functional proteins in breast milk (17). Existing studies have shown that OPN participates in modulating cell proliferation, differentiation, migration, immune regulation, and tissue repair (18,19). It is also involved in intestinal barrier protection and maintenance of immune homeostasis (20). Recent studies have found that OPN exerts anti-inflammatory, antioxidant, and tissue repair effects in respiratory disorders such as acute lung injury and pulmonary fibrosis (21,22). However, whether exogenous bovine milk-derived OPN supplementation has a protective effect against Hyp-induced neonatal mouse BPD, and whether this effect involves regulation of the NLRP3 inflammasome pathway, have not yet been clearly reported.

Therefore, in this study, we established a classic hyperoxia-induced neonatal mouse model of BPD and administered exogenous bovine milk-derived OPN by gavage. We systematically observed the effects of OPN on lung tissue pathological injury, alveolar and vascular development, inflammatory responses, and oxidative stress levels in Hyp-exposed neonatal mice. Furthermore, we explored its regulatory effect on the NLRP3 inflammasome-related pathway. Our aim was to clarify the protective role of exogenous bovine milk-derived OPN supplementation against BPD and its underlying molecular mechanisms, thereby providing new experimental evidence and potential intervention strategies for BPD. We present this article in accordance with the ARRIVE reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0632/rc).

Methods

Animal housing and treatment

Female and male C57BL/6 mice aged 10 weeks were purchased from Vital River (Beijing, China) for breeding. All animal experiments were performed under a project license (approval No. XZ202601285) granted by the Animal Care and Use Committee of Hunan Evidence-based Biotechnology Co., Ltd., in compliance with the institutional guidelines for the care and use of animals. After 1 week of acclimatization with free access to food and water, adult mice were mated to generate newborn pups for subsequent experiments. At full term (gestational days 21–22), female mice delivered naturally. Male pups obtained from multiple litters were randomly allocated into three experimental groups (N=6/group). During allocation, pups from different litters were distributed among the Control, Hyp, and Hyp + OPN groups to ensure that each experimental group contained animals from multiple litters and to minimize potential litter-associated variations. The Control group, hyperoxia (Hyp) group, and hyperoxia plus OPN treatment (Hyp + OPN) group were established for subsequent experiments.

Newborn mice were treated from postnatal day 0 (P0) to postnatal day 14 (P14). The Control group was maintained under normoxic conditions (21% O₂), whereas the Hyp and Hyp + OPN groups were exposed to 75% O₂ as previously described (23). The Hyp + OPN group received bovine milk-derived OPN (300 mg/kg, purity >95%, Arla Foods Ingredients, Videbæk, Denmark) once daily by oral gavage throughout the hyperoxia exposure period (24). This OPN administration represented exogenous supplementation of purified bovine milk-derived OPN in addition to normal maternal nursing, rather than an intervention involving breast milk itself. The Control and Hyp groups received an equivalent volume of vehicle (0.9% saline) by oral gavage throughout the experimental period. All pups remained with nursing dams throughout the experimental period and were breastfed ad libitum. Three nursing dams were used during the experimental period and were rotated every 24 h between hyperoxic and normoxic environments to reduce maternal care-related bias, minimize oxygen toxicity, and ensure adequate nursing. At P14, mice were euthanized by intraperitoneal injection of 1% pentobarbital sodium (150 mg/kg). Lung tissues were harvested and photographed for gross morphological assessment, followed by subsequent histological and molecular analyses. Outcome assessment and data analysis were performed by investigators blinded to the group allocation.

Hematoxylin and eosin (H&E) staining

Lung tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and cut at 4 μm for staining. Tissue morphology was observed via H&E staining. Alveolar structure was analyzed utilizing mean linear intercept (MLI) and radial alveolar count (RAC) (25). MLI was used to evaluate alveolar airspace size and was calculated by dividing the total length of measurement lines by the number of intersections with alveolar septa. RAC was determined by drawing a perpendicular line from the center of the terminal bronchiole to the nearest connective tissue septum and counting the number of alveoli intersected by the line. For each animal, two randomly selected lung sections were analyzed, and five non-overlapping fields per section were randomly selected for morphometric measurements. All images were captured at 200× magnification and analyzed using ImageJ by investigators blinded to group allocation.

Immunohistochemistry (IHC)

Following deparaffinization and rehydration, antigen retrieval was achieved by heating the lung sections (4 μm) in citrate buffer (10 mM, pH 6.0) in a pressure cooker for approximately 10 min. After blocking endogenous peroxidase activity by 15-min incubation with 0.5% H₂O₂-methanol, 1.5% rabbit serum in phosphate-buffered saline (PBS) (ScienCell Research Laboratories, Carlsbad, USA) was applied for 30 min. Afterwards, sections were subjected to 1-h incubation at room temperature with anti-Ki67 (1:1,000, 28074-1-AP, Proteintech, Wuhan, China) and anti-CD31 (1:4,000, 28083-1-AP, Proteintech) antibodies. After incubation with primary antibodies, corresponding secondary antibodies were applied, and DAB staining was performed applying a Vectastain kit. The sections were then lightly counterstained with Harris hematoxylin. Images were captured via light microscopy at 100× magnification from 3 randomly selected non-overlapping fields per section. The same threshold settings were applied for all groups during ImageJ analysis. Positive staining signals were quantified by calculating the percentage of positively stained area relative to the total analyzed area. All image acquisition and quantification procedures were performed by investigators blinded to group allocation.

RT-qPCR assay

Total RNA was isolated from lung tissues utilizing Trizol reagent (15596026, Thermo Fisher, Waltham, USA) and then reverse-transcribed into complementary DNA (cDNA) employing an RT kit (CW2569, CWbio, Taizhou, China). qPCR was carried out applying UltraSYBR mixture (CW2601, CWbio) under the following conditions: 95 ℃ for 10 min, followed by 40 cycles of 95 ℃ for 15 s and 60 ℃ for 30 s. GAPDH was used as the internal reference gene. Relative expression was calculated based on the 2^−ΔΔCt method and normalized to the Control group. Primer sequences are displayed in Table 1.

Table 1. Primer sequences.

Gene	Direction	Sequence (5'-3')
SPC	F	GTCCTCGTTGTCGTGGTGAT
	R	GGGCTAGGCGTTTCTGAGTT
AQP5	F	AGCCTTATCCATTGGCTTGTCG
	R	CCTACCCAGAAGACCCAGTGA
FLK-1	F	CCTTCAGATTACTTGCAGGGGA
	R	TGCAGAAGATACTGTCACCACC
VEGF	F	AGCAGAAGTCCCATGAAGTGAT
	R	ATGTACTCTATCTCGTCGGGGT
TNF-α	F	GTCCCCAAAGGGATGAGAAGTT
	R	CACTTGGTGGTTTGTGAGTGTG
IL-6	F	TGATGGATGCTACCAAACTGGA
	R	TGTGACTCCAGCTTATCTCTTGG
IL-1β	F	GCCACCTTTTGACAGTGATGAG
	R	CAGGTCAAAGGTTTGGAAGCAG
GAPDH	F	CAGGAGAGTGTTTCCTCGTCC
	R	GATGGGCTTCCCGTTGATGA

F, forward; R, reverse.

Western blotting (WB)

Total protein was extracted from lung tissues applying RIPA lysis buffer (Beyotime, Shanghai, China) containing protease/phosphatase inhibitors (Solarbio, Beijing, China). Its concentration was tested employing the BCA method (Beyotime, China). After electrophoresis, transfer, and blocking, membranes underwent overnight incubation at 4 ℃ with anti-SPC (1:1,000, 10774-1-AP, Proteintech), anti-AQP5 (1:1,000, 20334-1-AP, Proteintech), anti-FLK-1 (1:1,000, A24671, Abclonal, Wuhan, China), anti-NLRP3 (1:1,000, A24294, Abclonal), anti-ASC (1:1,000, A1170, Abclonal), anti-Cleaved-Caspase-1 (1:1,000, HY-P80622, MedChemExpress, Monmouth Junction, USA) and anti-GSDMD-N (1:1,000, DF13758, Affinity Biosciences, Liyang, China) primary antibodies. After three washes, another incubation with goat anti-rabbit IgG secondary antibody (HRP-conjugated; 1:5,000, A0208, Beyotime) was conducted. Signals were detected using chemiluminescence. Semiquantitative analysis of protein expression signals was performed via ImageJ, with GAPDH (1:1,000, 2118, Cell Signaling Technology, Shanghai, China) as the loading control.

ROS detection

Fresh mouse lung sections were washed with PBS and incubated with ROS probe working solution (KANLANG ROS detection kit, KL1470516A, Shanghai, China) at 37 ℃ for 60 min in the dark. After three washes with PBS, sections were mounted with antifade mounting medium and images were captured using a fluorescence microscope at 200× magnification under identical acquisition settings. For quantitative analysis, 3 randomly selected non-overlapping fields from each section were analyzed. ROS-associated fluorescence intensity was quantified using ImageJ with identical threshold settings applied to all groups. The mean fluorescence intensity was calculated to represent ROS levels in lung tissues. Image acquisition and quantification were performed by investigators blinded to group allocation.

TUNEL assay

Paraffin-embedded lung sections were deparaffinized, rehydrated, and permeabilized with 0.1% Triton X-100 (5 min, at room temperature). Fluorescent TUNEL staining was then performed using a TUNEL tissue detection kit (C1089, Beyotime) according to the manufacturer’s instructions. After nuclear counterstaining with DAPI, sections were mounted with antifade mounting medium. Images were captured using a fluorescence microscope at 200× magnification under identical acquisition settings. At least 5 randomly selected non-overlapping fields per section were analyzed. The percentage of TUNEL-positive cells relative to the total number of DAPI-positive nuclei was calculated using ImageJ. Identical threshold settings were applied for all groups, and image acquisition and quantitative analysis were performed by investigators blinded to group allocation.

Enzyme-linked immunosorbent assay (ELISA) for inflammatory cytokines

Levels of tumor necrosis factor-α (TNF-α; E-EL-M3063, Elabscience, Wuhan, China), interleukin-6 (IL-6; PI326, Beyotime), and IL-1β (PI301, Beyotime) in mouse lung tissues were measured using commercial ELISA kits according to the manufacturers’ instructions.

Measurement of malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione (GSH)

Mouse lung tissues were rinsed with saline at 4 ℃ and blotted dry with filter paper. Then, 100 mg of lung tissue was homogenized to prepare a 10% homogenate. Oxidative stress levels in mouse lung tissues were assessed utilizing commercial kits for MDA (S0131S, Beyotime), SOD (S0101S, Beyotime), and GSH (S0053, Beyotime) following the manufacturers’ protocols.

Immunofluorescence (IF) staining

Paraffin sections first underwent PBS washes (three times), 5-min permeabilization with 0.1% Triton X-100 (Solarbio, China) at room temperature, and three additional PBS washes. After 30-min blocking with 3% BSA (Solarbio, Beijing, Chin) at room temperature, the sections were subjected to overnight incubation (4 ℃) with pre-diluted primary antibodies: anti-NLRP3 rabbit polyclonal antibody (1:100, ab270449, Abcam, Cambridge, UK) or anti-caspase-1 rabbit polyclonal antibody (1:100, PA5-87536, Thermo Fisher). Following PBS wash, another 1-h incubation was carried out at 37 ℃ in the dark with goat anti-rabbit IgG secondary antibody (FITC-conjugated; 1:1,000, ab6717, Abcam). After further washes, nuclei were counterstained applying DAPI, and sections were mounted in antifade mounting medium. Fluorescence images were captured using a fluorescence microscope at 200× magnification under identical acquisition settings. For quantitative analysis, 3 randomly selected non-overlapping fields per section were analyzed. The fluorescence intensity of NLRP3 and caspase-1 signals was quantified using ImageJ with identical threshold settings applied to all groups. Image acquisition and quantitative analysis were performed by investigators blinded to group allocation.

Statistical analysis

GraphPad Prism 9 was utilized for data processing. Normality was examined via the Shapiro-Wilk test. For data following a normal distribution, comparisons between two groups were performed using Student’s t-test. Comparisons among three or more groups were performed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. A P value <0.05 was considered statistically significant. All experiments were independently repeated at least three times.

Results

OPN alleviates Hyp-induced lung tissue injury

Hyp exposure significantly inhibited body weight gain in mice (Figure 1A). OPN treatment partially restored body weight changes. Gross lung morphology showed restricted lobar expansion in the Hyp group, which was improved by OPN intervention (Figure 1B). H&E staining revealed disorganized alveolar structure and thickened alveolar septa in the Hyp group. OPN treatment partially alleviated these hyperoxia-induced pathological changes, accompanied by decreased MLI and increased RAC values (Figure 1C). IHC detection of Ki67 showed that Hyp exposure reduced lung tissue cell proliferation activity, whereas OPN treatment increased the proportion of Ki67-positive cells (Figure 1D).

Figure 1.

Bovine milk-derived OPN supplementation Hyp-induced lung tissue injury in mice. (A) Body weight records of newborn mice. (B) Gross lung morphology photographs. (C) Lung tissue structure detected by H&E staining; alveolar structure assessed by MLI and RAC. (D) Ki67 distribution detected by IHC staining. N=6. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. H&E, hematoxylin and eosin; Hyp, hyperoxia; IHC, immunohistochemistry; MLI, mean linear intercept; OPN, osteopontin; RAC, radial alveolar count.

OPN promotes alveolar and pulmonary vascular development in Hyp-exposed mice

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) showed that mRNA expression levels of SPC, AQP5, FLK-1, and VEGF in lung tissues were significantly decreased in the Hyp group compared with the Control group. In contrast, mRNA levels of these genes were partially restored in the Hyp + OPN group relative to the Hyp group (Figure 2A). WB demonstrated decreased protein expression of SPC, AQP5, and FLK-1 in the Hyp group, while OPN treatment improved their protein levels (Figure 2B). IHC detection of CD31 showed reduced pulmonary vascular density in the Hyp group, whereas the Hyp + OPN group exhibited a significant increase in CD31-positive vessels (Figure 2C).

Figure 2.

Effect of OPN on alveolar and pulmonary vascular development in Hyp-exposed mice. (A) RT-qPCR detection of SPC, AQP5, FLK-1, and VEGF mRNA expression levels in lung tissues. (B) WB detection of SPC, AQP5, and FLK-1 protein expression. (C) CD31 IHC staining for evaluating pulmonary angiogenesis. N=6. **, P<0.01; ***, P<0.001; ****, P<0.0001. Hyp, hyperoxia; IHC, immunohistochemistry; OPN, osteopontin; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; WB, Western blotting.

OPN alleviates the inflammatory response in lung tissues of Hyp-exposed mice

RT-qPCR showed that mRNA expression levels of inflammatory cytokines were significantly increased in lung tissues of the Hyp group compared with the Control group. These levels were reduced in the Hyp + OPN group relative to the Hyp group (Figure 3A). ELISA further validated these results, showing elevated protein levels of inflammatory cytokines in the Hyp group, which were decreased after OPN treatment (Figure 3B).

Figure 3.

Effect of OPN on the inflammatory response in lung tissues of BPD mice. (A) RT-qPCR detection of inflammatory cytokine mRNA expression levels in lung tissues. (B) ELISA detection of inflammatory cytokine protein levels in lung tissues. N=6. ***, P<0.001; ****, P<0.0001. BPD, bronchopulmonary dysplasia; ELISA, enzyme-linked immunosorbent assay; Hyp, hyperoxia; IL, interleukin; OPN, osteopontin; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; TNF-α, tumor necrosis factor-α.

OPN alleviates oxidative stress in lung tissues of Hyp-exposed mice

Compared with the Control group, the Hyp group showed significantly elevated oxidative stress levels in lung tissues, as indicated by increased MDA and ROS levels, along with decreased SOD activity and GSH levels. Following OPN treatment, both MDA and ROS levels were markedly reduced, while SOD activity and GSH levels were partially restored (Figure 4).

Figure 4.

Effect of OPN on oxidative stress in lung tissues of Hyp-exposed mice. (A) Detection of MDA levels in lung tissues. (B) Detection of SOD activity. (C) Detection of GSH levels. (D) Detection of ROS levels in lung tissues by DHE fluorescence staining. N=6. **, P<0.01; ***, P<0.001; ****, P<0.0001. DHE, dihydroethidium; GSH, glutathione; Hyp, hyperoxia; MDA, malondialdehyde; OPN, osteopontin; ROS, reactive oxygen species; SOD, superoxide dismutase.

OPN supplementation reduces the expression of NLRP3 inflammasome-related molecules in Hyp-exposed mice

TUNEL staining showed an increased number of TUNEL-positive cells in lung tissues of the Hyp group, whereas the Hyp + OPN group exhibited a reduced number of TUNEL-positive cells (Figure 5A). RT-qPCR analysis revealed significantly elevated mRNA expression levels of NLRP3 and ASC in the Hyp group, which were reduced following OPN treatment (Figure 5B). Western blot analysis demonstrated increased protein expression of NLRP3, ASC, cleaved-caspase-1, and GSDMD-N in the Hyp group, whereas OPN treatment was associated with reduced expression of these NLRP3 inflammasome-related molecules (Figure 5C). IF staining of lung tissues showed enhanced NLRP3 signals in the Hyp group, which were reduced following OPN treatment (Figure 5D).

Figure 5.

Effect of OPN on expression of NLRP3 inflammasome-related molecules in lung tissues of Hyp-exposed mice. (A) TUNEL staining of lung tissues showing TUNEL-positive cells. (B) RT-qPCR detection of NLRP3, ASC, and caspase-1 mRNA expression levels. (C) WB detection of NLRP3, ASC, cleaved-caspase-1, and GSDMD-N protein expression levels. (D) IF staining of NLRP3 and caspase-1 signals in lung tissues. N=6. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. ASC, apoptosis-associated speck-like protein containing a CARD; Hyp, hyperoxia; IF, immunofluorescence; OPN, osteopontin; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling; WB, Western blotting.

Discussion

Multiple factors are involved in the pathogenesis of BPD, and exposure to Hyp remains a main risk factor for BPD in preterm infants (26). A better understanding of the molecular basis of BPD contributes to the improvement of targeted disease management. In the present study, using a classic hyperoxia-induced neonatal mouse model of BPD, we demonstrate that exogenous bovine milk-derived OPN supplementation alleviates hyperoxic lung injury and BPD-like pathological changes in newborn mice. These protective effects were accompanied by reduced expression of NLRP3 inflammasome-related molecules, suggesting that modulation of NLRP3-related inflammatory responses may be involved in the beneficial effects of OPN supplementation. Our findings fill an important gap in this field, provide new experimental evidence for the protective effects of exogenous bovine milk-derived OPN supplementation against hyperoxia-induced lung injury, and offer a potential research direction for early prevention and targeted intervention of BPD.

Arrested alveolar development and impaired pulmonary microvascular angiogenesis are the core pathological features of BPD and the fundamental causes of long-term pulmonary dysfunction in preterm infants (27). Alveolar type II epithelial cells (ATII) serve as stem cells of the alveolar epithelium, differentiating into alveolar type I epithelial cells (ATI) and playing a central role in alveolar development and injury repair (28). Normal development of pulmonary microvessels is essential for alveolarization, and VEGF and its receptor FLK-1 are key signaling molecules that regulate pulmonary angiogenesis (29). Our results showed that Hyp exposure significantly downregulated the expression of the ATII cell marker SPC, the ATI cell marker AQP5, and the angiogenesis-related molecules VEGF and FLK-1 in the lung tissue of newborn mice. These changes were accompanied by simplified alveolar structure (increased MLI, decreased RAC) and reduced pulmonary vascular density (CD31-positive vessels), which is consistent with classic findings in previous BPD models (30-32). Notably, OPN intervention significantly reversed these alterations and increased the proportion of Ki67-positive cells in lung tissue. These findings suggest that OPN improves Hyp-induced arrest of alveolar and pulmonary microvascular development by promoting the proliferation of alveolar epithelial cells and vascular endothelial cells, thereby alleviating the core pathological damage of BPD. Previous research has shown that OPN regulates epithelial cell proliferation and differentiation through integrin receptors and promotes endothelial cell migration and angiogenesis, playing an important role in tissue injury repair (33). Moreover, a recent study has revealed that human OPN-derived peptide inhibits cell apoptosis, repairs alveolar epithelial injury, and reduces BPD-like injury in Hyp/lipopolysaccharide-treated mice (34). Our results are consistent with those reports and further extend the protective effects of exogenous bovine milk-derived OPN supplementation to a neonatal mouse model of BPD, providing new experimental evidence supporting the potential role of OPN in modulating neonatal lung injury responses.

Excessive inflammation and oxidative stress imbalance are central drivers of BPD development and progression (9). The antioxidant system in preterm lung tissue is immature (35). Hyp exposure leads to excessive production of ROS, accumulation of the lipid peroxidation product MDA, and depletion of endogenous antioxidants such as SOD and GSH, thereby inducing oxidative stress injury (36). Oxidative stress further activates innate immune cells in the lung, triggering the release of large amounts of pro-inflammatory cytokines, including TNF-α, IL-6, and IL-1β (37). This creates a vicious cycle of oxidative stress-inflammation that ultimately exacerbates alveolar developmental arrest and lung tissue injury (8). Our results showed that Hyp exposure significantly increased both mRNA and protein levels of the pro-inflammatory cytokines TNF-α, IL-6, and IL-1β in the lung tissue of newborn mice, accompanied by elevated MDA and ROS levels and decreased SOD activity and GSH content. OPN intervention markedly reversed the Hyp-induced elevation of inflammatory cytokines and the imbalance of oxidative stress, suggesting that anti-inflammatory and antioxidant effects are important mechanisms by which OPN exerts its protective effect against BPD in neonatal mice. Previous studies have confirmed that OPN inhibits the activation of pro-inflammatory signaling pathways such as nuclear factor kappa-B (NF-κB), reduces the release of pro-inflammatory cytokines, enhances the activity of the endogenous antioxidant system, and clears excessive ROS, thereby exerting protective effects in various inflammatory diseases (38,39). Our results further support the anti-inflammatory and antioxidant effects of OPN in Hyp-induced lung injury in neonatal mice, providing experimental evidence for further preclinical investigation of OPN as a potential intervention candidate for BPD.

Aberrant activation of the NLRP3 inflammasome is a key hub linking oxidative stress and inflammation, mediating lung injury in BPD (40). Studies have shown that Hyp-induced ROS are among the most important upstream activating signals for the NLRP3 inflammasome (41). ROS can induce conformational changes in NLRP3 through oxidative modification of related proteins, leading to recruitment of apoptosis-associated ASC and activation of caspase-1 (42). On one hand, this cleaves pro-IL-1β and pro-IL-18 into their mature forms, amplifying the inflammatory cascade (11). On the other hand, it induces pyroptosis and apoptosis, exacerbating lung tissue injury (41). Previous studies have found that inhibiting NLRP3 inflammasome activation significantly improves Hyp-induced alveolar developmental arrest and reduces BPD-like lung injury in neonatal mice, indicating that NLRP3 is a key target for BPD prevention and treatment (43,44). Our results showed that Hyp exposure significantly upregulated both mRNA and protein expression of NLRP3, ASC, and caspase-1 in the lung tissue of newborn mice, accompanied by an increased number of TUNEL-positive cells, which is consistent with previous reports. Importantly, OPN intervention was associated with reduced expression of NLRP3 inflammasome-related molecules and decreased numbers of TUNEL-positive cells in lung tissues. Given that OPN also significantly reduced Hyp-induced ROS production and oxidative stress imbalance in our study, we speculate that the protective effects of OPN may be associated with the attenuation of oxidative stress and inflammatory responses. The reduction in ROS levels may be related to decreased expression of NLRP3 inflammasome-related molecules and downstream inflammatory mediators, which may contribute to the improvement of hyperoxia-induced lung injury in this BPD model.

This study has translational value and innovation. First, breast milk is the preferred nutritional source for preterm infants after birth, and its bioactive components play important protective roles in multiple organ development (45). Our study is the first to demonstrate the protective effect of exogenous bovine milk-derived OPN supplementation against Hyp-induced BPD in neonatal mice, providing new mechanistic evidence for the protective effects of exogenous bovine milk-derived OPN supplementation on preterm lung injury and supporting further investigation of OPN as a potential intervention strategy for BPD. Second, the OPN content in conventional infant formula is much lower than that in breast milk (15). Our findings provide experimental support for the use of OPN as a nutritional fortifier in preterm infant formula and offer a new direction for early nutritional intervention in BPD. Furthermore, this study suggests that the protective effects of OPN against BPD are accompanied by modulation of NLRP3 inflammasome-related responses, providing new insights into the potential mechanisms underlying OPN-mediated protection and a possible direction for future BPD intervention strategies. It is noteworthy that previous studies have reported that SPP1 deficiency may alleviate hyperoxia-induced BPD-like lung injury in neonatal mice (26), which appears to differ from the protective effects observed following exogenous OPN supplementation in our study. This discrepancy may be attributed to differences in experimental context, including endogenous gene deletion versus exogenous protein supplementation, OPN source, dosage, and timing of intervention. Therefore, the biological effects of OPN may be context-dependent, and further studies are required to clarify the precise roles of OPN in neonatal lung injury.

Several limitations should be acknowledged. First, although the inclusion of a Control + OPN group would provide additional information regarding the physiological effects of exogenous OPN supplementation under normoxic conditions, this group was not included in the present study because our primary objective was to investigate the protective effects of OPN against hyperoxia-induced BPD-like lung injury. Future studies incorporating normoxic OPN-treated animals are warranted to further clarify the physiological effects of OPN supplementation. Second, although our results showed that OPN supplementation was associated with reduced expression of NLRP3 inflammasome-related molecules, the present study did not include direct functional validation experiments, such as pharmacological inhibition or genetic manipulation of NLRP3/caspase-1 signaling. Therefore, whether NLRP3 inflammasome-related responses directly mediate the protective effects of OPN remains to be further investigated. Third, although lung histological analyses, including MLI and RAC measurements, provided evidence of improved lung morphology after OPN supplementation, pressure-controlled inflation-fixation was not performed in the present study. Given that these morphometric parameters are sensitive to lung inflation status, potential variability caused by tissue expansion cannot be completely excluded. Future studies using standardized inflation-fixation procedures are needed to further confirm these structural findings. Fourth, the bioavailability and tissue distribution of orally administered OPN were not directly evaluated in the present study. Therefore, whether exogenous OPN reaches the lung directly or exerts its protective effects through systemic regulation remains unclear. Future studies incorporating pharmacokinetic and tissue distribution analyses are warranted to further clarify the biological fate of orally administered OPN.

Conclusions

In conclusion, our findings demonstrate that exogenous bovine milk-derived OPN supplementation alleviates hyperoxia-induced lung pathological injury, reduces the number of TUNEL-positive cells, and improves BPD-associated structural abnormalities in a neonatal mouse model of BPD. The protective effects of OPN supplementation may be associated with attenuation of oxidative stress and inflammatory responses, accompanied by reduced expression of NLRP3 inflammasome-related molecules. This study provides experimental evidence supporting further preclinical investigation of exogenous bovine milk-derived OPN supplementation as a potential intervention candidate for BPD.

Supplementary

The article’s supplementary files as

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were performed under a project license (approval No. XZ202601285) granted by the Animal Care and Use Committee of Hunan Evidence-based Biotechnology Co., Ltd., in compliance with the institutional guidelines for the care and use of animals.

Data Sharing Statement

Available at https://tp.amegroups.com/article/view/10.21037/tp-2026-0632/dss

tp-15-9-374-dss.pdf ^{(68.3KB, pdf)}

DOI: 10.21037/tp-2026-0632