A Novel Plasma Biomarker hsa_circ_0080018 Drives DLBCL Progression via M2 Polarization of Tumor‐Associated Macrophages

Yanfeng Liu; Yanan Gao; Chuanli Zhao

doi:10.1111/cas.70554

. 2026 Oct 13:10.1111/cas.70554. Online ahead of print. doi: 10.1111/cas.70554

A Novel Plasma Biomarker hsa_circ_0080018 Drives DLBCL Progression via M2 Polarization of Tumor‐Associated Macrophages

Yanfeng Liu ^1,^✉, Yanan Gao ², Chuanli Zhao ^1,^✉

PMCID: PMC13660449 PMID: 42867210

ABSTRACT

Noncoding RNAs, including circular RNAs (circRNAs), have been demonstrated to play vital roles in tumorigenesis. Uncovering the functions of circRNAs in tumorigenesis and their underlying regulatory mechanisms may suggest new approaches to the development of novel diagnostic and therapeutic strategies for human cancer. Here we report the important role of hsa_circ‐0080018 in diffuse large B‐cell lymphoma (DLBCL) progression and the potential impact of hsa_circ‐0080018 in DLBCL tumorigenesis. Hsa_circ‐0080018 was evidently upregulated in newly diagnosed DLBCL patient plasma, and as a reference to classify GCB and non‐GCB subtypes. The high expression of hsa_circ‐0080018 also appeared in plasma exosome and can transport to tumor microenvironment (TME). In addition, we found that at the molecular level hsa_circ‐0080018 acted as a decoy for miR‐625‐5p and regulated tumor associated macrophage (TAM) polarization by suppressing miR‐625‐5p that led to IGF‐1/IGF‐1R pathway activation. The activated IGF‐1/IGF‐1R pressed macrophage polarizing to M2 and ultimately promoted tumor progression. Our results provided a new potential biomarker in DLBCL plasma that is correlated with cell of origin (COO). The mechanism of circ‐0080018 in tumor progression was plasma generated circ‐0080018 delivered to TME by exosome and pushed macrophage polarization. Our research may provide a new target for the DLBCL treatment and prognosis in future.

Keywords: diffuse large B‐cell lymphoma (DLBCL), hsa_circ‐0080018, plasma exosome, polarization, tumor associated macrophage (TAM)

The proposed mechanistic model in this study.

graphic file with name CAS-9999-0-g005.webp

Abbreviations

AML: acute myeloid leukemia
Bukitt: Burkitt's lymphoma
CLL/SLL: chronic lymphocytic leukemia/ small lymphocytic lymphoma
DLBCL: diffuse large B cell lymphoma
FL: follicular lymphoma
GCB: Germinal center B‐cell
MM: multiple myeloma
non‐GCB: non‐Germinal center B‐cell
TAM: tumor associated macrophage
TME: tumor microenvironment

1. Introduction

Diffuse large B‐cell lymphoma (DLBCL) is the most common histological subtype of non‐Hodgkin's lymphomas, representing approximately 25% of new diagnoses [1], and it can occur de novo or as a result of transformation from different types of low‐grade B‐cell lymphomas [1]. According to the cell‐of‐origin (COO), these were defined: germinal center B‐cell (GCB) (40%–50%) and non‐germinal center B‐cell (non‐GCB) (50%–60%) [2]. non‐GCB DLBCL cases were found to have a poorer outcome than GCB DLBCL patients when treated with standard therapy [3, 4].

Currently, the prognosis of DLBCL patients remains unsatisfactory, especially among those with refractory or relapsed disease after first‐line treatment [5]. This patient group represents an important unmet need in lymphoma treatment [1]. In recent years, improved understanding of the underlying molecular pathogenesis has led to new classification and prognostication tools.

CircRNAs are a naturally occurring family of noncoding RNAs generated from precursor mRNA back‐splicing of numerous genes in eukaryotes, and they are expressed in a cell‐specific or tissue‐specific manner [6]. CircRNAs that function as biomarkers in cancer have recently been identified [7], and abundant evidence suggests that circRNAs are abnormally expressed in human cancers and may play a critical role in cancer initiation and development [8, 9]. However, there have been few studies about circRNA in DLBCL, and most studies are from tumor tissue [1, 10, 11, 12, 13, 14] and it is still unknown whether plasma‐generated circRNAs participate in the malignancy of DLBCL.

Several studies have focused on the potential role of the tumor microenvironment (TME) in DLBCL pathogenesis, but the function of the TME remains controversial [15]. As a major component of the TME, tumor‐associated macrophages (TAMs) play a pivotal role in the progression of inflammation‐related cancers [16]. However, the functional role of TAMs in lymphoid malignancies, including B‐cell lymphoma, has not been well defined [17].

Exosomes are small membrane vesicles with a typical diameter of 30 to 100 nm [18], and they play critical roles in regulating signal transduction by delivering mRNAs, non‐coding RNAs (miRNAs, lncRNAs, circRNAs), and proteins between neighboring or distant cells [19, 20]. Recent studies have shown that circRNAs are enriched and stable in serum exosomes [9, 21], but the biological mechanisms of exosomal circRNAs remain unclear in DLBCL.

In the present study, the results, for the first time, show that circ‐0080018 was upregulated in DLBCL plasma, especially non‐GCB plasma; it could serve as a reference to classify COO. miR625‐5p as a sponge for hsa_circ‐0080018 acted upon macrophage, which finally led to tumor progression. Importantly, hsa_circ‐0080018 was also upregulated in patient plasma. Our results may be useful for predicting diagnosis and developing novel therapies to treat DLBCL in the future.

2. Materials and Methods

2.1. Patient Samples

All of the patient peripheral blood samples used in this study were collected from newly diagnosed DLBCL patients in Shandong University qilu hospital from 2018 to 2023 following the World Health Organization guidelines [22]. The project was approved by the ethics committee of Shandong University Qilu hospital, and written consent was obtained from all the patients. The healthy blood samples were from volunteers. The study was conducted in accordance with the Declaration of Helsinki.

2.2. Microarray‐Based circRNA Expression Profiles and Targeted Genes

The plasma from three DLBCL patients and three healthy persons was used for circRNA microarrays. The circRNA microarray hybridization and data collection were performed by CapitalBio Technology Human CircRNA Array V2 (Capital Biotechnology, Beijing, China). Differentially expressed circRNAs with statistical significance between the two groups were identified through fold change filtering or volcano plot filtering. Hierarchical clustering was performed to show that circRNAs were regarded as differentially regulated when there was a fold change ≥ 2.0 and p < 0.05. Microarray data are available in GEO under accession number GSE268711.

2.3. RNA Extraction and Quantitative Real‐Time PCR

The blood samples and cell culture supernatant were centrifuged at 1800 × g for 10 min, and the supernatant was collected by centrifuging at 12000 × g for 10 min at 4°C. CircRNA was extracted using a virus extraction kit (Qiagen, USA). Cultured cells RNA isolation was performed using Trizol Reagent (Invitrogen, USA) according to the manufacturer's instructions. Reverse transcription was performed using a reverse transcription kit (Promega, USA). qRT‐PCR analysis was performed according to the manufacturer's recommendations. All the primers used for qPCR are listed in Table S1.

2.4. Transfection Experiment

The circ‐0080018, miR625‐5p inhibitor, miR625‐5p mimic were transfected into cells using Lipofectamine Stem Reagent (Thermo Fisher Scientific, USA). The cells were harvested at 48 h after transfection. All siRNAs were synthesized and purchased from GenePharma Company (Shanghai, China) and listed in Table S1.

2.5. Cell Culture

DLBCL cell lines: U2932, CTB‐1, Farage, RIVA were gifted from the First Affiliated Hospital of Nanjing Medical University, Jiangsu Province Hospital and kept in our lab. DLBCL cell lines were maintained in RPMI 1640 medium (Gibco, USA) with 10% FBS (Gibco, USA). HEK‐293T was kept in our lab and cultured in DMEM medium (Gibco, USA) supplemented with 10% FBS. All cell lines were authenticated by short tandem repeat analysis within 2 years.

Peripheral blood mononuclear cells (PBMCs) were obtained from DLBCL patients and isolated using Ficoll. To induce macrophage differentiation, CD14⁺ monocytes were isolated by a classical monocyte isolation kit (Miltenyi Biotech, Germany) and then differentiated into macrophages with 50 ng/mL M‐CSF (Peprotech, USA) for 7 days in RPMI 1640 medium supplemented with 10% FBS. The initial cell density was 5–7.5 × 10⁵ cells/m. The induced PBMC‐derived macrophages were called Mφs.

2.6. Co‐Culture of DLBCL Cell Lines With Mφs

3 × 10⁵ cells/mL cultured different DLBCL cell lines were seeded into pre‐coated Mφs and cultured for 48 h. Mφs were polarized to M1 or M2 phenotype by lipopolysaccharide (LPS) (100 ng/mL) plus IFN‐γ (1 U/mL) for M1 and with IL‐4 (10 ng/mL) plus IL‐13 (10 ng/mL, Peprotech) or with IL‐10 (10 ng/mL, Peprotech) for M2 for 48 h. DLBCL cell lines and induced M1 or M2 cells were respectively as controls.

2.7. Dual‐Luciferase Reporter Assay

The wild‐type and mutant promoters were synthesized and inserted into pMIR‐REPORT luciferase vector (Applied Biosystems, USA), and then co‐transfected with miRNA mimics into HEK‐293T cell line using Lipofectamine Stem Reagent (Invitrogen, USA). Cells were harvested at 48 h after transfection and luciferase activity was measured with a dual‐luciferase reporter assay (Promega, Madison, USA) in accordance with standard protocols.

2.8. Flow Cytometry

Cells were detached with a cell scraper to obtain single cells. Cells were incubated with PE‐CD80 (560925, BD) and Alexa Fluro 647‐CD163 (562669, BD) antibodies and resuspended in buffer for the analysis on a flow cytometer (Beckman Coulter, USA). All the samples had their own isotype controls. The flow data was analyzed by Flow Jo v 10.8.1.

2.9. Enzyme‐Linked Immunosorbent Assay (ELISA)

The concentrations of TNF‐α (KE1372, ImmunoWay), IL‐10 (KE1369, ImmunoWay), IL‐6 (KE1368, ImmunoWay), and IGF‐1 (DG100B, R&D) produced by cell supernatant were measured by ELISA kits in accordance with the manufacturer's guidelines.

2.10. Fluorescence In Situ Hybridization (FISH)

The subcellular localization of hsa_circ‐0080018 was identified by the FISH technique according to the instructions provided with the FISH Probe Mix (GREEN). The cell hybridization was performed overnight with hsa_circ‐0080018 and probes. Specimens were analyzed on an Evos FL Auto2 (Invitrogen, USA). A specific FISH probe for circ‐0080018 (5′‐CCACTCCACTGCCCGTAACCAGCTT‐3′) was custom‐synthesized by GenePharma. Meanwhile, a negative control probe with the sequence 5′‐TGCTTTGCACGGTAACGCCTGTTTT‐3′ was adopted for parallel FISH detection.

2.11. Actinomycin D and RNase R Treatment

Actinomycin D (2 μg/mL, Selleck, USA) was added to the culture medium, and the cells were collected at pointed time to assess the stability of circ‐0080018 and its linear isoform. Total RNA (2 μg) was digested with 3 U/μg RNase R (Geneseed Biotech, China) for 15 min at 37°C followed by incubation at 80°C for 5 min to stop the reaction. Actinomycin D and RNase R‐treated RNA were used to quantify the relative levels of circ‐0080018 and linear RNAs by qRT‐PCR.

2.12. RIP Assay

To perform RNA immunoprecipitation, we used the Magna RIP kit (Millipore, USA) according to the manufacturer's instructions. Extracted RNAs were analyzed by qRT‐PCR to identify the presence of circ‐0080018.

2.13. Cell Proliferation

The CCK8 assay was performed to assess the proliferative ability of the DLBCL cell lines according to the manufacturer's instructions (Beyotime, China). The absorbance at 450 nm was measured by an automatic microplate reader (Synergy, USA).

2.14. Agarose Gel Electrophoresis

Nucleic acids were separated by 2% gel electrophoresis. The bands were visualized by ultraviolet light on a CHAMPCHEMI imaging system (Beijing, China).

2.15. Western Blot

The cells were lysed with RIPA buffer. Then, equal amounts of protein were resolved by 10% SDS‐PAGE analysis and transferred onto a PVDF membrane (Millipore, USA). The membranes were blocked with 5% BSA (Sigma, USA) for 1 h at room temperature and then incubated with the following primary antibodies at 4°C overnight: anti‐IGF‐1R (#9750, CST), anti‐Phospho‐IGF‐1R (#3024, CST), and anti‐GAPDH (#5174, CST). After washing, the membranes were incubated with HRP‐conjugated secondary antibodies (#7074, CST). The bands were developed in ECL substrate (Millipore, Germany) and imaged by a CHAMPCHEMI imaging system (Beijing, China). Relative protein expression levels were quantified using ImageJ software and normalized to GAPDH.

2.16. IHC Assay

Immunohistochemical staining was carried out in paraffin‐embedded tissue from newly diagnosed DLBCL patient's tumor tissue. The protocol was performed as previously described. Tissue sections were incubated with CD68 (#97778, CST), CD86 (#91882, CST), and CD163 (##93498, CST) antibodies at 4°C overnight and then incubated with biotinylated anti‐rabbit secondary antibody for 2 h. Dako EnVision+ System‐HRP (DAB) kits (Dako North America, USA) were used for signal development in the tissue sections. Finally, after washing and dehydrating the sections were sealed with coverslips and imaged by upright microscopy (Nikon, Japan).

2.17. Exosome Isolation and Electron Microscopy

Plasma was centrifuged at 300 g and 3000 g, and the supernatant was centrifuged at 10,000 g for 30 min. Exosomes were isolated using Exo Quick Exosome Precipitation Solution (SBI System Biosciences, USA) according to the manufacturer's instructions. The exosomes were then examined by transmission electron microscopy and western blot as described previously [23, 24, 25].

2.18. Statistical Analysis

Statistical analyses were performed with GraphPad Prism (GraphPad Software Inc., version 8.0). The differences between groups were assessed by Student t‐test. Data are presented as the mean ± standard deviation (SD). p‐values ≤ 0.001 (***) and 0.0001 (****) were considered as statistically significant. One‐way ANOVA statistical tests were adopted for more than two group.

3. Results

3.1. CircRNA Expression Profiles in DLBCL Patient Plasma and Validation of Differently Expressed circRNAs

To analyze the circRNA expression profiles in DLBCL, blood samples from three DLBCL patients and three healthy controls were collected for circRNA microarray analysis. A total of 3970 circRNAs were identified, and of these, 136 circRNAs were dysregulated in DLBCL patients (fold‐change ≥ 2, p ≤ 0.05), of which 22 circRNAs were up‐regulated and 114 were down‐regulated. The differentially expressed circRNAs were identified through hierarchical clustering (Figure 1A), and the volcano plot filter identified the differentially altered circRNAs between DLBCL patients and healthy controls (Figure 1B). To increase the accuracy and further narrow down the list, we evaluated all the differentially expressed circRNAs according to their overall raw signal intensities, statistical values, and fold change (FC), and six up‐regulated circRNAs were selected for further study, including hsa_circ‐0094856, hsa_circ‐0080018, hsa_circ‐00268337, hsa_circ‐0004525, hsa_circ‐0079645, and hsa_circ‐0026428. We further verified these six circRNAs in 10 DLBCL patients and 10 healthy controls, and distinct products of the expected size were amplified using spanning junction primers (Figure 1C,D). There were three up‐regulated circRNAs, among which hsa_circ‐0080018 showed the most significant differential expression (p < 0.001) and was confirmed by Sanger sequencing (Figure 1E). Therefore, hsa_circ‐0080018 was selected for further investigation.

Plasma circRNA expression profile in DLBCL. (A) The cluster heatmap showing the differentially expressed circRNAs with fold change > 2. Red indicates high expression, and green indicates low expression. (B) The volcano plot was constructed using the fold‐change value and p‐value. The vertical lines corresponded to 2.0‐fold changes up and down, respectively, and the horizontal line represents a p‐value of 0.05. (C) The relative circRNA expression in plasma samples was assessed in 10 DLBCL patients and 10 healthy controls. RNA expression levels were normalized to the expression of the reference gene *GAPDH* (Relative expression levels = ct value of *GAPDH*–ct value of circ‐0080018). (D) Distinct products of the detected circRNAs amplified and verified by 2% agarose gel electrophoresis. (E) The expected product size of circ‐0080018 was confirmed by Sanger sequencing.

3.2. Characterization of Circ‐0080018 in DLBCL Plasma

Hsa_circ_0080018 (chr7:44157217–44157663) is derived from exon 13 and partial exon 14 of POLD2 pre‐mRNA, which is located on chromosome 7p13, and here we termed it circ‐0080018 (Figure 2A). RNase R exonuclease and actinomycin D were used to validate the stability of RNA isoforms in the DLBCL cell lines. Resistance to RNase R exonuclease (Figure 2B) and actinomycin D (Figure 2C) confirmed that circ‐0080018 was highly stable and indeed circular. Random hexamer primers and oligo (dT)₁₈ primers were used to further prove that circ‐0080018 had no poly‐A tail. The enrichment of POLD2 mRNA was apparent using the two primers, whereas the abundance of circ‐0080018 was decreased using oligo (dT)₁₈ primers (Figure 2D).

Characterization and expression of circ‐0080018. (A) The genomic locus of circ‐0080018. Sanger sequencing was used to validate the circ‐0080018 expression measured by RT–PCR. (B) qRT–PCR analysis of circ‐0080018 and POLD2 (circ‐0080018 mRNA) treated with RNase R. (C) Actinomycin D and (D) oligo (dT)18 primers were also tested for circ‐0080018 and POLD2 expression. (E) The expression of circ‐0080018 was measured in different types of hematopoietic disorders. (F) Circ‐0080018 was assessed in 109 DLBCL plasma samples and 50 normal plasma samples. (G) The product of circ‐0080018 expression levels in six randomized DLBCL plasma samples and five normal plasma samples was further validated by agarose gel electrophoresis.

To explore the diagnostic value of circ‐0080018 as a biomarker for DLBCL, samples from different types of hematopoietic disease were collected and subjected to qRT‐PCR detection. The result showed that circ‐0080018 was expressed at significantly higher levels in DLBCL compared with other hematopoietic diseases (Figure 2E). We next further analyzed the expression of circ‐0080018 in a large cohort of DLBCL samples (total 109 patients) and 50 normal samples obtained from 2018 to 2023. Consistent with previous results, circ‐0080018 was significantly upregulated in DLBCL samples with a 2.62‐fold increase compared with the expression in control samples (Figure 2F), interestingly, only 60% of normal controls expressed circ‐0080018. Randomly selected amplification products were validated by 2% agarose gel electrophoresis (Figure 2G). Taken together, our results showed that circ‐0080018 was a circular and stable transcript that was significantly up‐regulated in DLBCL patient plasma. All of the DLBCL patient‐related data was shown in Table S2.

3.3. Circ‐0080018 Predicts Aggressive Clinical Characteristics in DLBCL Patients

Considering the high expression level of circ‐0080018 in DLBCL patients, we performed receiver‐operating characteristic (ROC) curve analysis to evaluate its potential diagnostic value for effectively distinguishing DLBCL patients from healthy controls. The area under the ROC curve (AUC) of circ‐0080018 reached 0.82 (95% confidence interval = 0.75–0.89, p < 0.0001) (Figure 3A), indicating that circ‐0080018 was a potential biomarker for the screening of DLBCL. We tried to determine the relationship between circ‐0080018 expression and clinical relevance. In current clinical practice, immunohistochemistry algorithms such as the Hans and Tally method are used to identify the COOs, with variable concordance to gene expression profiling [26, 27]. Lactic dehydrogenase (LDH) is used by cancer biologists and immunologists to assess oncogenicity and/or immunosuppression [28]. Thus, COO and LDH levels were further analyzed with the expression of circ‐0080018. Interestingly, higher expression of circ‐0080018 was found in non‐GCB than GCB DLBCL (p = 0.0003) (Figure 3B). The ROC curve analysis of circ‐0080018 was 0.71 (95% confidence interval = 0.61–0.80, p = 0.0003) (Figure 3C). Taken together, these results indicated that circ‐0080018 might serve as a biomarker to separate GCB from non‐GCB in DLBCL. However, no relevant associations were seen between LDH levels and the expression of circ‐0080018 (Figure 3D). The clinical features of the DLBCL patients are listed in Table 1.

Circ‐0080018 predicted clinical outcomes in DLBCL patients. (A) The ROC curve of circ‐0080018 was constructed for differentiating DLBCL patients and healthy individuals. (B) Relative expression of circ‐0080018 in GCB and non‐GCB samples (**p < 0.01, ***p < 0.001). (C) The ROC curve of circ‐0080018 was established for GCB and non‐GCB samples. (D) Two groups were divided to analyze the relationship between LDH levels and circ‐0080018 expression. Left: The LDH level was 120–230; Right: The LDH level was higher than 230.

TABLE 1.

The clinical features of the DLBCL patients.

	Age, median	Range	GCB	Non‐GCB	Total number	LDH 120–230	LDH > 230
Male	59.4	22–91	41	16	57	17	42
Female	55.5	18–78	25	27	52	24	26
LDH		120–230	25	16		41
LDH		> 230	42	26			68

Open in a new tab

3.4. Function of Circ‐0080018 in DLBCL Cell Lines

CircRNAs have been reported to serve as miRNA ‘sponges’ and thus prevent miRNAs from silencing their targeted genes [29]. RNA‐FISH showed that circ‐0080018 was most abundant in the cytoplasm (Figure 4A; Figure S1), and we further investigated the ability of circ‐0080018 to sponge miRNAs. We performed RIP with an antibody against argonaute 2 (AGO2) in DLBCL cell line. The results showed that circ‐0080018 was significantly enriched with AGO2 compared with IgG antibody (Figure 4B), indicating that circ‐0080018 may act as a sponge for multiple miRNAs.

circ‐0080018 acts as a sponge of miR‐625‐5p and the mechanism of action in DLBCL cell lines. (A) RNA‐FISH demonstrated the cellular localization of circ‐0080018. (B) RIP was conducted with an antibody against AGO2. (C) Binding sites of miRNAs and circ‐0080018 predicted by both circInteractome (https://circinteractome.nia.nih.gov/) and circBank (http://www.circbank.cn/). (D) Dual‐luciferase reporter assay for the luciferase activity of circ‐0080018‐WT (wild type) and circ‐0080018‐Mut (mutant) in HEK‐293T cells transfected with miRNA mimics. (E) The relative expression of circ‐0080018 after transfection with si‐NC/si‐1 in four DLBCL cell lines for 48 h (***p < 0.001, ****p < 0.0001). (F) The relative expression of miR‐625‐5p after transfection with si‐NC/si‐1 in four DLBCL cell lines for 48 h (***p < 0.001, ****p < 0.0001). (G) The cell number of four DLBCL cell lines after RNAi for 48 h. (H) The OD450 value after RNAi of circ‐0080018 in DLBCL cell lines by CCK‐8 assay.

Next, we analyzed and predicted the potential miRNAs that might bind to circ‐0080018 using circBank (http://www.circbank.cn/) and circInteractome (https://circinteractome.nia.nih.gov/). We identified miR‐625‐5p as the potential miRNA binder, and the binding site and sequence between circ‐0080018 and miR‐625‐5p are shown in Figure 4C. To further validate this result, we constructed dual‐luciferase reporter plasmids carrying fragments of mutant or wildtype circ‐0080018 sequences and used these to co‐transfect HEK‐293T cells. Compared with the negative control miR‐625‐5p mimics reduced the luciferase reporter activity by almost 60% (Figure 4D). These results demonstrated that circ‐0080018 could function as a sponge for miR‐625‐5p.

Given that circ‐0080018 is highly expressed in DLBCL peripheral blood, we decided to investigate its effects on tumor progression. We constructed two strands of circ‐0080018 that we termed circ‐0080018‐1 (Si‐1) and circ‐00800‐2 (Si‐2) and then transfected into four DLBCL cell lines. qRT‐PCR revealed that circ‐0080018‐1 (Si‐1) was significantly reduced in the DLBCL cell lines after RNAi (Figure 4E; Figure S2), and thus si‐1 was used for the experiments. miR‐625‐5p expression was increased after RNA interference (RNAi) in all four DLBCL cell lines (Figure 4F), which further demonstrated that circ‐0080018 was a sponge for miR‐625‐5p. Cell counting (Figure 4G; Figure S3) and CCK8 assay (Figure 4H) showed no significant changes in cell viability or proliferation after RNAi. These findings suggested that circ‐008018 did not directly act on tumor cells.

3.5. Circ‐0080018 Was Up‐Regulated in Co‐Culturing System and Played a Role in Macrophage Polarization

The impact of the TME on the pathogenesis and outcome of DLBCL is still unknown [30], and we asked if circ‐008018 was enriched in the TME and led to tumor progression. In this study, we set up a co‐culturing system in which the DLBCL cell lines and Mφs were co‐cultured for 48 h. The supernatant and cultured cells were collected for the subsequent experiment. qRT‐PCR results showed that all the supernatants and co‐cultured Mφs expressed high levels of circ‐0080018 compared with the negative controls (Figure 5A,B). The proliferation results showed that co‐cultured cell lines grew faster than their control cells (Figure 5C), most of the cell lines showed significant increases (p < 0.0001). To further verify the phenotype of coculturing Mφs, qRT‐PCR and flow cytometry were performed to identify M1 and M2‐related genes and surface marker expression. LPS plus IFN‐γ–induced M1 and IL‐4/IL‐13 or IL‐10 induced M2 phenotype served as positive controls. The coculturing Mφs preferentially expressed M2‐related markers such as CD206, IL‐10, and CD163, but not M1‐related markers IL‐1β, iNOS, etc. (Figure 5D). Flow cytometry showed that although some Mφs (RIVA and U2932) expressed CD80 and CD163 surface markers, the co‐culturing Mφs were much closer to IL‐10 induced M2 and not LPS plus IFN‐γ–induced M1 phenotype (Figure 5E). The secretion of TNF‐α, IL‐6, and IL‐10 was seen in the supernatant, and this was in alignment with the flow cytometry data showing a predominance of M2 phenotype (Figure 5F). The newly diagnosed DLBCL tumor sections were collected for immunohistochemistry, and all three macrophage‐related markers: CD68, CD86, and CD163 were seen in the sections (Figure 5G). However, the M2 surface markers CD163 were more prevalent than the M1 marker CD80. Taken together, these results indicated that Mφs preferred to M2 in a coculture setting and thus promote tumor growth.

The role of circ‐0080018 in the co‐culturing system. (A) and (B) Circ‐0080018 expression in macrophages (Mφ) and supernatant in the co‐culturing system (***p < 0.001, ****p < 0.0001). (C) Cell numbers of the four DLBCL cell lines in the co‐culturing system (***p < 0.001, ****p < 0.0001). (D) The expression of the macrophage‐related polarization markers M1 and M2 after co‐culture for 48 h by RT‐PCR. LPS plus IFN‐γ was used as the M1‐positive control, and IL‐4/IL‐13 and IL‐10 were used as the M2‐positive controls. (E) Flow cytometry detection of the surface markers CD80 and CD163 in co‐cultured macrophages. (F) The secretion of TNF‐a, IL‐6, and IL‐10 in the co‐culturing system. (G) Immunohistochemistry was performed on newly diagnosed DLBCL patient's tumors using specific antibodies against CD68, CD86, and CD163.

3.6. The Underlying Mechanism of Circ‐0080018 in Macrophage Polarization

Our prior data confirmed that circ‐0080018 acts as a sponge for miR‐625‐5p (Figure 4), yet the downstream targets of miR‐625‐5p have not been clarified. Given that circ‐0080018 was markedly upregulated in the co‐culture system and drove macrophage polarization (Figure 4), we further screened macrophage‐related downstream target genes of miR‐625‐5p via three online databases. All predicted bindings were filtered by the respective standardized confidence thresholds of each database, and genes irrelevant to macrophage functions were removed. Six shared macrophage‐related candidate proteins were obtained from intersected candidates across the three databases, including ELK1, CCND1, ILK, IGF‐1, TCF7L2 and Axin2. Dual‐luciferase reporter assays were performed to confirm the binding of miR‐625‐5p (Figure 6A; Figure S4), among which IGF‐1 was the most obviously decreased. Circ‐0080018 expression was decreased nearly 80% after RNAi of si‐1 and could return to 70% normal using the miR625‐5p inhibitor in Mφs (Figure 6B), and thus si‐1 was chosen for the experiments. qRT‐PCR revealed that IGF‐1 expression was the most significantly reduced (Figure 6C) after treatment with RNAi and miR‐625‐5p mimics among six potential targets of miR‐625‐5p. Therefore, IGF‐1 was the target of miR‐625‐5p in macrophages. qRT‐PCR also indicated that M2‐related genes had significant decreases, and these could be reversed by the miR‐625‐5p inhibitors, but the M1‐related genes were not affected (Figure 6D). The ELISA data displayed that IGF‐1 secretion was affected after RNAi (Figure 6E). Western blot simultaneously manifested that IGF‐1R and p‐IGF‐1R expression was consistent with RNA and ELISA levels (Figure 6F; Figure S5) after RNAi. Interestingly, the protein expression of IGF‐1R and p‐IGF‐1R was lower in the LPS plus INF‐1γ‐induced M1 phenotype compared to the IL‐4/IL‐13 and IL‐10–induced M2 phenotype (Figure 6F; Figure S5), and IGF‐1 secretion showed a similar pattern (Figure S6). Meanwhile, in the co‐culturing system, IGF expression and secretion were also higher than controls (Figures S6 and S7), To sum up, IGF1 as a miR‐625‐5p target protein could restrain IGF‐1/IGF1R pathway after RNAi of circ‐0080018 in Mφs. IGF‐1/IGF‐1R pathway activation shaped macrophage activation and promoted DLBCL tumor cells proliferation.

IGF‐1 mRNA as a target of miR‐625‐5p. (A) The dual‐luciferase reporter assay for the validation of binding sites between miR‐625‐5p and IGF‐1. (B) The expression of circ‐0080018 after transfection with si‐NC/si‐circ‐0080018‐1/si‐circ‐008001802 (Si‐1 or Si‐2)/si‐miR‐625‐5p inhibitor (inhibitor) in macrophages (***p < 0.001, ****p < 0.0001). (C) The targeted candidate genes of miR‐625‐5p expression after transfection with si‐NC/si‐circ‐0080018 or miR‐NC/miR‐625‐5p mimics in macrophages. (D) The relative expression of macrophage‐related M1 and M2 polarization genes after transfection with si‐NC/si‐circ‐008001 or inhibitor in macrophages by qRT‐PCR. (E) IGF‐1 secretion in macrophages after transfection with si‐NC/si‐circ‐0080018 or inhibitor by ELISA (***p < 0.001, ****p < 0.0001). (F) Western blot detection of IGF‐1R and p‐IGF‐1R expression in macrophages. LPS plus IFN‐γ was used as the M1‐positive control, and IL‐4/IL13 and IL‐10 were used as the M2‐positive controls.

3.7. Circ‐0080018 Is Transported to DLBCL Patient Plasma by Exosomes

Based on our finding that circ‐0080018 was highly expressed in DLBCL patient plasma, we hypothesized that circ‐0080018 is delivered by exosomes into plasma. We collected plasma samples and isolated exosomes from 30 DLBCL patients and 10 normal controls. and characterized these vesicles by electron microscopy (Figure 7A). Western blot (Figure 7B) was performed to detect the presence of the exosomal markers CD63, CD81, and TSG101, thus further confirming the purity of the isolated exosomes in plasma. The measurement of exosome particle size is shown in Figure 7C. In addition, qRT‐PCR analyses showed that circ‐0080018 was enriched in the exosomes from DLBCL patient plasma, which was consistent with our hypothesis (Figure 7D). In addition, it was also abundant in the co‐culture supernatant (Figure 7E) and was affected by RNAi and its inhibitor (Figure 7F). In summary, our findings suggest that exosomes deliver circ‐0080018 into the plasma and that affects the TME.

Exosomal circ‐0080018 detection in plasma and expression in the co‐culturing system. (A) Plasma exosomes were isolated and characterized by electron microscopy. (B) Plasma exosomes were verified by western blot. (C) Particle size analysis of plasma exosomes. (D) Hsa_circ_0080018 was assessed in 35 DLBCL plasma samples and 20 normal plasma samples; half of the normal controls showed no expression of Hsa_circ_0080018 by qRT‐PCR. (E) Exosomal circ‐0080018 was also expressed at higher levels in the co‐culture system compared to controls. (F) Exosomal circ‐0080018 expression was affected by RNAi of circ‐0080018 and its inhibitor in macrophages.

4. Discussion

DLBCL is the most common type of non‐Hodgkin's lymphoma (NHL) and comprises a heterogeneous group of diseases with different biological and clinical presentations and different responses to treatment [31]. In the past two decades, multidisciplinary efforts from pathologists, molecular biologists, and clinicians have identified unique DLBCL subtypes by either COO or molecular characteristics [31]. However, although tremendous advances have been made, the COO is still determined by immunohistochemical staining [31]. It is in urgent need of screening effective new biomarkers and exploring potential therapeutic targets associated with DLBCL initiation and progression.

In the present study, the results, for the first time, revealed that highly enriched hsa_circ‐0080018 in DLBCL patient plasma that might serve as a novel biomarker for DLBCL. the results showed that circ‐0080018 was clearly upregulated in non‐GCB patient plasma and not in GCB patients. The COO is routinely used to identify subsets of patients with high‐risk disease and poorer outcomes to up‐front standard R‐CHOP therapy [31], and thus our results might provide a new marker for the diagnosis and prognosis of DLBCL. However, in our experiment, we found that circ‐0080018 did not function as an oncogenic driver in DLBCL by promoting DLBCL progression.

The TME surrounding malignant B cells consists of immune cells [32, 33], and the composition of immune cells in the TME varies between tumors and is associated with outcomes in many cancers, including DLBCL [34, 35, 36, 37]. TAMs have been identified as an adverse prognostic factor in many solid tumors, and they correlate with poor prognosis depending on the tumor type [33, 38, 39]. However, much is still unknown concerning the impact of the TME on the pathogenesis and outcome of DLBCL. We set up a co‐culturing system and found that higher expression of circ‐0080018 was in the co‐culturing supernatant and Mφs. Meanwhile, the proliferation of coculturing DLBCL cell lines grew faster, and co‐culturing Mφs biased to M2 phenotype. We thus hypothesized that high expression of circ‐0080018 might play an important role in macrophage polarization and seek to identify the underlying mechanism behind circ‐0080018's functional role.

CircRNAs have emerged as crucial mediators that have great implications in a wide variety of human diseases and cancers [40]. Abundant papers have reported that circRNAs played an important role in macrophage, there has been few papers in DLBCL. Our work clearly demonstrated that circ‐0080018 functioned as a miRNA sponge, enhancing the IGF‐1/IGF‐1R signaling through silencing miR‐625‐5p, thus influencing macrophage polarization leading tumor proliferation. IGF‐1/IGF‐1R signaling is closely related to tumor development and progression [41, 42]. This has been proved by our results. However, this study has several limitations. First, the circRNA microarray discovery cohort was relatively small (n = 3 DLBCL patients and n = 3 healthy controls), which may have limited the identification of potential circRNA candidates. Although circ‐0080018 was subsequently validated in an independent cohort of 109 DLBCL patients, larger multicenter cohorts and independent datasets are needed to further confirm its clinical significance. Second, GAPDH was used as the reference gene for plasma circRNA normalization. Given the variability of circulating cell‐free RNA, GAPDH may not be an ideal universal reference. Future prospective studies should evaluate more robust normalization strategies, including external spike‐in controls and multiple reference genes.

In this study we found that the highly expressed circ‐0080018 was stably expressed in plasma exosomes from DLBCL patients, which has not been reported previously. Recently, the presence of circRNAs in exosomes has been reported in certain cancers [21, 43]. However, only a few papers have discussed the pathological roles of circRNAs in exosomes [9, 44]. Our findings have identified circ‐0080018 that is highly expressed in plasma via exosomes that not only alters TAM polarization, but also promotes the progression of tumor cells in DLBCL patients.

Our study is the first to show that circ‐0080018 expression is enriched in DLBCL patient plasma, and its expression is correlated with the COO in DLBCL. The over‐expressed circ‐0080018 is delivered to TME by exosomes and skews macrophage to M2 phenotype leading to tumor cell proliferation, and the underlying mechanism is accomplished through circ‐0080018 acting as a sponge for miR‐625‐5p and thus triggering the IGF‐1/IGF‐1R signaling pathway through silencing miR‐625‐5p in macrophages (Figure 8). These findings will be meaningful for the diagnosis and open a promising clinical therapeutic target of DLBCL in future.

The proposed mechanistic model in this study. Circ‐0080018 functions as a miR‐625‐5p sponge. It is highly abundant in exosomes and can be delivered into plasma. The upregulation of circ‐0080018 in DLBCL patients results in decreased miR‐625‐5p levels, thus removing the inhibition of miR‐625‐5p on IGF‐1 mRNA and triggering the IGF‐1/IGF‐1R pathway in tumor‐associated macrophages and promoting DLBCL cell proliferation.

Author Contributions

Yanfeng Liu: conceptualization, methodology, software, data curation, supervision, formal analysis, funding acquisition, writing – original draft, writing – review and editing. Yanan Gao: methodology, writing – review and editing. Chuanli Zhao: conceptualization, funding acquisition, writing – original draft, writing – review and editing, project administration, data curation.

Funding

This study was supported by the National Natural Science Foundation of China (Program No. 81600078) and the Natural Science Foundation of Shandong Province (Program No. ZR2022MH193).

Ethics Statement

All the patient peripheral blood samples used in this study were collected from newly diagnosed DLBCL patients in Shandong University Qilu Hospital. The project was approved by Qilu Hospital of Shandong University Ethics committee (No. KYLL‐2020(KS)‐334), and written consents were obtained from all the patients. The healthy blood samples were from volunteers.

Consent

All authors involved in this study agreed to this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Table S1: Primer sequences used in this study.

Table S2: DLBCL patients' information. Upper: peripheral blood circRNA, lower: peripheral blood exosomal circRNA.

Figure S1: Representative FISH images showing circRNA signals in negative control samples.

Figure S2: The relative expression of circ‐0080018 after transfection with si‐NC/si‐2 in four DLBCL cell lines for 48 h (**p < 0.01, ***p < 0.001).

Figure S3: The growth curve of the four DLBCL cell lines after RNAi for 48 h. The initial cell number was 3 × 10⁵/well.

Figure S4: Dual‐luciferase reporter assays confirming the binding of miR‐625‐5p with the other five candidate genes.

Figure S5: Quantification of relative IGF‐1R and phosphorylated IGF‐1R (p‐IGF‐1R) expression from Western blot images with ImageJ analysis (*p < 0.05).

Figure S6: IGF‐1 secretion in the co‐culturing system supernatant.

Figure S7: The relative expression of IGF‐1 in co‐cultured macrophages.

CAS-9999-0-s001.pdf^{(968.9KB, pdf)}

Acknowledgments

The authors have nothing to report.

Contributor Information

Yanfeng Liu, Email: amyliu531@outlook.com.

Chuanli Zhao, chuanlizhao@email.sdu.edu.cn.

Data Availability Statement

Microarray data are available in the Gene Expression Omnibus repository under accession number GSE268711. Other data that support the findings of this study are available in the article and its Supporting Information files or from the corresponding author upon reasonable request.

References

1. Decruyenaere P., Offner F., and Vandesompele J., “Circulating RNA Biomarkers in Diffuse Large B‐Cell Lymphoma: A Systematic Review,” Experimental Hematology & Oncology 10, no. 1 (2021): 13, 10.1186/s40164-021-00208-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Alizadeh A. A., Eisen M. B., Davis R. E., et al., “Distinct Types of Diffuse Large B‐Cell Lymphoma Identified by Gene Expression Profiling,” Nature 403, no. 6769 (2000): 503–511, 10.1038/35000501. [DOI] [PubMed] [Google Scholar]
3. Lenz G., Wright G., Dave S. S., et al., “Stromal Gene Signatures in Large‐B‐Cell Lymphomas,” New England Journal of Medicine 359, no. 22 (2008): 2313–2323, 10.1056/NEJMoa0802885. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Choi W. W., Weisenburger D. D., Greiner T. C., et al., “A New Immunostain Algorithm Classifies Diffuse Large B‐Cell Lymphoma Into Molecular Subtypes With High Accuracy,” Clinical Cancer Research 15, no. 17 (2009): 5494–5502, 10.1158/1078-0432.CCR-09-0113. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Pasqualucci L. and Dalla‐Favera R., “Genetics of Diffuse Large B‐Cell Lymphoma,” Blood 131, no. 21 (2018): 2307–2319, 10.1182/blood-2017-11-764332. [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Chen L. L., “The Biogenesis and Emerging Roles of Circular RNAs,” Nature Reviews. Molecular Cell Biology 17, no. 4 (2016): 205–211, 10.1038/nrm.2015.32. [DOI] [PubMed] [Google Scholar]
7. Chen B. and Huang S., “Circular RNA: An Emerging Non‐Coding RNA as a Regulator and Biomarker in Cancer,” Cancer Letters 418 (2018): 41–50, 10.1016/j.canlet.2018.01.011. [DOI] [PubMed] [Google Scholar]
8. Kristensen L. S., Hansen T. B., Veno M. T., and Kjems J., “Circular RNAs in Cancer: Opportunities and Challenges in the Field,” Oncogene 37, no. 5 (2018): 555–565, 10.1038/onc.2017.361. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Wu Z., Sun H., Liu W., et al., “Circ‐RPL15: A Plasma Circular RNA as Novel Oncogenic Driver to Promote Progression of Chronic Lymphocytic Leukemia,” Leukemia 34, no. 3 (2020): 919–923, 10.1038/s41375-019-0594-6. [DOI] [PubMed] [Google Scholar]
10. Lin D., Wang Y., Lei L., and Lin C., “Circ_0003645 Serves as miR‐335‐5p Sponge to Promote the Biological Process of Diffuse Large B‐Cell Lymphoma by Upregulating NFIB,” Autoimmunity 55, no. 2 (2022): 127–135, 10.1080/08916934.2021.2023863. [DOI] [PubMed] [Google Scholar]
11. Liu W., Lei L., Liu X., and Ye S., “CircRNA_OTUD7A Upregulates FOXP1 Expression to Facilitate the Progression of Diffuse Large B‐Cell Lymphoma via Acting as a Sponge of miR‐431‐5p,” Genes & Genomics 43, no. 6 (2021): 653–667, 10.1007/s13258-021-01094-z. [DOI] [PubMed] [Google Scholar]
12. Zhao C. X., Yan Z. X., Wen J. J., et al., “CircEAF2 Counteracts Epstein‐Barr Virus‐Positive Diffuse Large B‐Cell Lymphoma Progression via miR‐BART19‐3p/APC/Beta‐Catenin Axis,” Molecular Cancer 20, no. 1 (2021): 153, 10.1186/s12943-021-01458-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Zhan C., Zhou H., Zhang W., and Si C., “Hsa_circ_0000877 Facilitates the Progression of Diffuse Large B‐Cell Lymphoma by miR‐370‐3p/Mitogen‐Activated Protein Kinase Kinase Kinase Kinase 4/Hippo Pathway,” Anti‐Cancer Drugs 33, no. 10 (2022): 1091–1102, 10.1097/CAD.0000000000001366. [DOI] [PubMed] [Google Scholar]
14. Hu Y., Zhao Y., Shi C., et al., “A Circular RNA From APC Inhibits the Proliferation of Diffuse Large B‐Cell Lymphoma by Inactivating Wnt/β‐Catenin Signaling via Interacting With TET1 and miR‐888,” Aging (Albany NY) 11, no. 19 (2019): 8068–8084, 10.18632/aging.102122. [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Cioroianu A. I., Stinga P. I., Sticlaru L., et al., “Tumor Microenvironment in Diffuse Large B‐Cell Lymphoma: Role and Prognosis,” Analytical Cellular Pathology (Amsterdam) 2019 (2019): 8586354, 10.1155/2019/8586354. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Qian B. Z. and Pollard J. W., “Macrophage Diversity Enhances Tumor Progression and Metastasis,” Cell 141, no. 1 (2010): 39–51, 10.1016/j.cell.2010.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Le K., Sun J., Khawaja H., et al., “Mantle Cell Lymphoma Polarizes Tumor‐Associated Macrophages Into M2‐Like Macrophages, Which in Turn Promote Tumorigenesis,” Blood Advances 5, no. 14 (2021): 2863–2878, 10.1182/bloodadvances.2020003871. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Pan B. T., Teng K., Wu C., Adam M., and Johnstone R. M., “Electron Microscopic Evidence for Externalization of the Transferrin Receptor in Vesicular Form in Sheep Reticulocytes,” Journal of Cell Biology 101, no. 3 (1985): 942–948. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Thery C., Zitvogel L., and Amigorena S., “Exosomes: Composition, Biogenesis and Function,” Nature Reviews. Immunology 2, no. 8 (2002): 569–579, 10.1038/nri855. [DOI] [PubMed] [Google Scholar]
20. Becker A., Thakur B. K., Weiss J. M., Kim H. S., Peinado H., and Lyden D., “Extracellular Vesicles in Cancer: Cell‐To‐Cell Mediators of Metastasis,” Cancer Cell 30, no. 6 (2016): 836–848, 10.1016/j.ccell.2016.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Li Y., Zheng Q., Bao C., et al., “Circular RNA Is Enriched and Stable in Exosomes: A Promising Biomarker for Cancer Diagnosis,” Cell Research 25, no. 8 (2015): 981–984, 10.1038/cr.2015.82. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Jaffe E. S., Barr P. M., and Smith S. M., “Understanding the New WHO Classification of Lymphoid Malignancies: Why It's Important and How It Will Affect Practice,” American Society of Clinical Oncology Educational Book 37 (2017): 535–546, 10.1200/EDBK_175437. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Tian X. P., Wang C. Y., Jin X. H., et al., “Acidic Microenvironment Up‐Regulates Exosomal miR‐21 and miR‐10b in Early‐Stage Hepatocellular Carcinoma to Promote Cancer Cell Proliferation and Metastasis,” Theranostics 9, no. 7 (2019): 1965–1979, 10.7150/thno.30958. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Li L., Li C., Wang S., et al., “Exosomes Derived From Hypoxic Oral Squamous Cell Carcinoma Cells Deliver miR‐21 to Normoxic Cells to Elicit a Prometastatic Phenotype,” Cancer Research 76, no. 7 (2016): 1770–1780, 10.1158/0008-5472.CAN-15-1625. [DOI] [PubMed] [Google Scholar]
25. Wei J. X., Lv L. H., Wan Y. L., et al., “Vps4A Functions as a Tumor Suppressor by Regulating the Secretion and Uptake of Exosomal microRNAs in Human Hepatoma Cells,” Hepatology 61, no. 4 (2015): 1284–1294, 10.1002/hep.27660. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Gutierrez‐Garcia G., Cardesa‐Salzmann T., Climent F., et al., “Gene‐Expression Profiling and Not Immunophenotypic Algorithms Predicts Prognosis in Patients With Diffuse Large B‐Cell Lymphoma Treated With Immunochemotherapy,” Blood 117, no. 18 (2011): 4836–4843, 10.1182/blood-2010-12-322362. [DOI] [PubMed] [Google Scholar]
27. Ott G., Ziepert M., Klapper W., et al., “Immunoblastic Morphology but Not the Immunohistochemical GCB/nonGCB Classifier Predicts Outcome in Diffuse Large B‐Cell Lymphoma in the RICOVER‐60 Trial of the DSHNHL,” Blood 116, no. 23 (2010): 4916–4925, 10.1182/blood-2010-03-276766. [DOI] [PubMed] [Google Scholar]
28. Claps G., Faouzi S., Quidville V., et al., “The Multiple Roles of LDH in Cancer,” Nature Reviews. Clinical Oncology 19, no. 12 (2022): 749–762, 10.1038/s41571-022-00686-2. [DOI] [PubMed] [Google Scholar]
29. Hansen T. B., Jensen T. I., Clausen B. H., et al., “Natural RNA Circles Function as Efficient microRNA Sponges,” Nature 495, no. 7441 (2013): 384–388, 10.1038/nature11993. [DOI] [PubMed] [Google Scholar]
30. Autio M., Leivonen S. K., Bruck O., et al., “Immune Cell Constitution in the Tumor Microenvironment Predicts the Outcome in Diffuse Large B‐Cell Lymphoma,” Haematologica 106, no. 3 (2021): 718–729, 10.3324/haematol.2019.243626. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Susanibar‐Adaniya S. and Barta S. K., “2021 Update on Diffuse Large B Cell Lymphoma: A Review of Current Data and Potential Applications on Risk Stratification and Management,” American Journal of Hematology 96, no. 5 (2021): 617–629, 10.1002/ajh.26151. [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Scott D. W. and Gascoyne R. D., “The Tumour Microenvironment in B Cell Lymphomas,” Nature Reviews. Cancer 14, no. 8 (2014): 517–534, 10.1038/nrc3774. [DOI] [PubMed] [Google Scholar]
33. Nicholas N. S., Apollonio B., and Ramsay A. G., “Tumor Microenvironment (TME)‐Driven Immune Suppression in B Cell Malignancy,” Biochimica et Biophysica Acta 1863, no. 3 (2016): 471–482, 10.1016/j.bbamcr.2015.11.003. [DOI] [PubMed] [Google Scholar]
34. Fridman W. H., Pages F., Sautes‐Fridman C., and Galon J., “The Immune Contexture in Human Tumours: Impact on Clinical Outcome,” Nature Reviews. Cancer 12, no. 4 (2012): 298–306, 10.1038/nrc3245. [DOI] [PubMed] [Google Scholar]
35. Keane C., Gill D., Vari F., Cross D., Griffiths L., and Gandhi M., “CD4⁺ Tumor Infiltrating Lymphocytes Are Prognostic and Independent of R‐IPI in Patients With DLBCL Receiving R‐CHOP Chemo‐Immunotherapy,” American Journal of Hematology 88, no. 4 (2013): 273–276, 10.1002/ajh.23398. [DOI] [PubMed] [Google Scholar]
36. Keane C., Vari F., Hertzberg M., et al., “Ratios of T‐Cell Immune Effectors and Checkpoint Molecules as Prognostic Biomarkers in Diffuse Large B‐Cell Lymphoma: A Population‐Based Study,” Lancet. Haematology 2, no. 10 (2015): e445–e455, 10.1016/S2352-3026(15)00150-7. [DOI] [PubMed] [Google Scholar]
37. Xu‐Monette Z. Y., Xiao M., Au Q., et al., “Immune Profiling and Quantitative Analysis Decipher the Clinical Role of Immune‐Checkpoint Expression in the Tumor Immune Microenvironment of DLBCL,” Cancer Immunology Research 7, no. 4 (2019): 644–657, 10.1158/2326-6066.CIR-18-0439. [DOI] [PubMed] [Google Scholar]
38. Hans C. P., Weisenburger D. D., Greiner T. C., et al., “Confirmation of the Molecular Classification of Diffuse Large B‐Cell Lymphoma by Immunohistochemistry Using a Tissue Microarray,” Blood 103, no. 1 (2004): 275–282, 10.1182/blood-2003-05-1545. [DOI] [PubMed] [Google Scholar]
39. Newman A. M., Steen C. B., Liu C. L., et al., “Determining Cell Type Abundance and Expression From Bulk Tissues With Digital Cytometry,” Nature Biotechnology 37, no. 7 (2019): 773–782, 10.1038/s41587-019-0114-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Han B., Chao J., and Yao H., “Circular RNA and Its Mechanisms in Disease: From the Bench to the Clinic,” Pharmacology & Therapeutics 187 (2018): 31–44, 10.1016/j.pharmthera.2018.01.010. [DOI] [PubMed] [Google Scholar]
41. de‐ Freitas‐Junior J. C., Carvalho S., Dias A. M., et al., “Insulin/IGF‐I Signaling Pathways Enhances Tumor Cell Invasion Through Bisecting GlcNAc N‐Glycans Modulation. An Interplay With E‐Cadherin,” PLoS One 8, no. 11 (2013): e81579, 10.1371/journal.pone.0081579. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Denduluri S. K., Idowu O., Wang Z., et al., “Insulin‐Like Growth Factor (IGF) Signaling in Tumorigenesis and the Development of Cancer Drug Resistance,” Genes & Diseases 2, no. 1 (2015): 13–25, 10.1016/j.gendis.2014.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Gao P. F., Huang D., Wen J. Y., Liu W., and Zhang H. W., “Advances in the Role of Exosomal Non‐Coding RNA in the Development, Diagnosis, and Treatment of Gastric Cancer (Review),” Molecular and Clinical Oncology 13, no. 2 (2020): 101–108, 10.3892/mco.2020.2068. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Xu Z., Chen Y., Ma L., et al., “Role of Exosomal Non‐Coding RNAs From Tumor Cells and Tumor‐Associated Macrophages in the Tumor Microenvironment,” Molecular Therapy 30, no. 10 (2022): 3133–3154, 10.1016/j.ymthe.2022.01.046. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials