β‐sitosterol Alleviates Pulmonary Arterial Hypertension in Rats With Involvement of the VEGF/PI3K/AKT Signaling Pathway

ABSTRACT

Pulmonary arterial hypertension (PAH) is a progressive and lethal disorder with limited therapeutic options. β‐sitosterol, a plant compound, has shown potential in managing PAH, but its protective mechanisms remain unclear. We evaluated the protective effects of β‐sitosterol against monocrotaline (MCT)‐induced PAH in rats and explored the underlying mechanisms. First, network pharmacology was used to predict potential targets of β‐sitosterol in PAH. A rat model of PAH was established by a single subcutaneous injection of MCT (60 mg/kg). From day 28 after MCT injection, PAH rats were treated with β‐sitosterol (100 mg/kg/day) by gavage for 28 days. Histopathological analysis, RT‐qPCR, and Western blotting were performed to evaluate inflammatory infiltration, cellular proliferation, apoptosis, and the activity of the VEGF/PI3K/AKT pathway in lung tissues. Network pharmacology analysis identified the VEGF/PI3K/AKT pathway as centrally implicated. In vivo, β‐sitosterol treatment significantly improved hemodynamic parameters and right ventricular function, reducing pulmonary vascular remodeling. Furthermore, β‐sitosterol suppressed vascular inflammation and proliferation while promoting apoptosis. RT‐qPCR analysis revealed that β‐sitosterol significantly reduced mRNA levels of VEGF, TNF‐α, IL‐6, IL‐1β, Collagen I, and TGF‐β1 compared with the MCT group. Western blotting demonstrated that β‐sitosterol decreased the phosphorylation of VEGFR2, PI3K and AKT, upregulated Bax expression, and downregulated PCNA and Bcl‐2. In conclusion, β‐sitosterol may alleviate PAH with the involvement of the VEGF/PI3K/AKT signaling pathway. These findings suggest the therapeutic potential of β‐sitosterol against PAH and offer preliminary insights into its molecular mechanisms.

1. Introduction

Pulmonary hypertension (PH), a life‐threatening condition defined by a mean pulmonary arterial pressure exceeding 20 mmHg at rest via right heart catheterization, is characterized by progressive pulmonary vascular remodeling that culminates in right ventricular failure [1]. Its estimated global prevalence is approximately 1%, and it is associated with high rates of hospitalization, significant mortality, and a poor long‐term prognosis [2]. Within its classifications, pulmonary arterial hypertension (PAH, Group 1 PH) represents a rare but fatal form, distinguished by pre‐capillary vasculopathy. The monocrotaline (MCT)‐induced rat model is widely accepted for PAH research [3].

The pathogenesis of PAH extends far beyond simple vasoconstriction, involving genetic susceptibility, epigenetic regulation [4, 5], and disrupted metabolic‐immune crosstalk [6]. This multifaceted dysfunction promotes a chronic inflammatory microenvironment and sustained cellular proliferation [7], culminating in the irreversible pulmonary vascular remodeling that drives right ventricular failure. Within this process, inflammation acts as a central driver, where immune cell activation and pro‐inflammatory cytokine release substantially contribute to vascular damage and remodeling [8].

Current therapeutic strategies for PAH primarily target vasodilation using endothelin receptor antagonists (ERAs), phosphodiesterase‐5 inhibitors, prostacyclin analogs, and soluble guanylate cyclase stimulators [9]. Although these treatments improve hemodynamics and quality of life, they do not halt the progression of pathological pulmonary vascular remodeling [10]. The 2024 FDA approval of Sotatercept has reshaped the PAH therapeutic landscape; it represents the first disease‐modifying agent that directly targets vascular remodeling instead of merely inducing vasodilation [11]. Even so, novel therapeutics targeting the root pathogenesis of PAH remain urgently required.

Vascular remodeling persists as a defining pathological feature of PAH despite available treatments [12]. This process encompasses a spectrum of cellular activities, including the proliferation and migration of endothelial cells and smooth muscle cells, fibroblast differentiation, extracellular matrix deposition, immune cell activation, and pericyte proliferation. Complex intercellular communication, cellular functional heterogeneity, and cell‐type‐specific contributions collectively govern PAH progression [12, 13].

Given these pathological processes, elucidating the signaling pathways driving PAH is crucial. Growth factors such as vascular endothelial growth factor (VEGF) and platelet‐derived growth factor (PDGF) exacerbate the disease by stimulating cell proliferation and migration, thereby accelerating vascular remodeling [14]. The PI3K/Akt pathway, activated upstream by VEGF, is critical for endothelial cell survival and angiogenesis [15]. Specifically, VEGF stimulation promotes the phosphorylation of VEGFR2 at key tyrosine residues, which recruits adaptor proteins like GAB1 and activates PI3K. This cascade leads to Akt phosphorylation, enhancing endothelial cell survival, migration, and nitric oxide production [16, 17]. Therefore, inhibition of the VEGF/PI3K/Akt axis holds promise for slowing PAH progression.β‐Sitosterol (SITO), the most abundant phytosterol and a primary constituent in many plants, exhibits notable anti‐inflammatory, anti‐tumor, and antioxidant properties [18]. In addition to its role in mitigating fibrotic diseases, phytosterols have demonstrated potent pro‐apoptotic effects, significantly inhibiting the growth of various tumor cell lines [19]. Our previous work has shown that SITO can effectively alleviate PAH, positioning it as a potential preventive candidate [20]. However, the precise mechanisms underlying its therapeutic effects remain poorly understood.

To fill this knowledge gap, we integrated network pharmacology to predict the anti‐PAH mechanisms of β‐sitosterol, which highlighted the VEGF/PI3K/Akt signaling pathway as a key target. We further validated this prediction using the MCT‐induced rat PAH model. This work provides new evidence supporting the therapeutic potential of β‐sitosterol and offers a fresh mechanistic clue for PAH drug discovery.

2. Materials and Methods

2.1. SITO Active Ingredient Acquisition and Screening for SITO and PAH Targets

The two‐dimensional chemical structure of SITO was retrieved from PubChem (https://pubchem.ncbi.nlm.nih.gov/). We performed systematic searches for “β‐Sitosterol” using the TCMSP (Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform; (https://tcmspw.com/tcmsp.php/) [21], SwissTargetPrediction (https://www.swisstargetprediction.ch/) [22], and PharmMapper databases (https://www.lilab-ecust.cn/pharmmapper/index.html) [23]. Potential targets identified from each database were collected, deduplicated, and merged to ensure data accuracy and completeness. Targets associated with pulmonary hypertension were compiled from the OMIM (http://www.omim.org) and GeneCards (https://www.genecards.org) databases [24]. Overlapping genes between β‐sitosterol and pulmonary hypertension (PAH) were further analyzed using the STRING database (https://string-db.org/) [25].

2.2. Protein–Protein Interaction (PPI) Network Construction

The protein–protein interaction (PPI) map generated by STRING (as a TSV file) was imported into Cytoscape to visualize the PPI network of the common targets. Subsequently, the Cytohubba plugin within Cytoscape was used to rank and extract the top 10 hub targets.

2.2.1. GO and KEGG Functional Analyses

To functionally characterize the identified hub genes, we performed Gene Ontology (GO) enrichment analysis to categorize their roles in molecular functions (MF), biological processes (BP), and cellular components (CC). Concurrently, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was conducted to elucidate their broader biological contexts. Both analyses were executed using the online platform for data analysis and visualization(https://www.bioinformatics.com.cn) [26]. GO provides systematic gene function annotation, while KEGG enables interpretation of high‐level genomic pathway.

2.3. Molecular Docking Verification

Ligand mol2 files and receptor pdb files were retrieved and downloaded from the PubChem database and the Protein Data Bank (PDB) (https://www.rcsb.org/), respectively. Molecular docking simulations were performed using the CB‐Dock2 platform (http://clab.labshare.cn/cb-dock2/php/download.php) [27, 28], which employs AutoDock Vina for computational modeling. The binding affinity between the receptor and ligand was evaluated based on the binding energy levels from the docking results. A Vina score below −5 indicates good binding activity between the target and the compound, with lower values reflecting stronger docking performance.

2.4. Reagent

β‐sitosterol (Formula: C₂₉H₅₀O, CAS NO. 83–46–5) and Monocrotaline (MCT, CAS NO. 315‐22‐0) were obtained from Ambeed (Shanghai, China). Prestained protein markers were obtained from Yamei (Cat. No. WJ103), Immunoway (Cat. No. D01250), and Servicebio (Cat. No. G2085), Goat anti‐rabbit IgG was purchased from Yamei (Shanghai, China). Hifair® II 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) and Hieff® qPCR SYBR Green Master Mix (High Rox Plus) were obtained from YEASEN (Shanghai, China).

2.5. Animals

Healthy male Sprague‐Dawley rats (200 ± 20 g, 6–8 weeks old) were obtained from the Experimental Animal Center of Guangxi Medical University. The animals were housed under specific pathogen‐free (SPF) conditions with a 12 h light/dark cycle and provided ad libitum access to standard chow and water. Following a 1‐week acclimatization period, the rats were randomly assigned to four groups (n = 6 per group): a normal control group (NC), a monocrotaline group (MCT; 60 mg/kg MCT), an MCT + SITO group (MCT + SITO; 100 mg/kg/d SITO) and a SITO group (100 mg/kg/d SITO). Our previous study identified 100 mg/kg/day as the optimal therapeutic dose of SITO for alleviating monocrotaline‐induced pulmonary arterial hypertension in rats [20]. Consequently, no additional titration was performed, and the sildenafil positive‐control group was omitted in this study. SITO was dissolved in 0.5% CMC–Na (Solarbio, Beijing, China) and dispersed via ultrasonication. Beginning 28 days after the MCT injection, the rats received either saline or SITO by oral gavage daily for 28 consecutive days. Rats in the SITO group were administered SITO, whereas the control group received an equal volume of saline via intragastric administration.

2.6. Echocardiography

High‐resolution echocardiography was performed on the shaved anterior chest wall using a Resona 7 system (Mindray, China) equipped with a 5–20 MHz linear‐array transducer (L20–5U) dedicated to small‐animal imaging. After induction with 4% isoflurane and maintenance at 2%, heart rate was continuously tracked and kept above 250 beats min⁻¹. From the apical four‐chamber window, color‐Doppler mapping was used to interrogate trans‐valvular flow patterns and velocities in both ventricles. Tricuspid annular plane systolic excursion (TAPSE) was subsequently quantified by placing the M‐mode cursor through the lateral tricuspid annulus in the same view, as previously validated.

2.7. Measurements of RVSP and Right Ventricle Hypertrophy

Under isoflurane maintenance anesthesia, ventilation was initiated at 80 breaths/min. The thoracic cavity was opened, and the right ventricle was punctured with a 25 G needle. A 1.8 F catheter was inserted for right heart catheterization and connected to an MPA system. Catheter position was confirmed by pressure waveforms, and right ventricular pressure was continuously recorded. RVSP was measured, and the RV/(LV + S) ratio was calculated.

2.8. Hematoxylin–Eosin Staining

For morphological analysis, 5 µm‐thick lung tissue sections were stained with hematoxylin and eosin (H&E). Pulmonary vascular remodeling was assessed on transversely sectioned pulmonary arterioles (outer diameter 50–100 µm) that were round or oval in shape. For quantitative analysis, ten pulmonary arterioles were randomly selected from each animal for examination. Two parameters were measured using ImageJ software: 1. Wall thickness percentage (WT%), calculated as: WT% = [(external diameter − internal diameter)/external diameter] × 100%. 2. Medial area percentage (MA%), calculated as: MA% = (medial area/total vessel area) × 100%. Images were captured using an Olympus BX51 microscope (Olympus, Tokyo, Japan) and analyzed with ImageJ software.

2.9. Immunofluorescence Staining

Immunofluorescence staining was performed on paraffin‐embedded lung Section (5 µm thick) to evaluate smooth muscle cell proliferation in pulmonary arterioles. Following deparaffinization, rehydration, and antigen retrieval in sodium citrate buffer (10 mM, pH 6.0) at 95°C for 15 min, sections were blocked with 5% bovine serum albumin for 1 h at room temperature. The sections were then incubated overnight at 4°C with primary antibodies against α‐SMA (1:200, mouse, Proteintech, Cat No. 67735‐1‐Ig) and PCNA (1:200, rabbit, Proteintech, Cat No. 10205‐2‐AP). After washing with PBS, sections were incubated with Alexa Fluor 594‐conjugated goat anti‐mouse IgG (1:500, Proteintech, Cat No. SA00013‐3) and Alexa Fluor 488‐conjugated goat anti‐rabbit IgG (1:500, Proteintech, Cat No. SA00013‐2) for 1 h at room temperature in the dark. Nuclei were counterstained with DAPI (blue). Images were captured using an Olympus BX51 microscope.

2.10. Masson's Trichrome Staining

Masson's trichrome staining was applied to paraffin‐embedded sections of lung and heart tissue to evaluate collagen deposition, specifically targeting pulmonary arteries. Following deparaffinization and rehydration, sections were stained using a standard protocol that renders nuclei blue‐black, cytoplasm and muscle fibers red, and collagen fibers a distinct blue. In lung sections, collagen content was quantified within the medial and perivascular regions of pulmonary arteries with an external diameter of approximately 50–150 μm. For quantitative analysis, ten pulmonary arterioles were randomly selected from each animal for examination. For heart tissue, the analysis measured interstitial fibrosis in the myocardium. After dehydration, clearing, and mounting, all sections were imaged by light microscopy, and the area of blue‐stained collagen was quantified relative to the total tissue or region of interest using ImageJ software.

3. Real‐Time Quantitative PCR (RT‐qPCR) Analysis

Total RNA was extracted from rat lung tissues using TRIzol reagent (Invitrogen). Following quantification of RNA purity and concentration, 1 µg of RNA was reverse‐transcribed into cDNA with the Hifair® II 1st Strand cDNA Synthesis SuperMix (YEASEN). Quantitative PCR was conducted on a QuantStudio system (Applied Biosystems) using the Hieff® qPCR SYBR Green Master Mix (High Rox Plus) (YEASEN). Each 20 µL reaction mixture comprised 10 µL of Master Mix, 0.4 µL each of gene‐specific forward and reverse primers, 2 µL of cDNA, and 7.2 µL of RNase‐free water. The thermocycling conditions consisted of an initial step at 95°C for 5 min, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. Relative mRNA expression of target genes, normalized to β‐actin, was calculated via the 2^−ΔΔCq method [29]. Primers used are listed in Table 1.

Table 1.

Primer sequences.

Genes	Direction	Sequence (5′–3′)
β‐actin	Forward	5′ AGGGAAATCGTGCGTGACAT3′
	Reverse	5′ GAACCGCTCATTGCCGATAG3′
VEGFA	Forward	5′TTCGTCCAACTTCTGGGCTC3′
	Reverse	5′GCTTTCTGCTCCCCTTCTGT3′
TNF‐α	Forward	5′GGCCACCACGCTCTTCTGTC3′
	Reverse	5′GGGCTACGGGCTTGTCACTC3′
IL‐6	Forward	5′ACAAAGCCAGAGTCCTTCAGA3′
	Reverse	5′TGGTCCTTAGCCACTCCTTC3′
IL‐1β	Forward	5′TGACGGACCCCAAAAGATGA3′
	Reverse	5′AAAGACACAGGTAGCTGCCA3′
TGF‐β1	Forward	5′GACTCTCCACCTGCAAGACC3′
	Reverse	5′GGACTGGCGAGCCTTAGTTT3′
Collagen I	Forward	5′CAGGCTGGTGTGATGGGATT3′
	Reverse	5′CGGGACCTTGTTCACCTCTC3′

3.1. Western Blotting

Lung tissues were lysed using RIPA buffer containing 1% PMSF and 1% phosphatase and protease inhibitors. The protein concentration was determined using the BCA protein assay. Equal amounts of protein were separated by 10% sodium dodecyl sulfate‐polyacrylamide gel electrophoresis and transferred to PVDF membranes. The membranes were blocked with 5% skim milk in TBST for 1‐1.5 h at room temperature, then incubated with primary antibodies for p‐VEGFR2 (1:500, Lamarck, CatalogNo: AB0480), VEGFR2 (1:1000, Lamarck, CatalogNo: AR0166), p‐PI3k (1:1000, Immunoway, CatalogNo: YP0224), PI3K (1:1000, Immunoway, CatalogNo: YM8045), p‐AKT (1:1000, Immunoway, CatalogNo: CY6569), AKT (1:1000, Immunoway, CatalogNo: CY5561), PCNA (1:10000, Proteintech, Cat No. 10205‐2‐AP), Bax (1:1000, Abways, CatalogNo: CY5059), Bcl‐2 (1:1000, Proteintech, Cat No. 26593‐1‐AP), Tubulin (1:7000, Proteintech, Cat No. 10094‐1‐AP) and GAPDH (1:10000, Abways, Catalog No. AB0037) overnight at 4°C. After washing with TBST, the membranes were incubated with horseradish peroxidase‐conjugated secondary antibodies for 1‐2 h at room temperature. The chemiluminescent signals were detected using an enhanced chemiluminescence system and imaged with a Bio‐Spectrum Gel Imaging System. Protein bands were quantified and analyzed using the ImageJ software.

4. Statistical Analysis

All experimental data were presented as mean ± standard error (Mean ± SEM) and analyzed using GraphPad Prism 10.1. Statistical significance was determined using one‐way analysis of variance (ANOVA), followed by Šidák's multiple comparison test for pairwise comparisons. Normality was assessed using the Shapiro–Wilk test, and homogeneity of variance was confirmed using the Brown–Forsythe test. For hemodynamic, histopathological, and morphometric analyses, n = 6 independent biological replicates per group were used. For RT‐qPCR and Western blotting, n = 3 independent biological replicates per group were used.

5. Results

5.1. Identification of Active Ingredients of SITO and Targets Related to PAH

Network pharmacology analysis was employed to investigate the potential targets and mechanisms of SITO in mitigating PAH. The chemical structure of SITO is shown in Figure 1A. Screening the TCMSP, SwissTargetPrediction, and PharmMapper databases yielded 3, 100, and 203 potential targets for β‐sitosterol, respectively. Following the removal of duplicates, 277 unique targets were obtained. From the GeneCards and OMIM databases, 1164 and 82 targets associated with pulmonary arterial hypertension (PAH) were identified, resulting in 1185 unique PAH targets after deduplication. The intersection of these with the 277 potential β‐sitosterol targets produced 96 common targets (Figure 1B). These overlapping targets indicate potential molecular sites for the therapeutic action of SITO against PAH.

Figure 1.

Network pharmacology analysis of SITO against PAH. (A) The chemical structure of SITO. (B) Venn diagram of overlapping targets between SITO active components and PAH. (C) PPI network of SITO active components and PAH targets. (D) Top 10 genes according to the Degree value.

5.2. Creation of a PPI Network and Screening of Core Genes

The PPI network was constructed (Figure 1C), and the top ten core targets were identified as ALB, EGFR, IGF1, ESR1, PPARG, SRC, MAPK3, CASP3, HSP90AA1, and KDR (Figure 1D).

5.3. GO and KEGG Functional Analyses

Analysis of GO terms and pathways yielded several key insights into the identified targets. The enriched biological processes included the platelet‐derived growth factor receptor α, vascular endothelial growth factor receptor 1, and insulin receptor signaling pathways, which are primarily associated with cell growth and signal transduction (Figure 2A). For cellular components, the targets were predominantly localized to the cytosol, extracellular vesicles, and plasma membrane, indicating their involvement in processes at the cell membrane and in extracellular regions (Figure 2B). Molecular function analysis revealed activities such as tyrosine kinase and receptor activity, which are critical for signal transduction (Figure 2C). KEGG pathway analysis further highlighted the PI3K‐Akt, MAPK, and Ras signaling pathways (Figure 2D). These pathways are well‐established in PAH and other proliferative contexts, underscoring their potential relevance. Given that EGFR, IGF1, and KDR (VEGFR2) all participate in the PI3K‐Akt pathway, which showed the highest significance in the KEGG analysis (‐log10(p value) > 15). We hypothesize that SITO may mitigate PAH through the VEGF/PI3K/Akt signaling pathway.

Figure 2.

Functional analysis of GO and KEGG. (A‐C) GO enrichment analysis of common genes, showing significant terms in biological processes (BP, A), cellular components (CC, B), and molecular functions (MF, C). (D) KEGG pathway enrichment analysis of key genes.

5.4. Molecular Docking

To further investigate the interactions between SITO and the three core target genes, we conducted molecular docking studies. The results showed that β‐sitosterol possessed the strongest binding affinity, with energies of –9.9 kcal/mol for EGFR, –6.8 kcal/mol for IGF1, and –9.8 kcal/mol for KDR. All values exceeded the screening threshold of –5.0 kcal/mol. This indicates a robust binding interaction between β‐sitosterol and the core target proteins (Figure 3). Specifically, SITO was predicted to occupy the canonical ATP‐binding pocket within the intracellular tyrosine kinase domains of EGFR and KDR, respectively, where it formed extensive hydrophobic interactions and hydrogen bonds with conserved catalytic residues. In contrast, SITO bound to the surface receptor‐binding interface of the IGF1 ligand, mainly via hydrophobic contacts and polar interactions.

Figure 3.

Molecular docking study of SITO binding to the three core target genes. (A). Binding conformation of SITO with EGFR protein (binding energy = −9.9 kcal/mol). (B). Binding conformation of SITO with IGF1 protein (binding energy = −6.8 kcal/mol) (C). Binding conformation of SITO with KDR protein (binding energy = −9.8 kcal/mol).

5.5. SITO Alleviates MCT‐Induced PAH Hemodynamic Abnormalities in Rats

To evaluate the effect of SITO on PAH, we established a rodent model of PAH induced by MCT. As shown in Figure 4, MCT successfully induced PAH, significantly increasing RVSP and reducing TAPSE relative to the negative control (NC) group. Treatment with SITO, however, significantly attenuated these effects, lowering RVSP and elevating TAPSE. Healthy rats administered SITO alone exhibited no significant differences in RVSP or TAPSE compared to the NC group, indicating no adverse effect of SITO on cardiac hemodynamics. These results demonstrate that SITO alleviates MCT‐induced PAH without impairing cardiac function.

Figure 4.

SITO alleviates MCT‐induced PAH hemodynamic abnormalities in rats. (A) Representative RVSP images. (B) M‐mode for quantification of tricuspid annular plane systolic excursion (TAPSE). (C) Bar charts showing mean RVSP measurements. (n = 6). (D) Bar charts showing TAPSE measurements (n = 6). All data were presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001.

5.6. SITO on MCT‐Induced Pulmonary Artery Remodeling

Pulmonary vascular remodeling is a critical factor in the development of PAH. We assessed this remodeling using hematoxylin and eosin (H&E), Masson trichrome staining, and immunofluorescence for α‐SMA and PCNA. H&E staining and quantitative morphometric analysis showed that medial wall thickness (as a percentage of vessel diameter) and media area percentage (medial area/total vessel area × 100%) were significantly increased in the MCT group compared with the NC group, and SITO treatment significantly reduced both parameters (Figure 5A, D, E). PCNA/α‐SMA immunofluorescence revealed extensive cell proliferation throughout the vascular wall and perivascular region in MCT‐treated rats, as evidenced by widespread PCNA staining (Figure 5B). SITO treatment markedly reduced overall PCNA fluorescence intensity. Co‐localization with α‐SMA confirmed that smooth muscle cells constituted a major proliferating component, although the diffuse pattern of PCNA staining suggested involvement of additional cell populations. Masson trichrome staining and its quantitative analysis revealed pronounced perivascular fibrosis in the MCT group, which was significantly attenuated by SITO treatment (Figure 5C, F). The healthy rats administered SITO alone showed no significant differences from the control group in arterial wall thickness, media area, or fibrosis, demonstrating that SITO does not adversely affect pulmonary artery structure under normal conditions. At the molecular level, quantitative RT‐PCR analysis revealed that fibrosis‐related genes TGF‐β1 and Collagen I were significantly upregulated in lung tissue from MCT‐treated rats compared with NC rats (Figure 5G, H). SITO treatment significantly attenuated the expression of both TGF‐β1 and Collagen I, with the SITO alone group showing no difference from NC controls. These findings collectively suggest that SITO ameliorates MCT‐induced vascular remodeling without harming pulmonary structure in healthy animals.

Figure 5.

SITO on MCT‐induced pulmonary artery remodeling. (A) Representative H&E images of the cross‐section of small pulmonary artery (PA), Scale bar, 20 μm. (B) Immunofluorescence staining of pulmonary arterioles: red, α‐SMA; green, PCNA; blue, DAPI (scale bar: 20 μm). (C) Pulmonary arteries fibrosis with Masson's trichrome staining, Scale bar, 20 μm. (D) Summarized data showing pulmonary arterial wall thickness. (E) Quantitative analysis of % media area (medial area/total vessel area × 100%,). (F) Summarized data showing averaged PA fibrosis ratio (the area of blue to the area of red). (G) Relative mRNA expression of TGF‐β1 in lung tissue. (H) Relative mRNA expression of Collagen I in lung tissue. All data were presented as the mean ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 and ****p < 0.0001.

5.7. Effects of SITO on Right Ventricular Hypertrophy

To evaluate right ventricular (RV) hypertrophy and fibrosis in the MCT‐induced PAH model, we performed H&E and Masson's trichrome staining. SITO administration significantly reduced the hypertrophic remodeling of the RV myocardium in PAH rats, decreasing the MCT‐induced elevation in myofiber cross‐sectional area (Figure 6A, D). MCT injection also caused substantial RV enlargement, indicated by an increased RV/(LV + S) ratio, which was significantly attenuated by SITO treatment (Figure 6C). Furthermore, Masson's trichrome staining showed pronounced fibrosis in the RV of the MCT group, a change that was markedly attenuated by SITO (Figure 6B, E). At the molecular level, TGF‐β1 and Collagen I mRNA expression were significantly upregulated in right ventricular tissue from MCT‐treated rats (Figure 6F, G). SITO treatment significantly reduced the expression of both TGF‐β1 and Collagen I in MCT + SITO rats. Healthy rats treated with SITO alone showed no significant differences in RV structure or fibrosis compared to controls, confirming the absence of adverse structural effects. Together, these findings indicate that SITO alleviates MCT‐induced RV hypertrophy and fibrosis without affecting cardiac structure in healthy animals.

Figure 6.

Effects of SITO on right ventricular hypertrophy. (A) Representative H&E images of the RV cross‐sectional, Scale bar, 50μm. (B) Representative views of Masson's trichrome staining to detect RV fibrosis, Scale bar, 50μm. (C) the ratio of right ventricular (RV) to left ventricular (LV) wall plus septum (S) (RV/[LV + S]) (n = 6). (D) Summarized data showing the averaged area of RV cross‐­sectional cells (n = 6). (E) Summarized data showing the averaged RV interstitial fibrosis ratio (the area of blue to the area of red) (n = 6). (F) Relative TGF‐β1 mRNA expression in right ventricular tissue (n = 3). (G) Relative Collagen I mRNA expression in right ventricular tissue (n = 3). All data were presented as the mean ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 and ****p < 0.0001.

5.8. Effect of SITO on Pulmonary Inflammation

To assess the effect of SITO on pulmonary inflammation in the MCT‐induced PAH model, we measured inflammatory markers in lung tissue. Inflammation is a key driver of PAH progression, promoting vascular remodeling and fibrosis. We quantified the expression of key pro‐inflammatory cytokines by qPCR. As shown in Figure 7(A, B, C), MCT treatment markedly upregulated the expression of these cytokines relative to the NC group. SITO treatment, however, significantly reduced the levels of TNF‐α, IL‐6, and IL‐1β, demonstrating its anti‐inflammatory activity. Healthy rats administered SITO alone showed no significant difference in cytokine expression compared to the NC group. These results suggest that SITO does not provoke inflammatory changes in healthy lung tissue, which supports its safety profile.

Figure 7.

Effect of SITO on pulmonary inflammation. (A) mRNA expression levels of TNF‐α.(B) mRNA expression levels of IL‐6. (C) mRNA expression levels of IL‐1β. (D) mRNA expression levels of VEGF. (n = 3). All data were presented as the mean ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 and ****p < 0.0001.

5.9. Effects of SITO on Pulmonary Cell Proliferation and Apoptosis

As illustrated in Figure 8A and Figure 8B, rats with MCT‐induced PAH exhibited significantly elevated levels of Bcl‐2 and PCNA, while BAX expression was reduced compared to the control group. Conversely, treatment with SITO resulted in a marked increase in BAX expression and a decrease in both Bcl‐2 and PCNA levels when compared to the MCT group. Additionally, SITO did not have a significant impact on the proliferation and apoptosis of lung tissue in normal rats. These findings indicate that SITO may play a role in modulating the balance between cell proliferation and apoptosis in the MCT‐induced PAH model, potentially contributing to its therapeutic effects.

Figure 8.

Effect of SITO on the VEGF/PI3K/AKT signaling pathway and apoptosis/proliferation‐related protein expression in rats. (A–B) Protein levels of PCNA, Bcl‐2, and BAX were verified by Western blot. (C–D) Protein levels of VEGFR2, p‐VEGFR2, PI3K, p‐PI3K, AKT, and p‐AKT were verified by Western blot. Data are presented as the mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001.

5.10. Effect of SITO on VEGF/PI3K/AKT Signaling Pathway

To further validate the findings from our network pharmacology analysis, we performed quantitative PCR for VEGF and Western blotting to assess the protein expression levels and phosphorylation status of VEGFR2 (the primary receptor for VEGF), p‐VEGFR2, PI3K, p‐PI3K, AKT and p‐AKT. As illustrated in Figure 7D, Figure 8C and Figure 8D, the lung tissues of MCT‐induced PAH rats exhibited significantly elevated levels of VEGF, p‐VEGFR2/VEGFR2, p‐PI3K/PI3K, and p‐AKT/AKT compared to the control group. SITO treatment resulted in a substantial reduction in the expression of these proteins in the PAH rat lungs. Importantly, SITO administration did not affect these indicators in normal rats. Therefore, we conclude that SITO alleviates PAH with involvement of the VEGF/PI3K/AKT signaling pathway.

6. Discussion

Current pharmacological strategies for PAH are unable to reverse established pulmonary vascular remodeling, leaving patients at high risk of right heart failure [30]. Therefore, novel therapies that directly target the underlying pathophysiology of PAH are urgently needed. As a multitarget phytosterol, SITO exhibits anti‐inflammatory, antioxidant, and antiproliferative properties [31]. In the present study, we employed network pharmacology to identify candidate pathways through which SITO may exert its protective effects, with the VEGF/PI3K/AKT axis emerging as a top‐ranked candidate. Distinct from our previous preventive study in which SITO administration was started on the day of MCT injection [20], the current work adopted a therapeutic intervention protocol, with SITO treatment initiated on day 28 post‑MCT injection after PAH vascular lesions had already formed. This delayed intervention design better recapitulates the real‑world clinical scenario, in which patients typically receive treatment after definitive PAH diagnosis. SITO treatment improved hemodynamic indexes, attenuated pulmonary vascular remodeling and right ventricular hypertrophy, suppressed perivascular inflammation, and restored the balance between cellular proliferation and apoptosis, accompanied by reduced pulmonary fibrosis. SITO produced no significant adverse effects on cardiopulmonary function or tissue architecture in healthy control rats. Mechanistically, qPCR and Western blot analyses revealed that SITO treatment was associated with reduced VEGF expression, and decreased VEGFR2/PI3K/AKT phosphorylation, suggesting that modulation of VEGF/PI3K/AKT signaling may contribute to its protective effect.

Network pharmacology enables systematic prediction of the molecular interactions between natural compounds and disease‐associated targets, providing a preliminary mechanistic basis for pharmacological research [32, 33]. In this study, 96 overlapping target genes of SITO and PAH were screened, and a protein–protein interaction network was constructed. GO enrichment analysis identified significant enrichment of VEGF‐associated biological processes, while KEGG pathway analysis revealed the PI3K/AKT pathway as the most significantly enriched signaling cascade (‐log10(p value) > 15). Hub gene analysis further highlighted KDR (VEGFR2), EGFR, and IGF1 as core regulatory nodes. Molecular docking analysis predicted stable binding of SITO to EGFR (−9.9 kcal/mol), KDR (−9.8 kcal/mol), and IGF1 (−6.8 kcal/mol), with all binding energies lower than −5.0 kcal/mol, indicating reliable molecular interactions between SITO and these key targets.

The VEGF signaling pathway plays a critical role in tumor angiogenesis and ischemic diseases [34], and VEGF‐related pathways showed significant enrichment in our GO analysis. As the principal receptor of VEGF, KDR mediates pro‐angiogenic signaling, while EGFR and IGF1 exert synergistic paracrine effects that promote vascular injury. The PI3K/AKT pathway, highly ranked in our KEGG analysis, acts as a core downstream cascade of EGFR, IGF1, and KDR. This pathway governs cell proliferation, survival, and metabolism and is widely recognized as a pivotal therapeutic target for multiple proliferative diseases [35]. IGF1 promotes pulmonary vascular smooth muscle cell proliferation and inhibits apoptosis in PAH; upon binding to IGF1R, IGF1 triggers PI3K/AKT cascade activation and further facilitates abnormal vascular cell proliferation and survival [36]. Moreover, VEGF‑mediated VEGFR2 phosphorylation initiates downstream PI3K/AKT signaling, which is essential for pathological angiogenesis [37]. Combined with our enrichment results, network topology analysis, well documented role in PAH pathogenesis and molecular docking evidence, the VEGF/PI3K/AKT pathway was selected for subsequent experimental validation. We acknowledge that other predicted pathways, such as MAPK/ERK and Ras signaling, may also participate in SITO's protective effects, and their potential roles warrant further exploration in future studies.

Consistent with the network pharmacology predictions, our in vivo experimental results verified that SITO downregulated VEGF expression and inhibited the phosphorylation of VEGFR2, PI3K, and AKT in MCT‐induced lung tissues. In addition, the decreased mRNA levels of TNF‐α, IL‐6, and IL‐1β following SITO treatment suggest that SITO may interrupt the positive feedback loop between VEGF signaling and inflammatory responses, thereby alleviating persistent pulmonary vascular injury. Collectively, we suggest that SITO may attenuate MCT‑induced PAH with the involvement of the VEGF/PI3K/AKT signaling pathway.

Molecular docking further revealed the potential structural mechanism by which SITO interacts with core targets. SITO was predicted to bind to the intracellular ATP‑binding pocket of the EGFR tyrosine kinase domain (−9.9 kcal/mol). This conserved catalytic pocket (F723, L747, D855, G857) is indispensable for EGFR autophosphorylation and downstream signaling activation and serves as the classic target of clinical EGFR inhibitors [38, 39]. Similarly, SITO targets the ATP‑binding domain of KDR (−9.8 kcal/mol), a region essential for VEGFR2 phosphorylation and angiogenic signal transduction [40, 41]. Binding of SITO at this site may restrain KDR activation and suppress downstream pro‐remodeling signaling. For IGF1, SITO binds to the core receptor‑recognition interface(such as D12, D53, L5, I4 and F16) of the IGF1 ligand, which is critical for IGF1–IGF1R complex formation [42]. Binding of SITO at this region may sterically hinder ligand–receptor interaction and restrain IGF1‐mediated pro‐proliferative signaling. Our Western blot results functionally confirmed that SITO inhibits KDR and AKT activation, consistent with the in‐silico predictions. Nevertheless, the inhibitory effects of SITO on EGFR and IGF1 signaling are currently based solely on molecular docking, and further experimental validation is required in subsequent investigations. Notably, the biological functions of VEGF in PAH are context‐dependent and dualistic, giving rise to the well‐recognized “VEGF paradox” in pulmonary hypertension research [43]. Physiologically, VEGF maintains endothelial integrity and survival, and insufficient VEGF signaling contributes to endothelial dysfunction and plexiform lesion formation [44]; however, excessive VEGF overexpression drives aberrant angiogenesis, vascular hyperpermeability, and smooth muscle proliferation, ultimately exacerbating vascular remodeling [45]. These seemingly contradictory findings likely reflect differences in disease models, timing of intervention, cell‐type‐specific responses, and the complex interplay between VEGF and other signaling pathways. In our MCT‐induced chronic PAH model with delayed therapeutic intervention, pronounced vascular remodeling and perivascular inflammation have already formed before SITO administration. At this stage, VEGF primarily acts as a pathological driver rather than an endothelial protector. SITO‐mediated VEGF downregulation, together with suppressed inflammation and restored proliferation‐apoptosis balance, indicates that targeting excessive VEGF signaling is therapeutically effective in the chronic inflammatory phase of PAH. Further studies employing cell‐type‐specific genetic manipulation are warranted to dissect the cellular specificity of VEGF signaling in SITO‐mediated protection.

The mechanism by which SITO attenuates VEGF mRNA upregulation remains to be fully elucidated. SITO may suppress the transcriptional activity of VEGF upstream regulators, such as HIF‑1α and STAT3 [46]. At the post‐transcriptional level, SITO may accelerate VEGF mRNA degradation via post‐transcriptional networks. MicroRNAs and RNA‐binding proteins such as HuR control VEGF mRNA stability and are dysregulated in PAH [47, 48]. Finally, SITO may affect alternative splicing through SR proteins and hnRNPs, shifting the balance away from pro‐angiogenic isoforms such as VEGF165a and toward anti‐angiogenic isoforms such as VEGF165b [49]. Future studies employing chromatin immunoprecipitation (ChIP), miRNA profiling, or mRNA stability assays will be necessary to elucidate the mechanism.

PCNA staining was widespread beyond the α‐SMA‐positive medial layer, suggesting that MCT‐induced vascular proliferation is not restricted to smooth muscle cells, but also involves endothelial cells, fibroblasts, and infiltrating inflammatory cells. SITO treatment markedly reduced PCNA signal across all these regions, pointing to a broad antiproliferative effect on multiple cell types within the pulmonary vasculature. In line with this, we also observed reduced expression of the pro‐inflammatory cytokines TNF‐α and IL‐6, both of which are known to drive vascular cell proliferation and migration. Future studies employing cell‐specific markers (e.g., CD31 for endothelial cells, CD68 for macrophages) will help precisely identify the dominant cell types targeted by SITO. Our results also showed that MCT‐induced PAH was associated with elevated PCNA and Bcl‐2 expression alongside reduced Bax expression in lung homogenates, which SITO treatment effectively reversed. SITO did not alter these proliferation, apoptosis, or inflammatory markers in healthy rats. Therefore, SITO appears to prevent PAH progression by correcting the imbalance between proliferation and apoptosis in the disease model.

The 2024 FDA approval of Sotatercept marks a major breakthrough in PAH management, representing the first approved therapy that targets pulmonary vascular remodeling rather than purely vasodilation [50]. Sotatercept functions as a selective ligand trap for TGF‐β superfamily ligands, rebalancing pro‐proliferative and anti‐proliferative Smad signaling to drive reverse remodeling [51], and its efficacy has been robustly validated in large‐scale clinical trials [52, 53, 54]. In comparison, SITO is a naturally derived phytosterol, with a very different mechanism of action. Whereas Sotatercept acts specifically on the TGF‐β pathway, SITO appears to exert broader effects across multiple pathways implicated in PAH, including VEGF/PI3K/AKT signaling and inflammatory networks. Given the heterogeneous and multifactorial nature of PAH, multitarget agents like SITO may offer a complementary therapeutic option, potentially useful as add‐on treatment or in patient subsets that respond poorly to single‐target agents.

Our study has several limitations. First, the current mechanistic evidence is correlative rather than causal; pathway rescue experiments are required to establish a causal link between SITO and the VEGF/PI3K/AKT axis. Second, all conclusions are derived from a single MCT‑induced PAH model, which limits the generalizability of the findings. Alternative models such as hypoxia‐induced or Sugen/hypoxia models would help establish broader applicability. Third, the absence of a positive control group (e.g., sildenafil) and the use of a single dose (100 mg/kg) without dose‐response exploration limit the translational interpretation of our findings. Fourth, although SITO showed favorable biosafety, the lung tissue drug concentration and pharmacokinetic characteristics were not assessed. Finally, all experiments were performed in an in vivo animal model, which cannot fully recapitulate the complexity of human PAH pathophysiology, and cellular‐level mechanistic validation remains to be conducted. Despite these limitations, our findings provide encouraging preclinical evidence supporting SITO as a promising candidate for further evaluation in pulmonary hypertension management.

7. Conclusion

In summary, the present findings suggest that SITO may alleviate MCT‑induced PAH with the involvement of the VEGF/PI3K/AKT signaling pathway. SITO may represent a promising candidate for the treatment of PAH. However, the causal mechanism of the VEGF/PI3K/AKT pathway in mediating SITO protection, as well as the translational potential of these preclinical findings, requires further rigorous validation in mechanistic experiments and clinical investigations.

Author Contributions

Zhiyu Zeng conceived and designed the study. Xiaobing Wu and Chen Gong participated in the experimental design. Xiaobing Wu and Chen Gong performed the experiments. Xiaobing Wu analyzed the data. Xiaobing Wu and Chen Gong wrote the manuscript, and all authors reviewed, and have read and approved the final manuscript.

Ethics Statement

All animal procedures were approved by the Animal Ethics Committee of Guangxi Medical University (Approval No. 202504043) and conducted in strict accordance with the institutional guidelines for the care and use of laboratory animals. All methods were reported in accordance with the ARRIVE guidelines (https://arriveguidelines.org).

Conflicts of Interest

The authors declare no conflicts of interest.

Wu X, Gong C, Zeng Z, “β‐sitosterol Alleviates Pulmonary Arterial Hypertension in Rats With Involvement of the VEGF/PI3K/AKT Signaling Pathway,” Pulmonary Circulation 16 (2026): e70428. 10.1002/pul2.70428.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.