URGCP promotes osteosarcoma progression by regulating the ESCRT-III subunit CHMP4B

Abstract

Background

Osteosarcoma (OS) is the most common primary malignant bone tumor in adolescents, with a persistently poor prognosis due to limited effective therapeutic targets. Identifying key oncogenic drivers and their regulatory networks is critical for developing novel targeted therapies to improve clinical outcomes. In this study, we aimed to investigate the expression pattern, diagnostic value, and functional role of upregulator of cell proliferation (URGCP) in OS, as well as to elucidate its downstream molecular mechanism, specifically focusing on the URGCP-CHMP4B regulatory axis.

Methods

We conducted a bioinformatics analysis of public datasets (Gene Expression Omnibus) to identify the dysregulation and diagnostic value of URGCP in OS. In vitro functional assays were conducted in URGCP knockdown MG-63 OS cells, including Cell Counting Kit-8 (CCK-8) proliferation assay, flow cytometry-based apoptosis detection, reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR), and western blotting. A xenograft mouse model was established to validate the in vitro findings. Rescue experiments were conducted by overexpressing CHMP4B in URGCP knockdown cells to decipher the downstream effector of URGCP.

Results

Bioinformatics analyses revealed that URGCP was significantly upregulated in OS tissues and exhibited diagnostic value. Silencing URGCP significantly inhibited OS cell proliferation and induced apoptosis in vitro, and suppressed tumor growth in vivo. Mechanistically, in vitro and in vivo URGCP knockdown led to the downregulation of CHMP4B, a core subunit of the endosomal sorting complex required for transport III (ESCRT-III), which is critical for regulating cell proliferation and apoptosis. Crucially, restoring CHMP4B expression in vitro effectively reversed the anti-proliferative and pro-apoptotic effects induced by URGCP silencing.

Conclusions

Our study identifies URGCP as an oncoprotein in OS that exerts its tumor-promoting effects, at least in part, by positively regulating CHMP4B. The URGCP-CHMP4B axis represents a potential therapeutic target for OS treatment.

Highlight box.

Key findings

• URGCP is significantly upregulated in osteosarcoma (OS) and exhibits diagnostic value.

• URGCP silencing suppresses proliferation, induces apoptosis in vitro, and inhibits tumor growth in vivo.

• URGCP positively regulates CHMP4B, and CHMP4B overexpression rescues the phenotypes induced by URGCP knockdown.

• The URGCP-CHMP4B axis is identified as a novel oncogenic pathway in OS.

What is known and what is new?

• URGCP promotes tumorigenesis in several cancers. CHMP4B is a core component of the ESCRT-III complex involved in membrane remodeling and cytokinesis.

• This study is the first to demonstrate that URGCP drives OS progression by positively regulating CHMP4B, establishing a functional link between URGCP and the ESCRT-III machinery.

What is the implication, and what should change now?

• The URGCP-CHMP4B axis represents a potential therapeutic target for OS. URGCP expression may also serve as a diagnostic biomarker. Large-scale clinical validation.

Introduction

Osteosarcoma (OS) is the most common primary malignant bone tumor in children and adolescents. It has an annual incidence of approximately 3–5 cases per million people (1,2). OS is characterized by high disability and mortality rates (3). The introduction of neoadjuvant chemotherapy combined with surgical resection has improved the 5-year survival rate for localized disease to 60–70% (4,5). However, the prognosis for patients with metastatic or recurrent OS remains poor, with 5-year survival rates of only 20–30% (6-8). Therefore, there is an urgent need to elucidate the molecular mechanisms driving OS progression and to identify novel therapeutic targets to improve treatment efficacy.

Upregulator of cell proliferation (URGCP/URG4) is a well-established oncoprotein across several malignancies. Its upregulation drives tumor progression and predicts poor prognosis (9-16). For instance, in hepatocellular carcinoma (HCC) and gastric cancer (GC), URGCP promotes tumor growth by accelerating G1/S transition via transcriptional upregulation of cyclin D1 (13,17). In bladder cancer (BC), URGCP promotes apoptotic resistance by activating the nuclear factor kappa-B (NF-κB) signaling pathway (14). In non-small cell lung cancer (NSCLC), URGCP overexpression correlates with disease progression and poor prognosis. It functionally promotes invasion, migration, and distant metastasis by activating NF-κB signaling to enhance MMP-9 expression (15). These studies establish URGCP as a promising prognostic biomarker and a functionally significant oncoprotein across multiple malignancies. However, its mechanistic basis and therapeutic relevance in the pathogenesis of OS remain poorly defined.

The endosomal sorting complex required for transport (ESCRT) machinery represents another crucial regulatory system in cellular homeostasis, responsible for processes including multivesicular body formation, cytokinesis, and plasma membrane repair (18,19). Accumulating evidence has implicated the ESCRT pathway in tumorigenesis, with its components functioning as either oncogenes or tumor suppressors in a context-dependent manner (20,21). CHMP4B, a core subunit of the ESCRT-III complex, is essential for the final scission step of membrane remodeling events (22). Recent studies have begun to reveal CHMP4B’s role in regulating cell proliferation and apoptosis (23), though its function and regulatory mechanisms in OS remain largely unexplored. Notably, emerging evidence suggests potential crosstalk between oncogenic drivers and ESCRT components (24), yet whether URGCP functionally engages CHMP4B to promote OS progression remains an open question.

In this study, we hypothesized that URGCP might promote OS progression by regulating ESCRT-III components. We systematically investigated the expression and functional role of URGCP in OS and explored its downstream regulatory targets and molecular mechanisms. Our findings will provide a novel therapeutic target for the treatment of OS. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1420/rc).

Methods

Bioinformatics analysis

Publicly available gene expression datasets (GSE218035 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE218035 and GSE28424 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28424) related to OS were retrieved from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). Differential URGCP expression between OS tissues/cell lines and normal controls was assessed using the limma R package, with a |log₂ fold change (FC)| >1 and an adjusted P value <0.05 as the cutoff criteria. The diagnostic value of URGCP was evaluated using receiver operating characteristic (ROC) curve analysis, and the area under the curve (AUC) was calculated. The ROC curve was plotted using the Xiantao Academic online platform (https://www.xiantao.love), a widely used web tool for data visualization. Pan-cancer expression analysis of URGCP was conducted using the TIMER 2.0 web server (https://compbio.cn/timer2/).

Cell culture and lentiviral transduction

The human OS cell line MG-63 was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). It was authenticated by short tandem repeat (STR) profiling and tested for mycoplasma contamination. Cells were maintained in Dulbecco’s modified eagle medium (DMEM; Wisent, Montreal, QC, Canada) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) and 1% penicillin-streptomycin (Wisent, Montreal, QC, Canada) at 37 ℃ in a humidified atmosphere with 5% CO₂. Lentiviral vectors encoding short hairpin RNA (shRNA) targeting URGCP (sh-URGCP), CHMP4B overexpression plasmid (oe-CHMP4B), and their corresponding negative controls (sh-NC, oe-NC) were constructed by GenePharma (Shanghai, China). Lentiviral particles were produced in HEK293T cells using the psPAX2 and pMD2.G packaging plasmids. OS cells were transduced with lentiviruses in the presence of 8 μg/mL polybrene (Solarbio, Beijing, China), and stable cell lines were selected using puromycin (2 μg/mL; Solarbio, Beijing, China) for 2 weeks. Transfection efficiency was verified by reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) and Western blotting.

RNA extraction and RT-qPCR

Total RNA was extracted from cells and tumor tissues using RNAiso Plus (Takara, Kyoto, Japan) according to the manufacturer's instructions. RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized using the M5 Super plus qPCR RT kit with gDNA remover (Mei5bio, Beijing, China). RT-qPCR was performed using 2× RealStar Fast SYBR qPCR Mix (GenStar, Beijing, China) on an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The relative mRNA expression levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the 2^−ΔΔCt method. The primer sequences used are listed in Table 1.

Table 1. Primer sequences used for RT-qPCR analysis.

Gene	Direction	Sequence (5' to 3')
Hsa-URGCP	Forward	GACCTTGCTGCCGACATTTAT
Hsa-URGCP	Reverse	GCAGGAAACTGTCTGAGGAGAG
Hsa-CHMP4B	Forward	TGCAGAGGAGATTTCAACAGC
Hsa-CHMP4B	Reverse	TGTTTCGGGTCCACTGATTTC
Hsa-GAPDH	Forward	GGAGCGAGATCCCTCCAAAAT
Hsa-GAPDH	Reverse	GGCTGTTGTCATACTTCTCATGG

RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction.

Western blotting

Cells or tumor tissues were lysed in RIPA buffer (Solarbio, Beijing, China) containing protease and phosphatase inhibitors (Solarbio, Beijing, China) on ice for 30 minutes. Protein concentrations were determined using a BCA Protein Assay Kit (Beyotime, Shanghai, China). Equal amounts of protein (30 μg per lane) were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Burlington, MA, USA). The membranes were blocked with 5% skim milk in Tris Buffered Saline with Tween 20 (TBST) for 1 hour at room temperature, then incubated overnight at 4 ℃ with primary antibodies against URGCP (1:2,000; Invitrogen, Waltham, MA, USA, PA5-44534), CHMP4B (1:2,000; Abcam, Cambridge, UK, ab135154), and GAPDH (1:5,000; Proteintech, Rosemont, IL, USA, 60004-1-Ig). After washing with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5,000; Beyotime, Shanghai, China) for 1 hour at room temperature. Protein bands were visualized using a Tanon ECL detection system (Tanon, Shanghai, China) and imaged with a Tanon 5200 Chemiluminescent Imaging System (Tanon, Shanghai, China). Band intensities were quantified using ImageJ software.

Cell proliferation assay

Cell proliferation was assessed using the Cell Counting Kit-8 (CCK-8) assay (Beyotime, Shanghai, China). Briefly, 5×10³ cells per well were seeded into 96-well plates. At 0, 24, 48, and 72 hours after seeding, 10 μL of CCK-8 solution was added to each well and incubated for 2 hours at 37 ℃. The absorbance was measured at 450 nm using a Multiskan FC microplate reader (Thermo Fisher Scientific, Waltham, MA, USA).

Apoptosis assay

Cell apoptosis was detected using an Annexin V-FITC/PI Apoptosis Detection Kit (eBioscience, San Diego, CA, USA) according to the manufacturer’s instructions. Briefly, cells were harvested by trypsinization, washed twice with cold phosphate-buffered saline (PBS), and resuspended in binding buffer. After staining with Annexin V-FITC and PI for 15 minutes at room temperature in the dark, apoptotic cells were analyzed using a FACSCanto II flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).

Xenograft tumor model

All animal experiments were performed under a project license (No. kmmu20221193) granted by the Institutional Animal Care and Use Committee of Kunming Medical University, in compliance with the NIH Guide for the Care and Use of Laboratory Animals. Male BALB/c nude mice (5 weeks old) were purchased from Hangzhou Ziyuan Laboratory Animal Technology Co., Ltd. (Hangzhou, China) and housed under specific pathogen-free conditions. To establish tumor xenografts, MG-63 cells (5×10⁶) stably expressing sh-NC or sh-URGCP were resuspended in a 1:1 mixture of DMEM and Matrigel (Corning, Corning, NY, USA), then subcutaneously injected into the right forelimb of each mouse (n=6 per group). Tumor volume was subsequently measured every 3 days using a vernier caliper and calculated as (length × width²)/2. After 4 weeks of monitoring, mice were euthanized by intraperitoneal injection of pentobarbital sodium (160 mg/kg), and death was confirmed by cervical dislocation. Finally, tumors were excised, weighed, and either stored at −80 ℃ for further analysis or fixed in 4% paraformaldehyde for histological examination.

Hematoxylin and eosin (H&E) staining

Tumor specimens were fixed in 4% paraformaldehyde (Sinopharm, Shanghai, China), paraffin-embedded, and cut into 4 μm sections. Following deparaffinization and rehydration, slides were stained with Harris H&E (BaSO, Zhuhai, China). After dehydration and clearing, coverslips were applied using neutral balsam (Sinopharm, Shanghai, China). Histological images were captured under a Nikon microscope (Nikon, Tokyo, Japan).

Histopathology and immunohistochemistry (IHC)

Tumor tissue sections were incubated with antibodies against URGCP (1:200) or CHMP4B (1:200) overnight at 4 ℃, followed by incubation with HRP-conjugated secondary antibodies. Staining was visualized with DAB substrate (Dako, Glostrup, Denmark). Histological images were acquired on a Nikon Eclipse Ti microscope (Nikon, Tokyo, Japan), and integrated optical density (IOD) quantification was executed with ImageJ software.

Statistical analysis

All experiments were independently replicated a minimum of three times. Data are expressed as mean ± standard deviation (SD). Statistical comparisons were performed in GraphPad Prism 9.0 using Student’s t-test for two-group analyses or one-way analysis of variance (ANOVA) with Tukey’s post-hoc test for multiple comparisons. Statistical significance was defined as P<0.05. The in vitro sample size (n=3 independent replicates per group) was chosen according to standard laboratory practice for reproducibility. For in-vivo xenograft studies, 6 mice were allocated to each group based on prior experience with similar OS xenograft models.

Results

URGCP is upregulated in OS tissues and cell lines

We initially examined URGCP expression across human cancers using the TIMER 2.0 database. URGCP was significantly upregulated in multiple cancer types, including CHOL, ESCA, HNSC, LIHC, LUAD, and STAD, compared to corresponding normal tissues, while it was downregulated in BLCA, BRCA, COAD, GBM, THCA, and UCEC (Figure 1A), suggesting a context-dependent oncogenic role. In OS, analysis of the GSE218035 dataset revealed significantly elevated URGCP expression in OS tissues compared to normal tissues. This upregulation was evident in both paired (tumor vs. matched normal, n=11; Figure 1B) and unpaired (tumor n=23 vs. normal, n=13; Figure 1C) sample analyses. ROC analysis yielded an AUC of 0.773 (Figure 1D), with a sensitivity of 77.3% and a specificity of 75.0% at the optimal cutoff value of 10.36, supporting the diagnostic potential of URGCP in distinguishing OS from normal tissues. Further analysis of the GSE28424 dataset showed that URGCP expression was significantly higher in OS cell lines than in normal bone tissues (Figure 1E). Among the OS cell lines analyzed, MG-63 exhibited relatively high URGCP expression (Figure 1F) and was accordingly selected for subsequent functional experiments. Collectively, these results demonstrate that URGCP is significantly upregulated in OS and support its potential role as a diagnostic biomarker and oncogenic driver in OS progression.

Figure 1.

URGCP is upregulated in OS and exhibits diagnostic value. (A) Pan-cancer analysis of URGCP expression from TIMER 2.0. (B,C) URGCP expression in paired (B) and unpaired (C) OS and normal tissues from the GSE218035 dataset. (D) ROC curve based on the GSE218035 dataset assessing the diagnostic performance of URGCP in OS. (E) URGCP expression in normal bone tissues versus OS cell lines. (F) URGCP expression levels across different OS cell lines based on the GSE28424 dataset. Data represent mean ± SD of at least three independent experiments. *, P<0.05; **, P<0.01; ***, P<0.001. AUC, area under the curve; CI, confidence interval; FPR, false positive rate; OS, osteosarcoma; ROC, receiver operating characteristic; SD, standard deviation; TPR, true positive rate; URGCP, upregulator of cell proliferation.

URGCP silencing inhibits proliferation and promotes apoptosis of OS cells

Most tumors are characterized by sustained proliferative signaling and resistance to apoptosis (25). To investigate the potential impact of URGCP knockdown on cellular proliferation and apoptosis in OS cells, we suppressed URGCP expression in MG-63 cells (Figure 2A-2C). CCK-8 assay revealed that URGCP silencing considerably reduced OD450 values (Figure 2D), indicating effective suppression of cellular proliferation. Flow cytometry apoptosis assay demonstrated enhanced apoptosis in OS cells with stable URGCP knockdown (Figure 2E,2F). Collectively, these findings indicate that URGCP silencing inhibits proliferation and promotes apoptosis of OS cells.

Figure 2.

URGCP silencing inhibits proliferation and promotes apoptosis of OS cells. (A-C) Stable knockdown of URGCP was validated using RT-qPCR and western blot analysis. GAPDH served as a loading control. (D) Cell proliferation was measured using the CCK-8 assay in control and URGCP knockdown cells. (E,F) Apoptosis rates were analyzed using flow cytometry in control and URGCP knockdown cells. Data represent mean ± SD of at least three independent experiments. ***, P<0.001. CCK-8, Cell Counting Kit-8; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OS, osteosarcoma; RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction; SD, standard deviation; sh-NC, short hairpin RNA negative control; sh-URGCP, short hairpin RNA targeting URGCP; URGCP, upregulator of cell proliferation.

URGCP silencing downregulates the ESCRT-III subunit CHMP4B in OS cells

The ESCRT-III complex plays critical roles in multiple cellular processes. CHMP4B, a core component of the ESCRT-III complex, is known to regulate cell proliferation and apoptosis (23). To determine whether CHMP4B contributes to URGCP-mediated effects in OS, we measured CHMP4B expression in URGCP knockdown MG-63 cells (Figure 3A-3C). Both mRNA and protein levels of CHMP4B were significantly lower in the sh-URGCP group than in the sh-NC groups (Figure 3A). Consistent with this, Western blot analysis revealed a significant reduction in CHMP4B protein expression following URGCP knockdown (Figure 3B,3C). Together, these results indicate that URGCP silencing downregulates the ESCRT-III complex subunit CHMP4B in OS cells.

Figure 3.

URGCP silencing downregulates CHMP4B expression in OS cells. (A) RT-qPCR analysis of CHMP4B mRNA in control, sh-NC, and sh-URGCP groups. (B) Western blot images of CHMP4B protein levels. (C) Quantification of CHMP4B protein expression normalized to GAPDH. Data represent mean ± SD of at least three independent experiments. ***, P<0.001. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OS, osteosarcoma; RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction; SD, standard deviation; sh-NC, short hairpin RNA negative control; sh-URGCP, short hairpin RNA targeting URGCP; URGCP, upregulator of cell proliferation.

CHMP4B overexpression reverses the effects of URGCP silencing on the proliferation and apoptosis of OS cells

To determine whether restoring CHMP4B expression could rescue the phenotypic alterations induced by URGCP silencing, we generated MG-63 cells with stable URGCP knockdown alone or in combination with CHMP4B overexpression (sh-URGCP + oe-CHMP4B). Western blot analysis confirmed efficient URGCP knockdown and successful CHMP4B reconstitution (Figure 4A-4C). CCK-8 proliferation assays revealed that URGCP silencing significantly suppressed cell viability compared to the control group. This suppression was significantly reversed by CHMP4B overexpression, which restored proliferation to levels comparable to those of the control group (Figure 4D). Similarly, flow cytometric analysis of apoptosis showed a pronounced increase in apoptotic rate upon URGCP knockdown. This effect was significantly attenuated by CHMP4B overexpression, which reduced apoptosis in URGCP-silenced cells back to baseline levels (Figure 4E,4F). Together, these data demonstrate that CHMP4B overexpression effectively rescues the anti-proliferative and pro-apoptotic phenotypes resulting from URGCP silencing, supporting a functional role for CHMP4B as a downstream effector of URGCP in OS cells.

Figure 4.

CHMP4B overexpression reverses the effects of URGCP silencing on OS cell proliferation and apoptosis. (A) Western blot images of URGCP and CHMP4B protein expression in the indicated experimental groups. (B) Quantitative analysis of URGCP protein levels normalized to GAPDH. (C) Quantitative analysis of CHMP4B protein levels normalized to GAPDH. (D) Cell proliferation was measured using the CCK-8 assay at 0, 24, 48, and 72 hours. (E) Quantification of apoptosis rates measured by flow cytometry. (F) Flow cytometry scatter plots illustrating apoptotic cell distribution. Data represent mean ± SD of at least three independent experiments. *, P<0.05; ***, P<0.001. CCK-8, cell counting kit-8; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OS, osteosarcoma; SD, standard deviation; sh-NC, short hairpin RNA negative control; sh-URGCP, short hairpin RNA targeting URGCP; URGCP, upregulator of cell proliferation.

URGCP silencing inhibits OS tumor growth and downregulates CHMP4B in vivo

To assess the role of URGCP in OS progression and its regulatory effect on CHMP4B in vivo, we established a xenograft model by subcutaneously injecting nude mice with MG-63 cells stably expressing sh-NC or sh-URGCP. Tumors derived from sh-URGCP-expressing cells exhibited decreased average tumor volume and weight compared to the sh-NC group (Figure 5A-5D). RT-qPCR analysis confirmed significant downregulation of URGCP and CHMP4B mRNA in sh-URGCP tumors (Figure 5E,5F), accompanied by a significant reduction in CHMP4B protein levels (Figure 5G-5I). Histopathological evaluation by H&E staining showed diminished cellularity and disrupted tissue architecture in sh-URGCP tumors (Figure 5J). IHC analysis further supported reduced expression of URGCP (Figure 5K,5L) and CHMP4B (Figure 5M,5N) in the knockdown group. Taken together, these in vivo findings demonstrate that URGCP silencing not only suppresses OS tumor growth but also leads to coordinated downregulation of CHMP4B, reinforcing the functional link between URGCP and CHMP4B in OS pathogenesis.

Figure 5.

URGCP silencing suppresses tumor growth and downregulates CHMP4B expression in vivo. (A) Images of excised tumors from mice injected with sh-NC or sh-URGCP MG-63 cells. n=6. (B) Tumor growth curves. (C) Final tumor volumes. (D) Tumor weights. (E,F) RT-qPCR analysis of URGCP (E) and CHMP4B (F) mRNA in tumor tissues. (G) Western blots of URGCP and CHMP4B. (H,I) Quantification of URGCP (H) and CHMP4B (I) protein expression. (J) H&E staining of tumor sections (scale: 100 μm). (K,L) IHC staining of URGCP (K) and CHMP4B (L) in tumors (scale: 100 μm). (M,N) Quantification of immunostains for URGCP (M) and CHMP4B (N) by IOD analysis. Data represent mean ± SD of at least three independent experiments. *, P<0.05; **, P<0.01; ***, P<0.001. H&E, hematoxylin and eosin; IHC, immunohistochemical; IOD, integrated optical density; OS, osteosarcoma; RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction; SD, standard deviation; sh-NC, short hairpin RNA negative control; sh-URGCP, short hairpin RNA targeting URGCP; URGCP, upregulator of cell proliferation.

Discussion

In this study, we present the comprehensive evidence establishing URGCP as a crucial oncogenic driver in OS. We found that URGCP is frequently overexpressed in OS tissues and exhibits highly diagnostic value. Functionally, silencing URGCP potently inhibited OS cell proliferation and induced apoptosis in vitro and curtailed tumor growth in vivo. Mechanistically, we identified a novel regulatory axis wherein URGCP promotes OS progression by regulating the expression of the ESCRT-III core subunit CHMP4B (Figure 6). Our rescue experiments confirmed that CHMP4B is a functionally critical downstream effector of URGCP. These findings not only elucidate a previously unrecognized role of URGCP in OS but also highlight the therapeutic relevance of the URGCP-CHMP4B signaling pathway.

Figure 6.

Graphical abstract of URGCP promotes OS progression by regulating the expression of the ESCRT-III core subunit CHMP4B. Created with BioGDP.com. ESCRT, endosomal sorting complex required for transport; OS, osteosarcoma; URGCP, upregulator of cell proliferation.

The ESCRT machinery is increasingly recognized for its non-canonical roles in cancer biology, beyond its well-established function in membrane trafficking (26-29). CHMP4B, in particular, has been reported to play a context-dependent role in cell survival. For instance, CHMP4B is essential for the completion of cytokinesis, and its dysfunction can lead to mitotic catastrophe and cell death (30,31). Conversely, other studies suggest that specific ESCRT-III components can be hijacked by cancer cells to enhance survival signaling (27,32,33). Our data align with a model where URGCP-mediated upregulation of CHMP4B supports OS cell proliferation and survival. The precise mechanism by which URGCP regulates CHMP4B expression warrants further investigation, potentially involving transcriptional control or post-transcriptional stabilization.

When considering the translational value of URGCP, however, its tissue specificity warrants careful evaluation. Notably, accumulating evidence has demonstrated that URGCP is upregulated in a wide range of malignancies, including HCC, GC, BC, glioma, prostate cancer, cervical cancer, and colon cancer (12,15,34), suggesting that URGCP may function as a broad-spectrum oncogene rather than an OS-specific biomarker. However, to date, no study has systematically compared URGCP expression across different bone sarcoma subtypes. Consequently, the diagnostic value of URGCP identified in our study should be interpreted as auxiliary discrimination between OS and normal controls, rather than as a specific diagnostic marker for OS.

While our findings position URGCP as a promising candidate for further investigation, several critical limitations currently preclude its clinical application as a prognostic or predictive biomarker in OS. First, the diagnostic and prognostic performance of URGCP has not been validated in large, multicenter, prospective cohorts. Most available evidence, including our own, is derived from retrospective analyses of publicly available datasets with relatively limited sample sizes, which are susceptible to selection bias and may not accurately reflect the heterogeneous clinical presentations of OS patients. Second, the optimal cutoff value for stratifying patients based on URGCP expression has not been established, and its independence from conventional clinicopathological parameters—such as tumor size, Enneking stage, histological subtype, and chemotherapy response—remains to be determined through multivariate analyses. Third, the dynamic changes of URGCP expression during disease progression or in response to treatment have not been characterized. Fourth, our current study did not assess the utility of URGCP as a predictor of treatment response, particularly to standard chemotherapy regimens (e.g., methotrexate, cisplatin, and doxorubicin). Whether URGCP expression levels correlate with chemosensitivity or resistance remains entirely unknown. While URGCP may serve as a companion biomarker in specific contexts, its transition from a molecular finding to a clinically actionable test will require extensive standardization of assay platforms, inter-laboratory validation, and the establishment of robust thresholds for clinical decision-making. These challenges underscore the need for rigorous, adequately powered prospective studies to define its true clinical utility. Additionally, we acknowledge that all expression analyses in the present study were performed on cultured cell lines and animal tissues. To facilitate clinical translation, future studies should validate the expression and clinical relevance of URGCP and CHMP4B using formalin-fixed paraffin-embedded (FFPE) samples by RT-qPCR in clinically well-characterized patient cohorts, with inclusion of both metastatic and non-metastatic cases. It would also be worthwhile to determine whether these findings remain consistent across the bimodal age distribution characteristic of OS. Beyond its potential diagnostic utility, the role of URGCP in tumor progression—particularly in metastasis, the leading cause of death in OS patients—merits further exploration.

Despite these limitations, the functional relevance of URGCP in tumor progression is supported by evidence from other malignancies and from the mechanistic link to CHMP4B established in our study. Our findings are consistent with and extend previous reports of URGCP’s oncogenic functions in other malignancies. URGCP is upregulated in human HCC, GC, BC, and NSCLC, where it promotes proliferation and tumorigenicity (9-15,17). Beyond proliferation, URGCP also drives metastatic progression: in NSCLC, URGCP promotes invasion and metastasis via NF-κB/MMP-9 activation, and its silencing nearly abolishes metastatic capacity (15). In OS, miR-708-5p, which targets URGCP, inhibits cell migration and invasion, implying a similar role for URGCP in OS metastasis (35). Moreover, CHMP4B, the downstream effector identified in our study, has been implicated in metastatic progression: CRISPR/Cas9-mediated CHMP4B knockout prevents tumor cells from repairing cytotoxic T lymphocyte (CTL)-induced membrane damage, significantly suppressing metastasis (36), while high CHMP4B expression correlates with poor prognosis in endometrial cancer and has been identified as a key gene associated with lung cancer progression (37). Our study extends the repertoire of URGCP’s functions by linking it to the ESCRT pathway through CHMP4B. This connection suggests that URGCP may exert its pro-tumorigenic effects not only by directly driving the cell cycle but also by safeguarding cellular integrity and completing essential division processes via CHMP4B. The fact that CHMP4B overexpression largely rescued the phenotypes of URGCP knockdown underscores its pivotal role in this axis.

From a therapeutic standpoint, targeting critical oncogenic dependencies such as the URGCP-CHMP4B axis holds promise for the treatment of OS. Given that CHMP4B is part of the essential membrane remodeling complex, its inhibition could disrupt multiple pro-survival processes in cancer cells (22,38-40). While direct targeting of ESCRT components is challenging, our work identifies URGCP as a more tractable upstream regulator. Future efforts could focus on developing small-molecule inhibitors or degrader molecules against URGCP. Furthermore, assessing URGCP and CHMP4B expression levels in patient tumors could serve as a prognostic biomarker to stratify patients for more aggressive or targeted therapies.

Our study provides foundational insights into the URGCP-CHMP4B axis in OS, while also highlighting several experimental limitations that warrant acknowledgment. First, although we established that URGCP regulates CHMP4B expression, the precise molecular mechanism underlying this regulation requires further investigation to determine whether it occurs at the transcriptional, post-transcriptional, or post-translational levels. Second, while CHMP4B represents a key downstream effector of URGCP, we cannot exclude the possibility that additional molecular targets contribute to its oncogenic functions. Third, we acknowledge that the functional validation in this study was primarily performed using a single OS cell line (MG-63), which is an inherent limitation of our current work. To comprehensively assess the functional specificity and translational potential of URGCP, future investigations should be expanded to include a broader panel of OS cell lines, particularly those representing distinct osteogenic subtypes, such as Saos-2 and U-2 OS, as well as chondroblastic or fibroblastic variants. Fourth, we did not directly evaluate the effect of URGCP on tumor cell migration, invasion, or lung metastasis. Given the leading role of lung metastasis in OS mortality and the literature supporting the involvement of URGCP and CHMP4B in metastatic progression, future studies employing Transwell migration/invasion assays and tail-vein or intracardiac injection metastatic mouse models are warranted to definitively determine the role of this axis in OS metastasis. Fifth, we also acknowledge the relatively limited sample size in this study, which underscores the need for further validation in larger cohorts. Addressing these experimental limitations will be essential to further establish the functional relevance and therapeutic potential of the URGCP-CHMP4B axis.

Conclusions

In conclusion, we have identified URGCP as a novel oncogene in OS that promotes tumor progression by regulating the ESCRT-III subunit CHMP4B. This newly described URGCP-CHMP4B axis provides a deeper understanding of OS pathogenesis and unveils a potential new avenue for therapeutic intervention. Beyond its therapeutic implications, URGCP may also hold promise as a prognostic and predictive biomarker, pending confirmation through rigorous clinical validation studies in well-characterized patient cohorts.

Supplementary

The article’s supplementary files as

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were performed under a project license (No. kmmu20221193) granted by the Institutional Animal Care and Use Committee of Kunming Medical University, in compliance with the NIH Guide for the Care and Use of Laboratory Animals.

Data Sharing Statement

Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1420/dss

tcr-15-9-692-dss.pdf ^{(72.5KB, pdf)}

DOI: 10.21037/tcr-2026-1420