Molecular Characterization of Listeria monocytogenes Associated with Adverse Pregnancy Outcomes in Iraq with Whole-Genome Analysis of a Representative Isolate

Abstract

Background

Pregnancy-associated listeriosis can cause severe fetal and obstetric complications, yet molecular epidemiological data from Iraq remain limited. This study integrated clinical and epidemiological data with PCR-based virulence profiling of Listeria monocytogenes isolates and whole-genome sequencing (WGS) of one representative clinical isolate.

Methods

In this prospective cross-sectional study, 150 pregnant women presenting with spontaneous abortion, stillbirth/intrauterine fetal death, or preterm labor were enrolled. L. monocytogenes isolates were characterized by culture, biochemical testing, 16S rRNA PCR, and PCR screening of hlyA, actA, inlA, and inlB. One representative isolate (A125-2) was subjected to WGS on the BGISEQ-500 platform for sequence typing, virulence and antimicrobial-resistance gene profiling, and phylogenomic placement.

Results

L. monocytogenes was isolated from 18/150 participants (12.0%; 95% CI, 7.3–18.1%), with the highest positivity among spontaneous abortion cases (14.3%). PCR detected hlyA, actA, and inlA in all 18 isolates and inlB in 12/18 (66.7%). The sequenced representative isolate A125-2 was assigned to Sequence Type 1 (ST1) and Clonal Complex 1 (CC1) and carried LIPI-1, LIPI-3, multiple internalin genes, stress-response determinants, and several antimicrobial-resistance-associated genes. WGS also detected inlB in A125-2 despite the PCR discrepancy. Descriptively, 28.7% of participants reported unpasteurized dairy exposure, and 61.1% of L. monocytogenes-positive cases occurred during winter.

Conclusion

The clinical and PCR findings support an association between L. monocytogenes and adverse pregnancy outcomes in this Iraqi cohort. Genomic characterization of one representative isolate demonstrated an ST1/CC1 background with multiple virulence and stress-adaptation determinants and illustrated the added resolution of WGS for investigating PCR discrepancies. Because only one isolate underwent WGS, the genomic findings should be interpreted as isolate-specific and not as population-level evidence for Iraqi L. monocytogenes strains. Broader multi-isolate genomic surveillance is warranted.

Introduction

Listeria monocytogenes, a facultative intracellular pathogen, represents a critical but under-recognized threat to maternal–fetal health globally, with pregnancy conferring a 10- to 100-fold increased susceptibility to listeriosis compared to the general population.¹ This Gram-positive bacterium demonstrates remarkable environmental resilience, showing growth and development at temperatures as low as −0.4°C up to 45°C, and surviving pH ranges of 4.6–9.5. These characteristics facilitate its persistence in food production environments and its subsequent transmission through contaminated products.² Although maternal listeriosis is often characterized by mild, non-specific, or even asymptomatic manifestations, the pathogen’s unique ability to cross both the blood-brain and placental barriers results in devastating consequences, including spontaneous abortion, stillbirth, and preterm labor.³

The molecular pathogenesis of L. monocytogenes involves sophisticated virulence mechanisms that enable cellular invasion, intracellular survival, and dissemination to the fetus. Key virulence determinants include listeriolysin O (encoded by hlyA), which facilitates phagosomal escape; ActA protein, enabling actin-based motility; and internalins A and B (inlA, inlB), mediating epithelial and placental invasion, respectively.⁴ These virulence factors demonstrate variable expression patterns across different lineages, potentially influencing clinical manifestations and pregnancy outcomes.⁵ Recent genomic studies have demonstrated that certain lineages, particularly Lineage I, are disproportionately associated with invasive infections. Within this lineage, specific genotypes, such as Sequence Type 1 (ST1) and Clonal Complex 1 (CC1), harbor an extensive repertoire of virulence and stress tolerance genes, conferring enhanced invasiveness in human hosts.⁶

The global burden of pregnancy-associated listeriosis varies geographically, while comprehensive epidemiological and genomic data from Iraq remain scarce.⁷ Iraqi studies have documented Listeria in food products and in clinical or mixed-source collections, but systematic surveillance linking pregnancy-associated disease with molecular typing is limited. This gap is relevant because exposure to unpasteurized dairy products and other high-risk foods may be influenced by local production, storage, and food-handling practices. These considerations provide a regional rationale for evaluating food-related exposures alongside clinical outcomes in pregnant women.

Whole-genome sequencing (WGS) enables high-resolution characterization of bacterial genomes, including virulence determinants, stress-adaptation loci, antimicrobial-resistance-associated genes, and phylogenetic relationships.⁸ In multilocus sequence typing, a Sequence Type (ST) is defined by the allelic profile of a standardized set of housekeeping genes, whereas a Clonal Complex (CC) groups closely related STs that share recent ancestry.⁹ Listeria Pathogenicity Island-3 (LIPI-3), which encodes Listeriolysin S, is enriched in some Lineage I hypervirulent clones and is therefore relevant when interpreting the virulence repertoire of a sequenced isolate.¹⁰

Accordingly, this study aimed to determine the prevalence and clinical associations of L. monocytogenes among women with adverse pregnancy outcomes, characterize virulence-gene distribution across the recovered isolates by PCR, and perform detailed genomic characterization of one representative clinical isolate. We hypothesized that L. monocytogenes positivity would be associated with selected clinical or food-exposure factors and that WGS of the representative isolate would provide additional resolution for lineage assignment and virulence profiling. The genomic component was exploratory and was not designed as a population-level genomic survey.

Material and Method

Study Design, Population, and Ethical Approval

This prospective cross-sectional molecular epidemiological study was conducted between December 2024 and April 2025 in many teaching hospitals in Iraq. This study enrolled 150 pregnant women with adverse outcomes.

Sample Size and Data Collection

A sample size of 150 participants was determined based on previous regional studies to ensure statistical relevance. Clinical and demographic data were meticulously extracted from official medical records and hospital registries to correlate microbiological findings with patient histories.

Inclusion and Exclusion Criteria

Inclusion Criteria

Pregnant women (gestational age ≥20 weeks) presenting with spontaneous abortion, stillbirth, or preterm labor, who provided informed consent.

Exclusion Criteria

To ensure that the adverse outcomes were primarily associated with L. monocytogenes, women who had received antibiotic therapy within two weeks prior to specimen collection were excluded. Additionally, cases with established non-microbial causes of pregnancy loss, such as major fetal congenital anomalies or diagnosed maternal hormonal imbalance, were excluded from the study.

The selection of 150 participants was statistically justified based on comparable studies conducted in resource-limited settings, ensuring sufficient power to detect the prevalence of L. monocytogenes within the study period. Furthermore, to maintain high data integrity, all demographic and clinical information, including obstetric history and pregnancy outcomes, was meticulously retrieved from the official medical records and registries of teaching hospitals.

Specimen Collection and Microbiological Processing

Placental tissues and deep cervical swabs were processed using a cold enrichment protocol. Specimens were incubated in Tryptic Soy Broth with 0.6% Yeast Extract (TSBYE) at 4°C for 7 d, followed by selective enrichment in half-Fraser broth (Oxoid, UK) at 30°C for 48 h. Subculturing was performed on PALCAM agar (Merck, Germany) and Columbia Blood Agar. Presumptive L. monocytogenes isolates were confirmed by Gram staining, catalase, oxidase, tumbling motility at 25°C, and the CAMP test.

DNA Extraction and PCR-Based Detection

For the total sample set (n=150), genomic DNA was extracted using the GeneJET Genomic DNA Purification Kit (Thermo Scientific, Lithuania) with lysozyme pretreatment (20 mg/mL). For selected isolates intended for advanced sequencing, the SaMag-12™ automated system (Cepheid, Italy) was utilized the SaMag-12. DNA quality was verified using NanoDrop 2000 and Quantus Fluorometer (Promega, USA). PCR was used to detect 16S rRNA and key virulence genes (hlyA, actA, inlA, and inlB) using GoTaq G2 Green Master Mix (Promega, USA). The primer sequencing, expected amplicon size, annealing temperatures and corresponding references are summarized in Table 1.

Table 1.

PCR Primers and Conditions Used for the Detection of L. monocytogenes and Its Virulence Factors

Target Gene	Primer Sequence (5”−3”)	Product Size (bp)	Annealing Temperature (°C)	Reference
16S rRNA	F:AGAGTTTGATCMTGGCTCAG<br> R: TACGGYTACCTTGTTACGACTT	760	52	11
hlyA	F:GCAGTTGCAAGCGCTTGGAGTGAA<br> R: GCAACGTATCCTCCAGAGTGATCG	456	55	12
actA	F: CGCCGCGGAAATTAAAAAAAGA<br> R: ACGAAGGAACCGGGCTGCTAG	839	55	13
inlA	F: CCGCACTCACTAACTTAGAG<br> R: GTTGTTTCTTTGCCGTCCAC	580	56	12
inlB	F: CCTAAACCTCCGACCAAACA<br> R: CCATTTCGCGCTTCTCTATC	293	57	12

Read Quality Control and Genome Assembly

Raw-read quality was assessed using FastQC v0.12.1, including evaluation of per-base sequence quality, GC-content distribution, sequence-length distribution, duplication levels, and adapter contamination. Raw DNBSEQ reads were filtered using SOAPnuke v1.5.6 with the recorded parameters -l 20 -q 40% -n 1% -d%. According to the original sequencing report, filtering removed reads containing a high proportion of low-quality bases (quality ≤20; 40% threshold), reads exceeding the specified N-content threshold (1%), adapter contamination, and duplication contamination. The sequencing data consisted of paired-end 150-bp reads generated from an approximately 350-bp insert library. The cleaned reads were initially assembled de novo using SPAdes v3.9.0 following a 15-mer pre-assembly analysis. For isolate A125-2, the resulting assembly comprised 28 contigs totaling approximately 2.96 Mb, with an N50 of 556,666 bp and a GC content of 37.88%. A subsequent Galaxy-based analysis generated a final assembly using Unicycler.

Bioinformatics and in silico Characterization

The assembled genome of A125-2 was characterized using Prokka for prokaryotic feature prediction and DNAPlotter for circular genome visualization.

Taxonomic Typing

Ribosomal multilocus sequence typing (rMLST) and traditional MLST (seven housekeeping genes) were conducted using the PubMLST and Institut Pasteur databases.^11,14

Virulome and Antimicrobial Resistance (AMR) Profiling

Virulence-associated genes were screened against the Virulence Factor Database (VFDB) using ABRicate (v1.0.1). Antimicrobial resistance (AMR) genes were identified using the Comprehensive Antibiotic Resistance Database (CARD).¹⁵

Stress and Mobile Elements

Stress survival islets (SSI) and mobile genetic elements (plasmids and transposons) were identified using MobileElementFinder and MobileOG-db.^16,17

CRISPR-Phage Analysis

(CRISPRCas)Finder was used to identify Cas gene clusters. Spacer sequences were searched against the NCBI database and Listeria phage vB_Lmo_2389_typeII (PP453647.1) using BLASTn.^15,18

Variant Analysis

Reference-based variant analysis was performed using the Listeria monocytogenes EGD-e chromosome reference represented in the archived variant-analysis record by the complete versioned RefSeq accession NC_003210.1 (GenBank AL591824.1; assembly accession GCA_000196035.1; BioProject PRJNA276). Variant-effect annotation was performed using SnpEff v5.2 (build 2023-09-29).

Phylogenetic Analysis

Two levels of phylogenetic reconstruction were performed:

16S rRNA-Based Analysis

Bidirectional sequencing was performed by Macrogen (South Korea), and maximum-likelihood phylogenetic reconstruction was performed in MEGA X with 1000 bootstrap replicates.

Core-Genome SNP-Based Analysis

Comparator Listeria monocytogenes genomes representing international isolates were retrieved from the National Center for Biotechnology Information (NCBI) using the accession numbers shown in Figure 1. The comparator set included isolates from multiple geographic origins and was used to place the representative Iraqi isolate A125-2 within an international phylogenetic context. Reference-based SNP analysis used the L. monocytogenes EGD-e chromosome (RefSeq accession NC_003210.1 GenBank AL591824.1) as the mapping reference. Only SNPs retained within conserved core-genome regions after exclusion or masking of ambiguous and low-quality positions were used for phylogenetic reconstruction. Because the complete archived records of the upstream mapping, SNP-calling software, and numerical filtering thresholds were unavailable, these parameters could not be reconstructed reliably and are therefore not reported.

Figure 1.

Core-genome SNP-based phylogenetic placement of the representative isolate A125-2 relative to selected international Listeria monocytogenes comparator genomes. Branch lengths represent genetic distance. The analysis concerns A125-2 only.

Statistical Analysis

Statistical analysis was performed using SPSS version 24.0. Categorical variables were summarized as frequencies and percentages, and continuous variables as means where appropriate. Categorical comparisons were assessed using the chi-square test or Fisher’s exact test, as appropriate. A two-sided p value <0.05 was considered statistically significant. Epidemiological observations for which a fully documented multivariable model was not available, including unpasteurized dairy exposure, seasonal distribution, and the interval from symptom onset to pregnancy loss, were reported descriptively and were not interpreted as independent or causal associations.

Results

Study Population Characteristics and L. monocytogenes Prevalence

Among the 150 enrolled women (mean age 28.4 ± 6.2 years), adverse outcomes comprised spontaneous abortion (n=63, 42%), intrauterine death/stillbirth (n=45, 30%), and preterm labor (n=42, 28%). Listeria monocytogenes was isolated from of 18/150 specimens (12.0%, 95% CI: 7.3–18.1%). The highest frequency was observed in spontaneous abortion cases (14.3%, p=0.042), followed by preterm labor (11.9%) and stillbirth (8.9%) (Table 2).

Table 2.

Distribution of L. monocytogenes Across Pregnancy Outcomes (n=150)

Pregnancy Outcome	Total Cases (n)	Positive Cases n (%)	95% CI	Pvalue*
Spontaneous Abortion	63	9 (14.3)	6.8–25.4	0.042
Intrauterine Death/Stillbirth	45	4 (8.9)	2.5–21.2	0.387
Preterm Labor	42	5 (11.9)	4.0–25.6	0.621
Total	150	18 (12.0)	7.3–18.1	-

Notes: * Significance: The p-value for Spontaneous Abortion (0.042) is less than 0.05, indicating a statistically significant association compared to the other outcomes. Prevalence: The overall positivity rate for L. monocytogenes in this study group is 12.0%.

Microbiological and PCR-Based Virulence Profiling

All 18 isolates were confirmed by characteristic morphology on PALCAM agar, biochemical tests (gram-positive, catalase-positive, tumbling motility), and 16S rRNA PCR (100% concordance). PCR screening revealed that the core virulence genes hlyA, actA, and inlA were present in 100% of all isolates. However, inlB was detected in only 66.7% (12 of 18) of the isolates (Table 3).

Table 3.

Virulence Gene Distribution Among L. monocytogenes Isolates (n=18)

Virulence Gene	Function	Positive n (%)	Distribution by Outcome*
hlyA	Phagosomal escape	18 (100%)	SA: 9/9; IUD: 4/4; PTL: 5/5
actA	Actin-based motility	18 (100%)	SA: 9/9; IUD: 4/4; PTL: 5/5
inlA	Epithelial invasion	18 (100%)	SA: 9/9; IUD: 4/4; PTL: 5/5
inlB	Placental invasion	12 (66.7%)	SA: 6/9; IUD: 3/4; PTL: 3/5

Notes: Values indicate the number of virulence-gene-positive isolates among the total number of L. monocytogenes-positive isolates within each pregnancy outcome category.

Abbreviations: * SA, spontaneous abortion; IUD, intrauterine death; PTL, preterm labor.

Note: The apparent absence of inlB in six isolates via conventional PCR was later identified by WGS as being due to significant sequence variation at the primer binding sites rather than genomic deletion.

Sequence analysis of the 16S rRNA gene (760 bp) revealed high conservation (98.2–100% identity). The Iraqi isolates were classified into three distinct groups (clusters A, B, and C) based on their genetic similarities and clinical associations. Cluster A was the most frequent and contained 11 isolates that showed 100% identity with global strains from China and France. The phylogenetic clustering, virulence-gene profiles, and clinical outcomes of all 18 isolates are summarized in Table 4.

Table 4.

Phylogenetic Clustering and Virulence Profiles of All Isolates (n=18)

Isolate ID	Cluster	inlA	inlB	actA	hlyA	Clinical Outcome
LM01	A	+	+	+	+	IUD
LM02	A	+	+	+	+	SA
LM03	A	+	+	+	+	SA
LM04	A	+	-	+	+	PTL
LM05	A	+	+	+	+	SA
LM06	A	+	+	+	+	SA
LM07	A	+	+	+	+	SA
LM08	A	+	-	+	+	SA
LM09	A	+	+	+	+	IUD
LM10	A	+	+	+	+	PTL
LM11	A	+	+	+	+	PTL
LM12	B	+	+	+	+	IUD
LM13	B	+	+	+	+	SA
LM14	B	+	-	+	+	PTL
LM15	B	+	+	+	+	SA
LM16	C	+	-	+	+	IUD
LM17	C	+	-	+	+	SA
LM18	C	+	-	+	+	SA

To obtain higher-resolution lineage information, core-genome SNP-based analysis was performed on the single representative isolate A125-2. In the phylogenetic analysis (Figure 1), A125-2 clustered within the Sequence Type 1 (ST1)/Clonal Complex 1 (CC1) lineage.

The limited SNP divergence between A125-2 and selected international ST1 comparators is consistent with the broad global distribution and genomic conservation of this lineage. This observation applies to the sequenced isolate only and does not establish population-level relatedness for all Iraqi isolates.

Whole-Genome Sequencing (WGS) and High-Resolution Typing

WGS of the representative isolate A125-2 provided approximately 200× coverage. rMLST and conventional MLST assigned A125-2 to ribosomal ST 15,959 and Sequence Type 1 (ST1) within Clonal Complex 1 (CC1). Genome annotation indicated an approximately 2.96-Mb genome with the GC-skew pattern shown in Figure 2. Functional categorization identified features related to replication/repair and phage-associated functions.

Figure 2.

Genome-level characterization of representative isolate A125-2. (A) Circular representation of the assembled genome showing coding sequences and GC-content/GC-skew features. (B) Functional categorization of annotated genomic features.

Phylogenomic Analysis

Core-genome SNP-based phylogenetic analysis placed the single Iraqi isolate A125-2 within the globally distributed ST1/CC1 clade (Figure 1). Its short genetic distance from selected international ST1 comparator genomes is consistent with conservation within this lineage; it should not be interpreted as evidence of direct transmission or as representative of all Iraqi L. monocytogenes isolates.

Expanded Virulome, Stress Survival, and AMR Genes

WGS of the representative clinical isolate A125-2 confirmed complete LIPI-1 and LIPI-3 (Listeriolysin S) gene clusters and detected multiple internalin genes (including inlA and inlB) together with stress-response determinants. These findings describe the virulence-gene repertoire of A125-2; they do not establish that the same genomic profile is present in the other 17 isolates.

Analysis of antimicrobial resistance (AMR) genes revealed both intrinsic and acquired determinants. These include fosX (100% identity, conferring resistance to fosfomycin), mprF (99.4%, associated with defensins resistance), norB (99.1%, fluoroquinolones efflux pump), and the lin gene (97.9%, lincosamides inactivation). The complete AMR profile for the sequenced isolate is summarized in Table 5.

Table 5.

AMR-Associated Genes Detected by WGS in Isolate A125-2

Gene	Resistance Mechanism	Antibiotic Class	Identity (%)
fosX	Antibiotic inactivation	Fosfomycin	100
mprF	Membrane charge modification	Defensins	99.42
norB	Efflux pump	Fluoroquinolones	99.14
lin	Antibiotic inactivation	Lincosamides	97.9

CRISPR-Phage Interaction and Epidemiological Risk Factors

CRISPR/Cas analysis of the representative isolate identified Type II-A Cas-associated loci. No spacer match was detected against Listeria phage vB_Lmo_2389_typeII in the analysis performed. This observation is reported descriptively and does not by itself establish prophage stability or lineage-wide behavior.

Among the 150 participants, 43 (28.7%) reported exposure to unpasteurized dairy products. Of the 18 Listeria monocytogenes-positive cases, 11 (61.1%) occurred during winter (December–February), whereas 7 (38.9%) occurred during the remaining months. The mean interval from symptom onset to pregnancy loss was 8.3 days among L. monocytogenes-positive cases compared with 14.2 days among negative cases; this comparison was descriptive. Whole-genome sequencing of the representative isolate A125-2 (n = 1) identified a Type II-A Cas-associated locus, while no spacer match was detected for the queried phage vB_Lmo_2389_typeII (GenBank accession PP453647.1) (Figure 3).

Figure 3.

Epidemiological and genomic findings. (A) CRISPR-Cas features of isolate A125-2. (B) Unpasteurized dairy exposure, seasonal distribution, and symptom-to-pregnancy-loss interval in the study cohort.

Discussion

This study integrates clinical and epidemiological data from 150 women with PCR-based virulence profiling of 18 L. monocytogenes isolates and WGS-based characterization of one representative isolate. The observed 12.0% positivity among women with adverse pregnancy outcomes supports the clinical relevance of listeriosis in this cohort, while the genomic component should be interpreted as a detailed case-level characterization rather than a population genomic survey.

The present findings highlight epidemiological and genomic features of Listeria monocytogenes in this cohort. Exposure to unpasteurized dairy products (28.7%) is consistent with the recognized importance of foodborne exposure in listeriosis; however, our descriptive data do not establish an independent risk association. The occurrence of 61.1% of positive cases during winter differs from previous reports. Qu L et al¹⁹ found that 75% of maternal and neonatal listeriosis cases in Xi’an occurred during spring and summer, with 54% of maternal cases occurring in spring. Similarly, Li C et al²⁰ reported that 10 of 12 (83.3%) pregnancy-associated cases in Beijing occurred during summer and autumn.

These differences may reflect geographic, climatic, dietary, or food-storage variations; nevertheless, the small number of positive cases in our study (n = 18) limits conclusions regarding seasonality. The shorter mean interval from symptom onset to pregnancy loss in positive vs negative cases (8.3 vs 14.2 days) should also be interpreted descriptively rather than as evidence of a statistically significant or causal relationship. Genomically, the Type II-A Cas-associated locus identified in isolate A125-2 is consistent with²¹ who identified Type II-A CRISPR-Cas9 systems in 41 of 275 (15%). The absence of a spacer match to the queried phage should be interpreted cautiously because²² demonstrated substantial diversity in Listeria CRISPR spacer repertoires and found that only a subset of spacers matched known Listeria bacteriophages. Because WGS was performed on a single representative isolate, these genomic findings cannot be generalized to all isolates.

The highest frequency of isolation was observed among cases of spontaneous abortion (14.3%), reinforcing epidemiological findings that link Listeria monocytogenes infection with first- and second-trimester complications.¹⁰ This is attributed to the organism’s unique ability to cross the placental barrier and replicate within trophoblastic cells.²³

The phylogenetic placement of A125-2 near selected international ST1/CC1 genomes is consistent with the recognized global distribution of this clonal complex. It does not demonstrate direct transmission, a recent cross-border event, or circulation of the same genomic profile among all Iraqi isolates. Such inferences would require WGS of a larger, systematically sampled isolate collection together with a fully documented comparator-genome workflow.

WGS also provided a useful explanation for one PCR/WGS discrepancy. Although inlB was amplified in only 12/18 isolates by conventional PCR, the sequenced representative isolate A125-2 contained inlB by WGS. This supports primer-binding-site variation or other assay-level sequence divergence as a plausible explanation for the PCR-negative result in A125-2. However, because the other PCR-negative isolates were not sequenced, WGS cannot establish the mechanism for all six PCR-negative isolates.

Genomic typing assigned A125-2 to ST1/CC1, a Lineage I-associated genotype widely reported among invasive human listeriosis isolates. The presence of LIPI-3 and a broad internalin repertoire further supports substantial virulence potential in this sequenced isolate. These findings should remain isolate-specific until additional Iraqi clinical isolates are sequenced.

The sequenced isolate also carried stress-response determinants and LIPI-3. These features may contribute to survival and pathogenic fitness, but the present study cannot causally link them to the speed or severity of pregnancy loss. At the epidemiological level, unpasteurized dairy consumption and winter predominance warrant public-health attention; however, at the epidemiological level unpasteurized dairy exposure and the observed winter predominance warrant further investigation in larger, adequately powered studies.

AMR-associated genes detected in A125-2 included fosX, mprF, norB, and lin. Genotypic detection of these determinants does not necessarily predict clinical resistance without phenotypic susceptibility testing and appropriate interpretive criteria. The findings therefore support continued antimicrobial-resistance surveillance rather than a change in treatment recommendations based on this single genome.

Study Limitations and Future Perspectives

The principal genomic limitation is that only one of the 18 L. monocytogenes isolates underwent WGS. Consequently, ST1/CC1 assignment, LIPI-3 carriage, the detailed virulome, AMR-associated genes, and core-genome SNP relationships cannot be generalized to the full isolate collection or to Iraqi L. monocytogenes populations. The study was also conducted in a limited geographic setting and some outcome subgroups were small, reducing statistical power. In addition, reproducibility of the phylogenomic analysis requires complete reporting of read trimming, assembly, SNP-calling/filtering parameters, the mapping reference, and comparator-genome accessions. Future multicenter studies should sequence multiple isolates, use a predefined genomic analysis pipeline, and integrate food/environmental sampling with clinical surveillance.

Conclusion

In this cohort of 150 women with adverse pregnancy outcomes, L. monocytogenes was detected in 18 participants (12.0%), with the highest positivity among spontaneous abortion cases. PCR showed widespread detection of hlyA, actA, and inlA, while inlB was detected in 12/18 isolates. WGS of one representative isolate, A125-2, assigned it to ST1/CC1 and identified LIPI-1, LIPI-3, multiple internalins, stress-response determinants, and AMR-associated genes. WGS also detected inlB in A125-2 despite the PCR discrepancy, illustrating the value of sequence-level analysis for investigating assay discordance. These genomic findings are specific to A125-2 and should not be extrapolated to all Iraqi or regional isolates. The epidemiological findings support strengthening food-safety education, particularly regarding unpasteurized dairy products, while broader multi-isolate genomic surveillance is needed to define circulating lineages and transmission patterns.

Funding Statement

No external funding was received for this study. The Article Processing Charge (APC) is covered by the authors.

Abbreviations

WGS, Whole-Genome Sequencing; MLST, Multilocus Sequence Typing; rMLST, Ribosomal Multilocus Sequence Typing; ST, Sequence Type; CC, Clonal Complex; SNPs, Single Nucleotide Polymorphisms; InDels, Insertions and Deletions; AMR, Antimicrobial Resistance; VFDB, Virulence Factor Database; CARD, Comprehensive Antibiotic Resistance Database; CRISPR, Clustered Regularly Interspaced Short Palindromic Repeats; TSBYE, Tryptic Soy Broth with Yeast Extract; SSI, Stress Survival Islet; LIPI, Listeria Pathogenicity Island; OR, Odds Ratio; CI, Confidence Interval; SPSS, Statistical Package for the Social Sciences; IUD, Intrauterine Death; PTL, Preterm Labor; SA, Spontaneous Abortion.

Data Sharing Statement

The genome sequence generated in this study has been deposited in the NCBI Bio Sample database. The Bio Sample accession number for strain LM-Ramadi-2025 is SAMN55408695 and Gene Bank accession number is JCCEXJ000000000.1 https://www.ncbi.nlm.nih.gov/nuccore/JCCEXJ000000000.

Ethics Declaration

Ethical approval and consent to participate the ethics committee of Anbar Medical College, Iraq (Reference: No 186,2/11/2024-AMC) was used and carried out in accordance with the Helsinki Declaration. Written informed consent was obtained from all participants.

Author Contributions

All authors made a significant contribution to the work reported, whether in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising, or critically reviewing the article; gave final approval of the version to be published; agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

Disclosure

We declare that the authors have no competing or other interests that might influence the results and/or discussion reported in this paper.