The complete mitochondrial genome of Reptalus artemisiae (Becker, 1865) (Hemiptera: Cixiidae)

Abstract

Reptalus artemisiae (Becker, 1865) is a vector of economically important plant pathogens. To date, no complete mitochondrial genome has been available for Pentastirini. We present the first complete mitogenome of R. artemisiae, sequenced using ONT MinION long reads. The circular genome is 15,476 bp long, comprises 13 protein-coding, two rRNA, 22 tRNA genes, and an AT-rich putative noncoding control region. Gene content and organization are consistent with the ancestral insect mitochondrial genome. This dataset provides a crucial reference for phylogenetic studies for both Reptalus and Pentastirini, support integrative approaches to classification, and offers a foundation for applied research on pathogen-vector-endosymbiont interactions.

Introduction

Phloem-sap-feeding planthopper Reptalus artemisiae (Becker, 1865) is an emerging vector of two plant pathogens, ‘Candidatus Phytoplasma solani’ and ‘Candidatus Arsenophonus phytopathogenicus’, associated with economically significant plant diseases and posing a significant threat to agriculture (Kosovac et al. 2023; Kreitzer et al. 2025). The cixiid R. artemisiae was historically reported under the name Reptalus quinquecostatus (Dufour, 1833) until a taxonomic revision where R. artemisiae was set as the valid name for this taxon (Webb et al. 2013; Emeljanov 2020; Tishechkin & Emeljanov 2024). Moreover, R. artemisiae is often present sympatrically with its congeneric species R. panzeri (Löw, 1883), another vector of ‘Ca. P. solani’. Morphological differentiation between these two species can be reliably performed only on males, while the female specimens have to be subjected to molecular identification. Recently, a specimen of R. artemisiae was included in an endomicrobiome study (Duduk et al. 2026). From this dataset, we assembled and annotated the complete mitochondrial genome of R. artemisiae, representing the first mitogenomic resource for the genus Reptalus.

Material and methods

Insect material, DNA extraction, and identification

Reptalus artemisiae 135-24 (Figure 1) was collected during June 2024 on Prunus spinosa L. from Pančevo, Serbia (N44°56′18″; E20°43′35″). After collection of 25 specimens one female was used for DNA extraction, and the rest were held as voucher specimens and deposited in the Laboratory of Phytopathology collection (https://pesting.org.rs/en/laboratorija-za-fitopatologiju/) under the voucher number SB6/24. Contact information for the collection: Bojan Duduk (email: bojan.duduk@pesting.org.rs). This specimen is listed as under extraction number 135/24, while the raw sequencing data have been deposited in NCBI’s Sequence Read Archive (SRA) and are accessible through BioProject PRJNA1215974. As a female, the cixiids were initially identified at the genus level (Reptalus sp.) based on external morphological features: the size of the body, five distinct longitudinal carinae on the mesonotum, and two transverse keels on the head (Holzinger et al. 2003). The final identification of the specimen as R. artemisiae was performed molecularly based on differences in the length of internal transcribed spacer 2 (ITS2) amplicons and analysis of COI sequences (Bertin et al. 2010) as part of a study by Duduk et al. (2026). Total genomic DNA was extracted from the whole insects with methods for DNA extraction, library preparation, and sequencing detailed in Duduk et al. (2026).

Figure 1.

The adult of R. artemisiae. (A) The dorsal view; (B) the ventral view. Bar represents 1 mm. The photos were taken by the authors.

Mitochondrial genome assembly and functional annotation

To assemble the mitochondrial genome from R. artemisiae metagenomic DNA, reads were compared against a subset of protein databases using DIAMOND v.2.1.9.163 (Buchfink et al. 2021). DIAMOND outputs were parsed using the Metagenome Analyzer (MEGAN) v.6.25.10 (Huson et al. 2016) for taxonomic binning. The insect-assigned reads were mapped using minimap2 to the mitochondrial genome of Cixiid Oliarus cf. filicicola (MZ748293). The selected mitochondrial reads of R. artemisiae were merged into a single circular scaffold by aligning to the mitogenome of O. cf. filicicola as a reference genome using Genious Prime 2025.2.2. The reference genome was removed, and the consensus assembly generated was polished using medaka v.2.0.1 (https://github.com/nanoporetech/medaka) on Galaxy. Manual curation was performed in Geneious. Circularity and coverage depth were verified by realigning raw reads to the final assembly using Geneious, with per-base depth calculated. Annotation of the mitogenome was performed through MITOS2 (Bernt et al. 2013; Donath et al. 2019), and a circular genome map was generated using CGview, using Proksee b.2026-01-10 (Grant et al. 2023).

To reveal the phylogenetic position of R. artemisiae, all 13 protein-coding genes (PCG) deduced amino acid sequences from the R. artemisiae mitogenome were aligned with all four publicly available complete Cixiidae mitogenomes as well as 15 representatives of all other complete mitogenomes publicly available of Fulgoromorpha (Delphacoidea, Ricaniidae, Flatidae, Lophopidae, and Fulgoridae), up to three representatives per family, using ClustalX, under MEGA X (Thompson et al. 1997; Kumar et al. 2018) with the default parameters applied. Two species from Cicadomorpha (Cosmoscarta dorsimacula and Bothrogonia yunana) were used as outgroup taxa to root the tree. The evolutionary history of R. artemisiae and the closest species was inferred using the maximum-likelihood (ML) method and the “General Reversible Mitochondrial model” (Adachi and Hasegawa 1996) as the best-fit substitution model. To estimate the statistical significance of the inferred clades, 1,000 bootstraps were performed.

Results

The assembly yielded a complete 15476 bp circular mitochondrial genome of the R. artemisiae 135/24, which has been deposited in the NCBI GenBank under accession number PX991861. Read depth across the mitochondrial genome was relatively uniform with a mean coverage of 56x, without gaps or indels indicating reliable assembly support. The mitogenome of R. artemisiae comprises a total of 37 genes, including 13 PCGs, 2 rRNA genes, and 22 tRNA genes (Table 1, Figure 2). Among them, 23 genes were identified on the majority strand, while the remaining 14 are encoded on the minority strand. The nucleotide composition of the mitochondrial genome of the R. artemisiae is as follows: 29.5% GC content, G-9.8%, C-19.7%, and A-42.6%, T-27.9%. All PCGs start with an ATN start codon except cox1 and nad1, which start with CTG and GTG, respectively. All genes have a complete stop codon except atp6 and nad4, which have T completed via polyadenylation. The two rRNAs (rrnL and rrnS) are 1,159 bp and 734 bp long, respectively. Among tRNAs, the shortest were trnY and trnR 61 bp and the longest was trnK 71 bp. A non-coding control region (1116 bp) was located between the rRNAs and trnI with 16.9% GC content. Within this control region a 920 bp long repeat sequence contains tandem repeats of 40 bp (AAAATAGCTAACATTAAAAAGTCACTTAAGTTTTTTTAAA) repeated 23 times. Position 1 was set at the beginning of the trnI gene, located downstream of the control region.

Table 1.

Organization of the mitochondrial genome of Reptalus artemisiae Becker, 1865 (Hemiptera: Cixiidae).

	Gene		Start	End	Strand	Length (bp)	Start	Stop
1	trnI(gat)	isoleucine	1	67	+	67
2	trnQ(ttg)	glutamine	65	130	−	66
3	trnM(cat)	methionine	130	195	+	66
4	nad2		199	1,155	+	957	ATA	TAA
5	trnW(tca)	tryptophan	1154	1221	+	68
6	trnC(gca)	cysteine	1214	1275	−	62
7	trnY(gta)	tyrosine	1276	1336	−	61
8	cox1		1335	2870	+	1536	CTG	TAA
9	trnL2(taa)	leucine 2	2873	2936	+	64
10	cox2		2937	3602	+	666	ATA	TAA
11	trnK(ctt)	lysine	3604	3674	+	71
12	trnD(gtc)	aspartic acid	3675	3738	+	64
13	atp8		3739	3843	+	105	ATC	TAA
14	atp6		3837	4491	+	655	ATT	T*
15	cox3		4492	5274	+	783	ATG	TAG
16	trnG(tcc)	glycine	5274	5335	+	62
17	nad3		5336	5686	+	351	ATC	TAA
18	trnA(tgc)	alanine	5686	5750	+	65
19	trnR(tcg)	arginine	5755	5815	+	61
20	trnN(gtt)	asparagine	5815	5879	+	65
21	trnS1(gct)	serine 1	5879	5946	+	68
22	trnE(ttc)	glutamic acid	5948	6012	+	65
23	trnF(gaa)	phenylalanine	6013	6077	−	65
24	nad5		6211	7872	−	1662	ATT	TAA
25	trnH(gtg)	histidine	7890	7952	−	63
26	nad4		7953	9270	−	1318	ATG	T*
27	nad4l		9264	9533	−	270	ATG	TAA
28	trnT(tgt)	threonine	9564	9607	+	62
29	trnP(tgg)	proline	9607	9670	−	64
30	nad6		9672	10166	+	495	ATT	TAA
31	cob		10170	11285	+	1116	ATG	TAA
32	trnS2(tga)	serine 2	11285	11348	+	64
33	nad1		11371	12294	−	924	GTG	TAA
34	trnL1	leucine 1	12295	12358	−	64
35	rrnL		12334	13492	−	1159
36	trnV(tac)	valine	13560	13626	−	67
37	rrnS		13624	14360	−	737
38	control region		14361	15476	+	1116

*Termination codon completed via polyadenylation.

Figure 2.

Circular map of the assembled reptalus artemisiae mitogenome, drawn using the proksee web server. From outside to inside, the rings represent: (1, 2) predicted protein-coding, rRNA, tRNA, and tmRNA genes on the forward and reverse strands respectively; (3) GC content; (4) GC skew; (5) genome coordinates (kb).

The ML phylogeny inferred from all 13 PCGs sequences was largely congruent with the classification of Hemiptera (Figure 3). Fulgoromorpha formed a highly supported monophyletic clade. All families within Fulgoromorpha represented by more than one species were recovered as strongly supported monophyletic groups, with Cixiidae being closest to Delphacidae. Within Cixiidae, Pentastirini formed a strongly supported subclade including R. artemisiae.

Figure 3.

Maximum likelihood (ML) phylogenetic analyses of concatenated 13 mitochondrial protein-coding gene deduced amino acid sequences of 16 species within the infraorder Fulgoromorpha including R. artemisiae 135/24 (PX991861) and two species from the infraorder Cicadomorpha as outgroup taxa to root the tree. The numbers at the nodes represent the bootstrap values. The following sequences were used: MZ748293 oliarus cf. filicicola (Chong et al. 2022), MZ779204 Oecleopsis sinicus (direct submission), OR062443 Oecleopsis sp. (direct submission), MZ748292 Iolania perkinsi (Chong et al. 2022), MG515237 Saccharosydne procerus (Huang and Qin 2018), KC333655 Nilaparvata bakeri (direct submission), MG049917 Peregrinus maidis (Huang and Qin 2017), MT079725 Lycorma meliae (Du et al. 2021), FJ456942 Lycorma delicatula (Hua et al. 2009), MN025522 Aphaena amabilis (Wang et al. 2019), MT990448 Lophops carinata (direct submission), FJ230961 Geisha distinctissima (Song and Liang 2009), OR062418 Aplos simplex (Wang et al. 2024), KX371891 Ricania speculum (Zhang et al. 2016), MT898421 Ricania shantungensis (Kang et al. 2020), MG599490 Cosmoscarta dorsimacula (Su et al. 2018), MT500858 Bothrogonia yunana (direct submission).

Discussion and conclusion

This study presents the first complete mitochondrial genome sequence of R. artemisiae. The number of full-length mitogenome sequences in Cixiidae is still relatively small, with four including the current one. Total length, as well as GC content, falls within the range of those currently represented in the literature as Cixiid mitogenomes to date. Genomic features and genome arrangement were the same as the ancestral insect and is identical to the other published Cixiid genomes (Boore 1999; Song et al. 2017; Chong et al. 2022). The mitogenome-based phylogenetic reconstruction provided well-supported phylogenetic resolution for Fulgoromorpha systematics, confirming its monophyly as well as the assessed families. Pentastirini, including R. artemisiae form a strongly supported subclade under Cixiidae, hence confirming its taxonomic placement. Furthermore, the analysis strongly supports a sister-group relationship between the Cixiidae and Delphacidae, which aligns with prior phylogenetic research (Song et al. 2017; Chong et al. 2022). Considering limited taxonomic representation within Cixiidae, this mitogenomic data represents a valuable reference for comparative mitochondrial analyses and provides valuable resources for establishing a DNA barcoding library for Pentastirini to mitigate species misidentification risks. It improves phylogenetic resolution among cixiids and facilitates the assessment of species boundaries in the context of persistent taxonomic uncertainty within Reptalus. This genomic resource provides a useful foundation for future systematic, evolutionary, and vector-related studies, supporting both basic and applied research in entomology.

Funding Statement

This research was supported by the Ministry of Education, Science and Technological Development of the Republic of Serbia, contract 451-03-33/2026-03/200214.

Disclosure statement

The authors report no conflicts of interest.

Data availability statement

The genome sequence data of this study are openly available in GenBank of NCBI at (https://www.ncbi.nlm.nih.gov/) under the accession no. PX991861. The associated BioProject, Bio-Sample, and SRA numbers are PRJNA1215974, SAMN46422405, and SRR32132256, respectively.

Voucher information

The specimen of Reptalus artemisiae used for DNA extraction was destroyed during the extraction process and the rest of the specimens (24) were held as voucher specimens and deposited in the Laboratory of Phytopathology collection (https://pesting.org.rs/en/laboratorija-za-fitopatologiju/) under the voucher number SB6/24. Contact information for the collection: Bojan Duduk (email: bojan.duduk@pesting.org.rs). Identification was performed morphologically by the authors, based on diagnostic characters of Reptalus and molecularly based on differences in the length of internal transcribed spacer 2 (ITS2) amplicons and phylogenetic analysis based on COI sequences. Collection metadata: Serbia, Banat (N44°56′18″; E20°43′35″), June 10 2024, collected by the authors. A photograph of the specimen prior to DNA extraction is provided as a digital voucher in Figure 1.

All sequences analyzed in the present study can be accessed in the NCBI GenBank database under the bio project accession number (PRJNA1215974).