Skip to main content
NCBI home page
The Journal of Physiological Sciences : JPS logoLink to The Journal of Physiological Sciences : JPS
. 2026 Sep 28;76(3):100103. doi: 10.1016/j.jphyss.2026.100103

Gamma-oryzanol promotes neurite extension in NGF-primed PC12 cells and enhances viability/process elongation in immortalized Schwann cells

Takeshi Shimizu 1
PMCID: PMC13659583  PMID: 42826535

Abstract

Phytochemicals are natural compounds found in vegetables and fruits. Gamma-oryzanol (Orz) is present in rice bran generated during the milling process. Health effects of Orz have yet to be fully elucidated. We found that Orz treatment enhanced neurite/process extension in both nerve growth factor-primed PC12 pheochromocytoma cells and immortalized Schwann cells (IFRS1 cells). Orz also improved the viability of IFRS1 cells cultured under low-serum conditions. LY294002, a PI3K inhibitor, caused a polygonal cobblestone-like morphology in IFRS1 cells, while Orz treatment cancelled this effect. Although LY294002 increased the number of apoptotic IFRS1 cells, this effect was not influenced by Orz treatment, suggesting that the effects of Orz on Schwann cell morphology are mediated through downstream effectors of the PI3K pathway rather than through cell viability. Taken together, Orz promotes process extension of two types of neural cells and enhances Schwann cell viability, suggesting therapeutic potential for regeneration after peripheral nerve injury.

Keywords: Gamma-oryzanol, PC12, Schwann cell, Morphology, Viability

Introduction

Phytochemicals are natural compounds found in plants, contributing to their colors and aromas. They have attracted attention because of their wide variety of health-promoting effects [1]. Rice (Oryza sativa L.) is a staple food for more than 50% of the world’s population. Gamma-oryzanol (Orz) is a compound included in rice bran, which is generated during rice processing. Rice bran has been reported to have beneficial health effects, such as tumor progression, inflammatory responses, immune function, oxidative stress and lipid metabolism [2], [3]. However, the neuroprotective effects of Orz have yet to be fully elucidated.

Schwann cells are myelinating cells of the peripheral nervous system [4]. They interact with peripheral neurons and stimulate myelination by releasing various growth factors. Schwann cells are considered potential therapeutic targets for peripheral nerve injuries. However, the effects of Orz on Schwann cells have not yet been reported.

PC12 cells were originally isolated and established as a cell line from rat adrenal medulla pheochromocytoma [5]. These cells do not require nerve growth factor (NGF) for survival; however, when exposed to NGF, they stop proliferating and extend neurites, acquiring properties similar to those of sympathetic ganglion neurons. Therefore, NGF-primed PC12 cells are widely used as a model of differentiated neurons. Previous studies have demonstrated that rice bran extract containing Orz protects PC12 cells from mitochondrial dysfunction in a cell culture model of Alzheimer's disease (PC12APPsw cells), which releases very low levels of amyloid-β (Aβ40) and thus mimics the early stages of the disease, by improving ATP production and mitochondrial respiratory rates [6], [7]. Other effects of Orz on PC12 cells have yet to be reported.

In this study, we investigate whether Orz can promote neural functions using PC12 cells and immortalized Fischer 344 rat Schwann cells (IFRS1 cells) [8]. We found that Orz facilitates process extension of these two types of cells, as well as IFRS1 cell viability. The findings of the present study suggest that the effects of Orz on Schwann cell morphology are mediated through downstream effectors of the PI3K pathway.

Sciatic nerve injury causes neural degeneration in the peripheral nervous system (PNS) followed by axonal regeneration and remyelination. Neuronal process extension and enhancement of Schwann cell function by Orz treatment can represent a novel therapeutic strategy for regeneration after peripheral nerve injury.

Methods

Antibodies and recombinant proteins

The following antibodies or reagents were purchased from the specified vendors: mouse anti-MAP2 antibody (1/400, Chemicon, MAB3418 [9]), rat anti-myelin basic protein (MBP) antibody (1/300, Millipore, MAB386 [10]), rabbit anti-cleaved caspase3 antibody (1/500, Cell Signaling, #9661 [11]), rabbit anti-phospho-Histone H3 antibody (1/500, Upstate, 06–570 [12], [13]), mouse nerve growth factor 7S subunit native protein (NGF, Thermo Fisher Scientific, 13290–010), PI3K inhibitor LY294002 (abcam, ab120243), MEK inhibitor PD0325901 (Tokyo Chemical Industry Co., Ltd., Tokyo, Japan, P2897) and fibronectin from bovine plasma (Sigma, F4759).

PC12 cell culture

PC12 pheochromocytoma cells (RCB0009, RIKEN BRC) were cultured on poly-L-lysine (PLL, Fujifilm Wako, Osaka, Japan, 333–30751)-coated culture plastics in Dulbecco’s Modified Eagle Medium (DMEM) with 10% horse serum (HS), 5% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin. The cells were then seeded on PLL- and fibronectin-coated glass coverslips (13 mm round, Matsunami Glass Ind., Ltd., Osaka, Japan). Although PLL has been used to enhance the attachment of PC12 cells [14], dual-component coatings consisting of PLL and fibronectin have been reported to further enhance cell attachment, proliferation, and neurite outgrowth [15]. To induce the differentiation of PC12 cells, NGF (50 ng/ml) was applied to the culture medium, and Orz (50 or 200 µM; Fujifilm Wako, Osaka, Japan, 152–01272) solubilized in dimethyl sulfoxide (DMSO) was applied to PC12 cells to assess the effects on their morphology. Cells were then maintained for one or two additional days.

IFRS1 cell culture

IFRS1 cells (SWN-IFRS1C, Cosmo Bio Co., Ltd.) were seeded on 24 well culture plates (1.5 ×104/cm2) and maintained overnight in growing medium, a 1:1 mixture of commercially available Schwann cell (IFRS1) medium (Cosmobio, Tokyo, Japan, SWNMR): DMEM (Thermo Fisher Scientific) supplemented with 5% FBS. On the next day, the culture medium was changed to DMEM containing 1% FBS, and maintained in the presence (20, 80 or 300 μM) or absence of Orz for 3 or 6 days.

Immunostaining

The cultured cells were fixed with 4% paraformaldehyde (PFA) at room temperature in phosphate-buffered saline (PBS, pH 7.4) and used for immunostaining. Fixed cells were blocked with 5% normal horse serum in PBS containing 0.1% Triton X-100 (PBST) and then incubated with primary antibodies overnight at 4°C. After being rinsed with PBST, the cells were incubated with secondary antibody. The secondary antibody used were biotinylated horse anti-mouse/rabbit IgG (H＋L) (Vector, BA-1400). The Vectastain Elite ABC kit (Vector) was used for immunostaining with the horseradish peroxidase (HRP) substrate diaminobenzidine (DAB). DAB signals were visualized with an Olympus CX33 microscope (Olympus, Tokyo, Japan). The positive signals for immunostaining with anti-cleaved caspase3 antibody were counterstained by methyl green solution (Fujifilm Wako, Osaka, Japan, 138–12701)

RNA preparation and real-time quantitative RT-PCR

Total RNA was isolated from IFRS1 cells using Sepasol RNA I Super G reagent (Nacalai, Kyoto, Japan). The first-strand cDNA was synthesized with 2 µg of total RNA using ReverTra Ace (TOYOBO, Osaka, Japan). Real-time quantitative RT-PCR (qRT-PCR) was performed with 10 µl of KAPA SYBR FAST qPCR master mix reagent (Roche, Switzerland), 0.2 µM specific primer sets (for Krox-20, p75, SOX-10 and β-actin, primer sequences are shown below), and 1 µl of the prepared cDNA. Real-time quantitative RT-PCR analysis was performed using a MYGO MINI analyzer (IT-IS Life Science Ltd). PCR amplification was performed using a two-step cycling protocol consisting of 45 cycles of denaturation at 95°C and annealing/extension at 60°C. To distinguish specific amplification from nonspecific amplification, the melting curve was analyzed after each PCR reaction. Two replicates were averaged for each sample measurement. The primer sets used in this study were as follows:

Krox-20: Forward primer: TGTCCCACCTTCTCACAGAC, Reverse primer: TCAGAGCAACTGGCATCGAG.

p75: Forward primer: GGTGATGGCAACCTCTACAG, Reverse primer: AAGGGCATCAAGCGTTGCAC.

SOX-10: Forward primer: TACTCTGACCATCAGCCCTC, Reverse primer: TACTGGCTGTTCCCAGTGTG.

β-actin: Forward primer: CTCCCTGGAGAAGAGCTATG, Reverse primer: GCACTGTGTTGGCATAGAGG.

Measurement of PC12 cell process length and IFRS1 cell process area

The average process length was calculated from the five longest processes in PC12 cells among all process-bearing cells in each field, as traced using ImageJ software (NIH). When a process contacted another cell before reaching its distal end, its length was defined as the distance from the cell body to the point of contact, and this identifiable segment was also included in the measurement. Only the portion that could be clearly identified and traced as a single process was analyzed.

Process area of IFRS1 cells was quantified using ImageJ software. Each image was first converted to an 8-bit grayscale image. Thresholding (binarization) was then performed by adjusting the threshold so that process regions were highlighted while cytoplasmic regions were excluded. The resulting binary image was subsequently used to measure process area. To normalize for differences in cell numbers across fields of view, the measured values were divided by the number of cells in each field, and the process area per cell was evaluated.

Statistical analyses

All results are expressed as the mean±SEM. For comparison of two groups, a Student’s t-test was used. p values < 0.05 were considered significant. Data for multiple comparisons were analyzed by two-way ANOVA followed by Tukey's multiple comparisons test using the statistical program SPSS (IBM, Armonk, NY, USA) for Fig. 4 and Fig. 5 or one-way ANOVA followed by Tukey's multiple comparisons test using the statistical program GraphPad InStat 3 (GraphPad Software, San Diego, CA, USA). The level of significance was p < 0.05.

Fig. 4.

Fig. 4

Open in a new tab

LY294002 induced a cobblestone-like morphology in IFRS1 cells, whereas treatment with Orz for 3 days cancelled these effects. (A-D) LY294002-treated (C, D) or vehicle-treated (A, B) IFRS1 cell morphology visualized by immunostaining for MBP (myelin basic protein) was shown with (B, D) or without Orz (A, C) applied for 3 days. (E) The percentage of the process area per cell in each field was shown in the graph for cells treated with or without Orz in the presence (5 µM) or absence of LY294002. Groups with the same symbol were not significantly different (two-way ANOVA followed by Tukey's multiple comparisons test, n = 10 fields of view analyzed each). (F) The expression levels of the Schwann cell regulatory genes Krox-20, p75 and SOX-10 were analyzed by real-time quantitative RT-PCR using RNA samples prepared from vehicle-treated and Orz-treated (80 µM) cells in the presence (5 µM) or absence of LY294002. Gene expression was normalized to β-actin, and the expression level in the vehicle-treated group was set to 1. Orz treatment did not alter the expression of these Schwann cell regulatory genes (No significant difference by one-way ANOVA with a Tukey post hoc test, n = 3 independently prepared samples). (G, H) IFRS1 cells positive for phospho-Histone H3 were shown with (H) or without Orz (G) for 3 days in the absence of LY294002. Phospho-Histone H3-positive cells were identified by the presence of a distinct nuclear dot signal, and cells exhibiting a clear nuclear dot signal were counted as positive. Arrows indicate representative phospho-Histone H3-negative cells. (I) The ratio of phospho-Histone H3-positive cells / total cells was shown in the graph with or without Orz in the presence (5 µM) or absence of LY294002 (No significant difference by two-way ANOVA followed by Tukey's multiple comparisons test, n = 12 fields of view analyzed each). Scale bar, 100 µm.

Fig. 5.

Fig. 5

Open in a new tab

LY294002 increased the number of apoptotic IFRS1 cells cultured for 3 days, while this effect was not influenced by Orz treatment. (A-D) LY294002-treated (C, D) or vehicle-treated (A, B) IFRS1 cells positive for cleaved caspase3 were shown with (B, D) or without Orz (A, C) applied for 3 days. The cleaved caspase3-positive cells were shown by nuclear dot signal, and total cells were shown by methyl green staining. (E) The ratio of cleaved caspase3-positive cells / total cells was shown in the graph with or without Orz in the presence (5 µM) or absence of LY294002. Groups with the same symbol were not significantly different, whereas groups without the same symbol were significantly different (two-way ANOVA followed by Tukey's multiple comparisons test, n = 10 fields of view analyzed each). (F) Schematic illustration of the effects of Orz. Orz-induced process extension in PC12 cells is independent of the PI3K pathway. Orz-induced morphological changes in IFRS1 cells occur independently of cell differentiation and viability. In the present study, Orz ameliorated the morphological alterations and impaired process extension induced by the PI3K inhibitor LY294002 in IFRS1 cells, whereas it did not suppress the LY294002-induced increase in cell death. These findings suggest that the effects of Orz on Schwann cell morphology are mediated, at least in part, through signaling mechanisms that are distinct from those regulating cell survival. Our study suggests that Orz may promote neuronal process extension and Schwann cell survival, potentially contributing to remyelination following peripheral nerve injury. Abbreviation: PIP3: Phosphatidylinositol (3,4,5)-trisphosphate, ILK: Integrin-linked kinase, ROCK: Rho-associated protein kinase, GSK3: Glycogen Synthase Kinase 3, mTOR: mechanistic target of rapamycin, MDM2: murine double minute 2, BAD: Bcl-2-associated agonist of cell death, Bcl-2: B-cell lymphoma 2, FOXO: Forkhead box O. Scale bar, 100 µm.

Results

Orz increases the length of PC12 cell processes

PC12 cell differentiation is induced by NGF treatment, as shown by the neurite outgrowth [5]. In the present study, PC12 cells were treated with Orz (50 or 200 µM), immediately followed by application of 50 ng/ml NGF for one or two days. The morphology of PC12 cells was visualized by immunostaining for microtubule-associated protein 2 (MAP2). When PC12 cells were treated with Orz plus NGF for one or two days, the length of cell processes was significantly longer than that treated with NGF alone (Fig. 1A-D, F). Treatment with Orz did not promote process elongation in the absence of NGF, suggesting that the effect of Orz on PC12 cell processes is NGF-dependent (Fig. 1E, G). Previous study reported that Orz treatment induced adult mouse hippocampus derived-neural progenitor cell differentiation towards neuronal lineage, as demonstrated by the increase in MAP2-positive cells [16]. Orz did not increase the number of PC12 cells with outgrowing neurites (Fig. 1H), suggesting that Orz increased the length of PC12 cell processes independently of NGF-induced cell differentiation.

Fig. 1.

Fig. 1

Open in a new tab

Orz increased the process length of PC12 cells, but it did not promote NGF-induced differentiation. (A-C) PC12 cell morphology visualized by immunostaining for MAP2 was shown with or without Orz applied for 2 days. (D) The process length was shown in the graph with or without Orz applied for one day in vitro (DIV) in the presence of NGF (one-way ANOVA with a Tukey post hoc test, ***, p < 0.001, n = 65 cells analyzed each). PD0325901 (0.2 µM, a MEK inhibitor) inhibited neurite outgrowth of PC12 cells by NGF. Orz did not up-regulate the neurite outgrowth in the presence of PD0325901 (No significant difference by one-way ANOVA with a Tukey post hoc test, n = 48 cells analyzed each). (E) The process length was shown in the graph with or without Orz applied for one DIV in the absence of NGF (No significant difference by one-way ANOVA with a Tukey post hoc test, n = 97 cells analyzed each). (F) The process length was shown in the graph with or without Orz applied for two DIV in the presence of NGF (one-way ANOVA with a Tukey post hoc test, ***, p < 0.001, n = 65 cells analyzed each). No reduction of neurite outgrowth was observed by LY294002 (10 µM, a PI3K inhibitor) in the presence of NGF. The effect of Orz on PC12 cell process extension was not impaired by LY294002. (G) The process length was shown in the graph with or without Orz applied for two DIV in the absence of NGF (No significant difference by one-way ANOVA with a Tukey post hoc test, n = 85 cells analyzed each). (H) The ratio of cells with neurites / total cells was shown in the graph with or without Orz co-applied with NGF for two DIV (No significant difference by Student’s t, n = 11 fields of view analyzed each). Scale bar, 50 µm.

The activation of ERK, an extracellular signal-regulated kinase, was previously reported in PC12 cells by NGF treatment [17]. PD0325901, a MEK inhibitor, inhibited neurite outgrowth of PC12 cells induced by NGF (Fig. 1D), as reported previously [18]. Orz did not promote the neurite outgrowth in the presence of PD0325901 (Fig. 1D).

LY294002 is a well-known compound that inhibits Phosphoinositide 3-kinase (PI3K; [19]). The neurite outgrowth was not downregulated by LY294002 (10 µM, a PI3K inhibitor) in the presence of NGF (Fig. 1F), consistent with the previous study using the same concentration (10 µM) of LY294002 [18]. Furthermore, the effect of Orz on process extension in PC12 cells was not influenced by LY294002 (Fig. 1F), indicating that Orz increased the process length of PC12 cells independently of the PI3K pathway.

Orz also promotes process extension in a Schwann cell line (IFRS1 cell)

We next used another neural IFRS1 cell, a commercially available Schwann cell [20]. The cells were seeded on 24 well culture plates and cultured with different concentrations of Orz for 3 days. IFRS1 cell morphology with or without Orz was visualized by immunostaining for myelin basic protein (MBP), a major component of myelin proteins. As a result, the length of IFRS1 cell processes was significantly increased by Orz treatment for 3 days (Fig. 2A-C).

Fig. 2.

Fig. 2

Open in a new tab

Orz enhanced process extension in IFRS1 cell. (A, B) IFRS1 cell morphology visualized by immunostaining for MBP (myelin basic protein) was shown with (B) or without Orz (A) applied for 3 days. (C) The percentage of the process area per cell in each field was shown in the graph for cells treated with or without Orz (one-way ANOVA with a Tukey post hoc test, *, p < 0.05, **, p < 0.01, ***, p < 0.001, n = 12 fields of view analyzed each). Scale bar, 100 µm.

Orz facilitates the viability of IFRS1 cells cultured under low-serum conditions for 6 days

We next assessed the effects of Orz on IFRS1 cell viability. IFRS1 cells were seeded and maintained overnight in the growing medium (See Methods), and then cultured under low-serum conditions (1% FBS) for 6 days with different concentrations of Orz. The viability of IFRS1 cells was assessed by immunostaining for cleaved caspase3, an apoptotic marker. The positive cells for cleaved caspase3 were decreased by Orz treatment (Fig. 3A-C), indicating that Orz promoted the viability of IFRS1 cells even under low-serum conditions for 6 days.

Fig. 3.

Fig. 3

Open in a new tab

Orz improved the viability of IFRS1 cells cultured under low-serum conditions. (A, B) The positive cells for cleaved caspase3, an apoptotic marker, in IFRS1 cells cultured under low serum condition (1% FBS) for 6 days were shown with (B) or without Orz (A). The cleaved caspase3-positive cells were shown by nuclear dot signal, and total cells were shown by methyl green staining. (C) The ratio of cleaved caspase3-positive cells / total cells was shown in the graph with or without Orz (one-way ANOVA with a Tukey post hoc test, *, p < 0.05, **, p < 0.01, n = 11 fields of view analyzed each). Scale bar, 100 µm.

LY294002, a PI3K inhibitor, causes a cobblestone-like morphology in IFRS1 cells, whereas treatment with Orz for 3 days cancels these effects

PI3K/Akt signaling pathway is well known to be involved in cell differentiation, proliferation, cell viability and actin cytoskeleton arrangement in various types of cells. Previous studies have reported that PI3K/Akt pathway controls proliferation, cell viability and migration of Schwann cells [21]. When IFRS1 cells were treated with LY294002 (5 µM), a specific inhibitor of PI3K, for 3 days, a polygonal cobblestone-like morphology of IFRS1 cells was observed (Fig. 4A, C, E). We examined the effect of Orz on LY294002-induced morphological changes in IFRS1 cells. Interestingly, Orz treatment reversed the cobblestone-like morphology induced by LY294002 in IFRS1 cells, which exhibited a greater number of cells with longer processes (Fig. 4A-E). To determine whether the process extension and cobblestone-like morphology of IFRS1 cells were associated with their differentiation state, we examined the expression of the differentiation markers Krox-20, p75 and SOX-10 [22], [23] by quantitative real-time RT-PCR two days after Orz treatment. No significant differences in the expression levels of these markers were observed between Orz-treated and vehicle-treated cells, either in the presence or absence of LY294002 (Fig. 4F). These results suggest that the observed morphological changes by Orz, including process extension and cobblestone-like morphology, occur independently of changes in the differentiation state of IFRS1 cells. In addition, treatment with Orz did not affect the proliferation of IFRS1 cells cultured for 3 days in the presence or absence of LY294002, as assessed by immunostaining for phospho-histone H3, a marker of mitosis (Fig. 4G-I).

LY294002 increases the number of positive cells for an apoptotic marker in IFRS1 cells cultured for 3 days, whereas it is not influenced by Orz treatment

The cytotoxic effect of LY294002 on IFRS1 cells was investigated by immunostaining for cleaved caspase3, an apoptotic marker. The number of cleaved caspase-3-positive cells was increased by LY294002 treatment compared with vehicle treatment (Fig. 5A, C, E) similarly to the previous reports [24], [25], whereas it was not influenced by Orz treatment (Fig. 5A-E). These results indicate that the cytotoxic aspect of LY294002 is not correlated with the ability of Orz to cancel the polygonal cobblestone-like morphological change. Furthermore, treatment with PD0325901, a MEK inhibitor, also reduced the viability of IFRS1 cells (data not shown), as reported previously [26], [27]. PD0325901 treatment resulted in the appearance of more round-shaped cells without processes than vehicle treatment.

Discussion

Previous studies have reported the roles of PI3K in the axonal contact-dependent regulation of Schwann cell development, including proliferation, survival and the initial stages of myelination [28]. Although Orz ameliorated the morphological alterations and impaired process extension induced by the PI3K inhibitor LY294002 in IFRS1 cells, it did not suppress the LY294002-induced increase in apoptotic cell death. These findings suggest that the effects of Orz on Schwann cell morphology may be mediated, at least in part, through mechanisms distinct from those regulating cell survival. The PI3K/Akt signaling pathway plays multiple roles in Schwann cell biology, including the regulation of survival, differentiation, and myelination [29], [30], and its downstream effectors are also involved in the control of cellular growth and cytoskeletal organization. For example, Akt-mediated regulation of GSK-3β has been implicated in the control of microtubule dynamics and cellular morphology [31], whereas mTOR signaling contributes to cellular growth and membrane expansion [32]. In addition, integrin-linked kinase (ILK) and Rho-associated protein kinase (ROCK), which have been reported to be activated downstream of PI3K via phosphatidylinositol (3,4,5)-trisphosphate (PIP3) [33], have been implicated in the regulation of Schwann cell morphology and peripheral nerve regeneration [34]. Therefore, Orz may modulate signaling pathways downstream of PI3K or parallel signaling pathways that preferentially regulate cytoskeletal organization and process extension, rather than simply restoring the PI3K-dependent survival signaling. In particular, the PI3K/Akt/GSK-3β, mTOR-associated, and ILK–ROCK signaling pathways may represent potential mechanisms underlying the morphological effects of Orz. Further studies will be required to determine the precise molecular mechanisms involved.

Proper process extension, axonal sorting and remyelination were impaired in integrin-linked kinase (ILK)-deficient Schwann cells, which exhibited shorter processes, while application of a ROCK inhibitor rescued these deficits, including process extension [34], indicating that process length of Schwann cells is highly correlated with peripheral nerve myelination. It is thus possible that Orz-induced process extension enhances Schwann cell function and/or myelination.

In the present study, we demonstrated that Orz increased the process length of PC12 cells independently of the PI3K pathway. On the other hand, Orz treatment reversed the cobblestone-like morphology of IFRS1 cells induced by LY294002, raising the possibility of a correlation between the PI3K pathway and IFRS1 cell signaling initiated by Orz treatment. These findings suggest that the mechanism by which Orz alters cell morphology differs depending on the neural cell type. One limitation of this study is that the mechanisms underlying the effects of Orz on these two cell types, including its relationship with the PI3K pathway in IFRS1 cells and the molecular basis of its neurite outgrowth-promoting activity, remain to be elucidated. Further studies are needed to clarify the molecular mechanisms through which Orz exerts these effects.

Orz is a lipophilic molecule capable of penetrating the blood-brain barrier. It has been reported that orally administered Orz passes through the blood-brain barrier in its intact form, retaining its ester bonds, and distributes into the mouse brain at high concentrations [35]. The findings of the present study could also be applicable to cortical neurons and myelinating oligodendrocytes in the brain.

Sciatic nerve injury causes neural degeneration in the nerve stump, followed by rapid axonal regrowth and remyelination [36]. In the present study, we showed that Orz facilitated process extension in both PC12 cells and IFRS1 cells, as well as IFRS1 cell viability. It is possible that Orz treatment improves neuronal process extension, Schwann cell survival and remyelination in injured PNS regions. Orz application could provide a new therapeutic approach for regeneration after peripheral nerve injury. Further investigation is needed to address this issue using animal models of PNS injury treated with Orz.

A previous study revealed that myelin formation occurs in a coculture of PC12 cells and IFRS1 cells [37]. The neuroprotective activity of Orz will be further investigated using neuron-Schwann cell co-culture systems.

Conclusions

Orz treatment enhanced process extension in both PC12 pheochromocytoma cells and IFRS1 cells, as well as the viability of IFRS1 cells. Orz treatment reversed the morphological changes induced by LY294002, suggesting that the effects of Orz on IFRS1 cell morphology are mediated through downstream effectors of the PI3K pathway. These findings suggest that Orz application can represent a novel therapeutic strategy for peripheral nerve regeneration by promoting neuronal process extension, Schwann cell survival and remyelination in injured regions.

Funding

This study was supported by Japan Society for the Promotion of Science Grants-in-Aid for Scientific Research (No 21K07278).

CRediT authorship contribution statement

Takeshi Shimizu: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Software, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Declaration of Competing Interest

There are no competing interests to declare.

Acknowledgements

We thank Dr. H Kikuchi for technical support.

Data Availability

The datasets used in this article are available when reasonable request is directed to the corresponding author.

References

  • 1.Pandohee J., Kyereh E., Kulshrestha S., Xu B., Mahomoodally M.F. Review of the recent developments in metabolomics-based phytochemical research. Crit. Rev. Food Sci. Nutr. 2023;63:3734–3749. doi: 10.1080/10408398.2021.1993127. [DOI] [PubMed] [Google Scholar]
  • 2.Henderson A.J., Ollila C.A., Kumar A., Borresen E.C., Raina K., Agarwal R., Ryan E.P. Chemopreventive properties of dietary rice bran: current status and future prospects. Adv. Nutr. 2012;3:643–653. doi: 10.3945/an.112.002303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Suwannachot P., Thawornchinsombut S., Jongjareonrak A., Sringam P., Senaphan K. Supplementation with rice bran hydrolysates reduces oxidative stress and improves lipid profiles in adult dogs. J. Vet. Med. Sci. 2023;85:727–734. doi: 10.1292/jvms.22-0513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jessen K.R., Mirsky R., Lloyd A.C. Schwann cells: development and role in nerve repair. Cold Spring Harb. Perspect. Biol. 2015;7:a020487. doi: 10.1101/cshperspect.a020487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Greene L.A., Tischler A.S. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. USA. 1976;73:2424–2428. doi: 10.1073/pnas.73.7.2424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hagl S., Kocher A., Schiborr C., Eckert S.H., Ciobanu I., Birringer M., El-Askary H., Helal A., Khayyal M.T., Frank J., Muller W.E., Eckert G.P. Rice bran extract protects from mitochondrial dysfunction in guinea pig brains. Pharmacol. Res. 2013;76:17–27. doi: 10.1016/j.phrs.2013.06.008. [DOI] [PubMed] [Google Scholar]
  • 7.Hagl S., Grewal R., Ciobanu I., Helal A., Khayyal M.T., Muller W.E., Eckert G.P. Rice bran extract compensates mitochondrial dysfunction in a cellular model of early Alzheimer's disease. J. Alzheimers Dis. 2015;43:927–938. doi: 10.3233/JAD-132084. PMID: 25125472. [DOI] [PubMed] [Google Scholar]
  • 8.Sango K., Yanagisawa H., Kawakami E., Takaku S., Ajiki K., Watabe K. Spontaneously immortalized Schwann cells from adult Fischer rat as a valuable tool for exploring neuron-Schwann cell interactions. J. Neurosci. Res. 2011;89:898–908. doi: 10.1002/jnr.22605. [DOI] [PubMed] [Google Scholar]
  • 9.Chan W.S., Sideris A., Sutachan J.J., Montoya G.J.V., Blanck T.J.J., Recio-Pinto E. Differential regulation of proliferation and neuronal differentiation in adult rat spinal cord neural stem/progenitors by ERK1/2, Akt, and PLCγ. Front. Mol. Neurosci. 2013;6:23. doi: 10.3389/fnmol.2013.00023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Eckharter C., Junker N., Winter L., Fischer I., Fogli B., Kistner S., Pfaller K., Zheng B., Wiche G., Klimaschewski L., Schweigreiter R. Schwann cell expressed Nogo-B modulates axonal branching of adult sensory neurons through the Nogo-B receptor NgBR. Front. Cell. Neurosci. 2015;9:454. doi: 10.3389/fncel.2015.00454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Shimizu T., Osanai Y., Tanaka K.F., Thai T.Q., Abe M., Natsume R., Sakimura K., Ikenaka K. Mechanical regulation of oligodendrocyte morphology and maturation by the mechanosensor p130Cas. J. Neurochem. 2019;150:158–172. doi: 10.1111/jnc.14657. [DOI] [PubMed] [Google Scholar]
  • 12.Herman-Antosiewicz A., Singh S.V. Checkpoint kinase 1 regulates diallyl trisulfide-induced mitotic arrest in human prostate cancer cells. J. Biol. Chem. 2005;280:28519–28528. doi: 10.1074/jbc.M501443200. [DOI] [PubMed] [Google Scholar]
  • 13.Ishikawa A., Yamauchi M., Suzuki K., Yamashita S. Image-based quantitative determination of DNA damage signal reveals a threshold for G2 checkpoint activation in response to ionizing radiation. Genome Integr. 2010;1:10. doi: 10.1186/2041-9414-1-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Akeson R., Warren S.L. PC12 adhesion and neurite formation on selected substrates are inhibited by some glycosaminoglycans and a fibronectin-derived tetrapeptide. Exp. Cell. Res. 1986;162:347–362. doi: 10.1016/0014-4827(86)90340-X. [DOI] [PubMed] [Google Scholar]
  • 15.Orlowska A., Perera P.T., Kobaisi MAl, Dias A., Nguyen H.K.D., Ghanaati S., Baulin V., Crawford R.J., Ivanova E.P. The Effect of Coatings and Nerve Growth Factor on Attachment and Differentiation of Pheochromocytoma Cells. Materials (Basel) 2017; 11: 60. doi: 10.3390/ma11010060. [DOI] [PMC free article] [PubMed]
  • 16.Abate G., Pezzotta A., Pucci M., Bortolotto V., Ribaudo G., Bonini S.A., Mastinu A., Maccarinelli G., Ongaro A., Tirelli E., Zizioli D., Gianoncelli A., Memo M., Grilli M., Uberti D. The bioactive gamma-oryzanol from oryza sativa l. promotes neuronal differentiation in different in vitro and in vivo models. Antioxid. (Basel) 2024;13:969. doi: 10.3390/antiox13080969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kano Y., Nohno T., Takahashi R., Hasegawa T., Hiragami F., Kawamura K., Motoda H., Sugiyama T. cAMP and calcium ionophore induce outgrowth of neuronal processes in PC12 mutant cells in which nerve growth factor-induced outgrowth of neuronal processes is impaired. Neurosci. Lett. 2001;303:21–24. doi: 10.1016/s0304-3940(01)01676-7. [DOI] [PubMed] [Google Scholar]
  • 18.Lu X.C., Zheng J.Y., Tang L.J., Huang B.S., Li K., Tao Y., Yu W., Zhu R.L., Li S., Li L.X. MiR-133b promotes neurite outgrowth by targeting RhoA expression. Cell. Physiol. Biochem. 2015;35:246–258. doi: 10.1159/000369692. [DOI] [PubMed] [Google Scholar]
  • 19.Vlahos C.J., Matter W.F., Hui K.Y., Brown R.F. A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002) J. Biol. Chem. 1994;269:5241–5248. PMID: 8106507. [PubMed] [Google Scholar]
  • 20.Saiki T., Nakamura N., Miyabe M., Ito M., Minato T., Sango K., Matsubara T., Naruse K. The Effects of insulin on immortalized rat schwann cells, IFRS1. Int. J. Mol. Sci. 2021;22:5505. doi: 10.3390/ijms22115505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ogata T., Iijima S., Hoshikawa S., Miura T., Yamamoto S., Oda H., Nakamura K., Tanaka S. Opposing extracellular signal-regulated kinase and Akt pathways control Schwann cell myelination. J. Neurosci. 2004;24:6724–6732. doi: 10.1523/JNEUROSCI.5520-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jessen K.R., Mirsky R. Signals that determine Schwann cell identity. J. Anat. 2002;200:367–376. doi: 10.1046/j.1469-7580.2002.00046.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jessen K.R., Mirsky R. Schwann cell precursors; multipotent glial cells in embryonic nerves. Front. Mol. Neurosci. 2019;12:69. doi: 10.3389/fnmol.2019.00069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Campana W.M., Darin S.J., O’Brien J.S. Phosphatidylinositol 3-kinase and Akt protein kinase mediate IGF-I- and prosaptide-induced survival in Schwann cells. J. Neurosci. Res. 1999;57:332–341. PMID: 10412024. [PubMed] [Google Scholar]
  • 25.Maurel P., Salzer J.L. Axonal regulation of Schwann cell proliferation and survival and the initial events of myelination requires PI3-kinase activity. J. Neurosci. 2000;20:4635–4645. doi: 10.1523/JNEUROSCI.20-12-04635.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Neff B.A., Voss S.G., Schmitt W.R., Driscoll C.L.W., Link M.J., Beatty C.W., Kita H. Inhibition of MEK pathway in vestibular schwannoma cell culture. Laryngoscope. 2012;122:2269–2278. doi: 10.1002/lary.23472. [DOI] [PubMed] [Google Scholar]
  • 27.Huang G., Sun Z., Wu J., Shui S., Han X., Guo D., Li T. Calreticulin promotes proliferation and migration but inhibits apoptosis in schwann cells. Med. Sci. Monit. 2016;22:4516–4522. doi: 10.12659/msm.900956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Heller B.A., Ghidinelli M., Voelkl J., Einheber S., Smith R., Grund E., Morahan G., Chandler D., Kalaydjieva L., Giancotti F., King R.H., Fejes-Toth A.N., Fejes-Toth G., Feltri M.L., Lang F., Salzer J.L. Functionally distinct PI 3-kinase pathways regulate myelination in the peripheral nervous system. J. Cell. Biol. 2014;204:1219–1236. doi: 10.1083/jcb.201307057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Figlia G., Gerber D., Suter U. Myelination and mTOR. Glia. 2018;66:693–707. doi: 10.1002/glia.23273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu Y.P., Shao S.J., Guo H.D. Schwann cells apoptosis is induced by high glucose in diabetic peripheral neuropathy. Life Sci. 2020;248 doi: 10.1016/j.lfs.2020.117459. [DOI] [PubMed] [Google Scholar]
  • 31.Kim Y.T., Hur E.M., Snider W.D., Zhou F.Q. Role of GSK3 signaling in neuronal morphogenesis. Front. Mol. Neurosci. 2011;4:48. doi: 10.3389/fnmol.2011.00048. eCollection 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ishii A., Furusho M., Bansal R. Mek/ERK1/2-MAPK and PI3K/Akt/mTOR signaling plays both independent and cooperative roles in Schwann cell differentiation, myelination and dysmyelination. Glia. 2021;69:2429–2446. doi: 10.1002/glia.24049. Epub 2021 Jun 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Delcommenne M., Tan C., Gray V., Rue L., Woodgett J., Dedhar S. Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc. Natl. Acad. Sci. USA. 1998;95:11211–11216. doi: 10.1073/pnas.95.19.11211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Pereira J.A., Benninger Y., Baumann R., Gonçalves A.F., Ozçelik M., Thurnherr T., Tricaud N., Meijer D., Fässler R., Suter U., Relvas J.B. Integrin-linked kinase is required for radial sorting of axons and Schwann cell remyelination in the peripheral nervous system. J. Cell. Biol. 2009;185:147–161. doi: 10.1083/jcb.200809008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kozuka C., Sunagawa S., Ueda R., Higa M., Tanaka H., Shimizu-Okabe C., Ishiuchi S., Takayama C., Matsushita M., Tsutsui M., Miyazaki J., Oyadomari S., Shimabukuro M., Masuzaki H. Gamma-Oryzanol protects pancreatic β-cells against endoplasmic reticulum stress in male mice. Endocrinology. 2015;156:1242–1250. doi: 10.1210/en.2014-1748. [DOI] [PubMed] [Google Scholar]
  • 36.Chen Z.L., Yu W.M., Strickland S. Peripheral regeneration. Annu. Rev. Neurosci. 2007;30:209–233. doi: 10.1146/annurev.neuro.30.051606.094337. [DOI] [PubMed] [Google Scholar]
  • 37.Sango K., Kawakami E., Yanagisawa H., Takaku S., Tsukamoto M., Utsunomiya K., Watabe K. Myelination in coculture of established neuronal and Schwann cell lines. Histochem. Cell. Biol. 2012;137:829–839. doi: 10.1007/s00418-012-0934-3. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used in this article are available when reasonable request is directed to the corresponding author.

Articles from The Journal of Physiological Sciences : JPS are provided here courtesy of Elsevier

RESOURCES