Abstract
A random mutagenesis technique was used to predict the evolutionary potential of β-lactamase CTX-M-9 toward the acquisition of improved catalytic activity against ceftazidime. Thirty CTX-M mutants were obtained during three rounds of mutagenesis. These mutants conferred 1- to 128-fold-higher MICs of ceftazidime than the parental enzyme CTX-M-9. The CTX-M mutants contained one to six amino acid substitutions. Mutants harbored the substitutions Asp240Gly and Pro167Ser, which were previously observed in clinical CTX-M enzymes. Additional substitutions, notably Arg164His, Asp179Gly, and Arg276Ser, were observed near the active site. The kinetic constants of the three most active mutants revealed two distinct ways of improving catalytic efficiency against ceftazidime. One enzyme had a 17-fold-higher kcat value than CTX-M-9 against ceftazidime. The other two had 75- to 300-fold-lower Km values than CTX-M-9 against ceftazidime. The current emergence of CTX-M β-lactamases with improved activity against ceftazidime may therefore be the beginning of an evolutionary process which might subsequently generate a great diversity of CTX-M-type ceftazidimases.
The most prevalent mechanism of resistance against β-lactams in gram-negative bacilli is the production of β-lactamases belonging to structural class A (1). Class A β-lactamases are active-site serine enzymes which cleave the amide bond in the β-lactam ring via an acyl-enzyme intermediate.
Oxyimino cephalosporins, such as ceftazidime or cefotaxime, are highly resistant to this hydrolysis by class A penicillinases such as TEM-1, TEM-2, and SHV-1. However, the extensive use of these β-lactams has resulted in the emergence of extended-spectrum β-lactamases (ESBLs). The first ESBLs were derived from the TEM-1/2 and SHV-1 β-lactamases by critical amino acid substitutions which confer hydrolytic activity against oxyimino cephalosporins. The major substitutions are located in two elements of the binding site: the β3 strand at position 238 and the omega loop at positions 164 and 179 (27).
Non-TEM, non-SHV ESBLs designated CTX-M enzymes were identified in the early 1990s (2, 36). The frequency of CTX-M enzymes has increased sharply worldwide since 1995, and they now form a growing family that comprises more than 40 enzymes (3). Most CTX-M enzymes exhibit a much greater hydrolytic efficiency against cefotaxime than against ceftazidime, unlike TEM- and SHV-type ESBLs. However, seven CTX-M mutants harboring point mutations which improve enzymatic efficiency against ceftazidime have been reported recently, suggesting that CTX-Ms are altering their substrate specificity in response to continued antibiotic selective pressure. Five mutants harbor substitution Asp240Gly (4, 5, 16, 29, 31), and two mutants harbor substitutions Pro167Ser/Thr (33, 38). These substitutions have not been previously observed in natural TEM or SHV ESBLs, suggesting that CTX-M enzymes have a singular evolutionary potential. In this work, a random mutagenesis technique was applied to the CTX-M-9-encoding gene to predict whether other substitutions are involved in this evolution process.
MATERIALS AND METHODS
Bacterial strains and plasmids.
An Escherichia coli ΔampC strain was constructed from E. coli DH5α (Novagen, Darmstadt, Germany). E. coli ΔampC and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) were used for the cloning experiments. E. coli BW25141 was the recipient of the kanamycin resistance cassette (14).
The pKOBEG (10) and pCP20 (13) plasmids were used for the construction of E. coli ΔampC. Plasmid pClRio-7 (4) was the original source of the blaCTX-M-9 gene, and plasmid pBK-CMV (Stratagene, Amsterdam, The Netherlands) was used for the cloning experiments during the mutagenesis process. The subcloning experiments and the overexpression of CTX-M-encoding genes were performed with a modified pET9a plasmid (24).
Construction of an E. coli DH5α ΔampC isogenic mutant.
An isogenic mutant of E. coli DH5α in which the ampC gene was deleted was constructed by the method of Datsenko and Wanner (14). Briefly, E. coli DH5α was transformed with pKOBEG plasmid (10) and cultivated at 30°C in Luria-Bertani (LB) broth supplemented with 25 μg/ml chloramphenicol and 1 mM l-arabinose. When the optical density at 620 nm reached 0.5, the bacterial culture was incubated for 20 min at 42°C and for 10 min at 4°C. E. coli DH5α was then washed three times with 10% glycerol.
The Flp recognition target-flanked cassette harboring the kanamycin resistance-encoding gene was generated by PCR from E. coli BW25141 with the primers MIampC-1 and MIampC-2 (Table 1), which contained sequences homologous to regions adjacent to the ampC gene (Fig. 1A). The PCR products were electroporated in the previously glycerol-washed E. coli DH5α. The resulting E. coli ΔampC::Kanr, in which the ampC gene was replaced by a kanamycin resistance cassette, was selected at 37°C on LB agar containing 50 μg/ml of kanamycin and verified by PCR. After this primary selection, mutants were maintained at 42°C without antibiotics to eliminate the pKOBEG plasmid. The loss of this helper plasmid was verified by a chloramphenicol sensitivity test. The mutant was then transformed with plasmid pCP20, and the kanamycin resistance cassette was deleted using the Flp recognition target system (14). E. coli ΔampC::Kanr(pCP20) was selected at 30°C on LB agar supplemented with 25 μg/ml chloramphenicol and then maintained at 42°C without antibiotic to cure the helper plasmid pCP20. The loss of this helper plasmid and of the kanamycin resistance cassette was checked by a chloramphenicol and kanamycin susceptibility test, and the loss of ampC gene was checked by PCR (Fig. 1).
TABLE 1.
Oligonucleotides used
| Primer | Oligonucleotide sequence (5′→3′) |
|---|---|
| MIampC-1 | GTAAATCCGGCCCGCCTATGGCGGGCCGTT TTGTATGGAAACCAGACCCTGTAG |
| MIampC-2 | CAGCAAGGAAAAGCGGAGAAAAGGTCCGAA AATTCGGACCCGATGGAATTCATA |
| ampC-1 | GGCTATGCGGACATCGCC |
| ampC-2 | GCCTGCTCAAAACTCAAACC |
| ampC-3 | TCTACGGTCTGGCTGCTATCC |
| ampC-4 | TGTCGCTGCGGCAACGAGAG |
| k2 | CGGTGCCCTGAATGAACTGC |
| kt | CGGCCACAGTCGATGAATCC |
| k1 | CAGTCATAGCCGAATACCCT |
| pBK-CMV1′ | CTAGTGGATCCAAAGAATTCAAAAAGC |
| pBK-CMV2′ | AATTGGGTACACTTACCTGGTACCC |
| NdeORFM9-A | GGAATTCCATATGGTGACAAAGAGAGTGC |
| SfiORFM9-B | GACTATCGGCCTTTTTGGCCTTACAGCCCT TCGGCGAT |
FIG. 1.
Deletion of the ampC gene from E. coli DH5α. (A) Schematic representation of locations of different primers on DNA of E. coli DH5α the E. coli ΔampC::Kanr and E. coli ΔampC isogenic mutants. (B) PCR amplification product analysis. Amplification products were generated by using specific primers for the kanamycin resistance cassette sequence (k2 and kt) (lanes 1), for the intragenic region of the ampC gene (ampC-1 and ampC-2) (lanes 2), for the location of the kanamycin resistance cassette (ampC-3) and k1 [lanes 3] and ampC-4 and k2 [lanes 4], and for the extragenic region of the ampC gene (ampC-3 and ampC-4) (lanes 5). (a) E. coli DH5α; (b) E. coli ΔampC::Kanr; (c) E. coli ΔampC.
In vitro mutagenesis.
The blaCTX-M-9 gene was mutagenized by error-prone PCR with the GeneMorph random mutagenesis kit (Stratagene, Amsterdam, The Netherlands) as recommended by the manufacturer. Briefly, 10 ng of plasmid was amplified by PCR with 200 μM each deoxynucleoside triphosphate, 125 ng primers pBK-CMV1′ and pBK-CMV2′ (Table 1), and 2.5 U Mutazyme DNA polymerase. The primers included restriction sites for enzymes KpnI and EcoRI. The mutagenized amplicon was cleaved with these endonucleases (Roche Applied Science, Meylan, France) and cloned into the corresponding restriction sites of plasmid pBK-CMV downstream of the lacZ promoter. The recombinant plasmids were transformed into E. coli ΔampC, which was then cultured in 1 ml LB broth at 37°C for 1 h.
One hundred microliters of transformed cells was spread on Mueller-Hinton plates supplemented with 32 μg/ml amoxicillin and 20 μg/ml kanamycin to evaluate the total number of CTX-M-producing strains which were screened during the mutagenesis experiment. In parallel, 900 μl of recombinants was selected for growth on Mueller-Hinton agar with increased concentrations of ceftazidime.
Three rounds of mutagenesis were performed consecutively. About 20,000 β-lactamase-producing clones were screened by using 4 μg/ml ceftazidime during the first round. The mutant candidates for the second and third rounds were selected on the basis of inhibition diameters of ≥21 mm for cefotaxime or ≥14 mm for ceftazidime and a number of amino acid substitutions of ≤3 in order to increase the diversity of the recovered substitutions. During the second round, about 10,000 β-lactamase-producing clones were screened from six candidate mutants on agar containing 8 μg/ml of ceftazidime. During the third round, about 10,000 β-lactamase-producing clones were screened from four candidate mutants on agar containing 16 μg/ml of ceftazidime.
Selection of mutants for sequencing.
The resistant phenotype of CTX-M mutant-harboring clones was established for β-lactams and kanamycin by the disk diffusion method. These clones were classified into two resistance phenotypes on the basis of inhibition diameters for cefotaxime and ceftazidime. Phenotype 1 exhibited similar inhibition diameters for ceftazidime and cefotaxime, and phenotype 2 exhibited lower inhibition diameters for ceftazidime than for cefotaxime. In both these phenotypes, the clones can be subgrouped on the basis of the inhibition diameter values for β-lactams. blaCTX-M genes were sequenced from two mutants in each phenotype group.
The sequences were determined by direct sequencing of PCR products, using the dideoxy chain termination procedure with an Applied Biosystems sequencer (ABI 377) (34). The nucleotide and deduced protein sequences were analyzed using software available at the website of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). The ClustalW program (http://infobiogen.fr) was used for alignment of multiple protein sequences (39).
Susceptibility to β-lactams.
Antibiotic-containing disks were used for antibiotic susceptibility testing by the disk diffusion assay (Sanofi-Diagnostics Pasteur, Marnes la Coquette, France). MICs were determined by a microdilution method on Mueller-Hinton agar (Sanofi Diagnostics Pasteur, Marnes la Coquette, France) with an inoculum of 104 CFU per spot. MICs of β-lactam antibiotics were determined alone and combined at a fixed concentration of clavulanic acid (2 μg/ml) or tazobactam (4 μg/ml). Antibiotics were provided as powders by Glaxo SmithKline (amoxicillin, ticarcillin, cefuroxime, ceftazidime, and clavulanic acid), Wyeth Laboratories (piperacillin and tazobactam), Eli Lilly (cephalothin), Roussel-Uclaf (cefotaxime and cefpirome), Bristol-Myers-Squibb (aztreonam and cefepime), and Merck Sharp and Dohme-Chibret (imipenem).
β-Lactamase preparation.
The mutant genes were amplified by PCR from plasmid pBK-CMV with primers NdeORFM9-A and SfiORFM9-B, which included restriction sites for enzymes NdeI and SfiI (Table 1). The PCR products were digested with these two enzymes and were ligated into the corresponding restriction sites of modified plasmid pET9a (24). The resulting plasmids were transformed into E. coli BL21(DE3). E. coli transformants were selected on Mueller-Hinton agar supplemented with 30 μg kanamycin and 0.5 μg ceftazidime.
CTX-M mutant-encoding genes were overexpressed in Escherichia coli BL21(DE3) from pET9 derivative plasmids in 2xYT broth (Qbiogene, Irvine, CA) supplemented with 0.1 mM isopropyl-β-d-thiogalactopyranoside (Sigma Chemical Co., St Louis, Mo.), as previously reported (11). After extraction of the enzymes by sonication, the extract was clarified by centrifugation and treatment with DNase I (Roche Applied Science, Meylan, France). CTX-M purification was carried out as previously described (6) by ion-exchange chromatography with an SP Sepharose column (Amersham Pharmacia Biotech) and gel filtration chromatography with a Superose 12 column (Amersham Pharmacia Biotech), using a fast protein liquid chromatography system. The total protein concentration was estimated by the Bio-Rad protein assay (Bio-Rad, Richmond, Calif.), with bovine serum albumin (Sigma Chemical Co., St Louis, Mo.) used as a standard. The purities of enzyme extracts were estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (6).
Determination of β-lactamase kinetic constants.
Steady-state kinetic parameters were determined for mutants exhibiting ceftazidime, cefotaxime, and amoxicillin MICs of ≥64, ≥16, and ≥2048 μg/ml, respectively. The Michaelis constant (Km) and catalytic activity (kcat) were determined with purified extracts by using a computerized microacidimetric method (23). Bovine serum albumin and Triton X-100 (Sigma Chemical Co., St Louis, Mo.) were added at final concentrations of 50 μg/ml and 0.01%, respectively, to prevent denaturation (20) and aggregation of enzyme M-A6B1C1.
RESULTS
Construction of E. coli ΔampC.
An ampC gene isogenic mutant of E. coli DH5α was constructed to eliminate phenotypic variations which may result from AmpC production during in vitro evolution. The ampC gene was replaced by kanamycin resistance cassette in E. coli ΔampC::Kanr. The cassette was then eliminated by using the helper plasmid pCP20. Each step of the construction was checked by PCR (Fig. 1). The resulting strain was designated E. coli ΔampC.
Collection of mutants.
After the first round of mutagenesis, 106 clones were able to grow in the presence of 4 μg/ml ceftazidime. Phenotype 1, which exhibited similar inhibition diameters for ceftazidime and cefotaxime, possessed 81 clones. Phenotype 2, which exhibited a smaller inhibition diameter for ceftazidime than for cefotaxime, possessed 25 clones. The clones belonging to phenotype 2 presented a great diversity of inhibition diameters for the other β-lactams, unlike the clones belonging to phenotype 1, which formed a homogenous group. A second round of mutagenesis was performed from six candidate mutants (one from phenotype 1 and five from phenotype 2), and 123 clones were obtained on agar containing 8 μg/ml ceftazidime; 22 clones belonged to phenotype 1, and 101 clones belonged to phenotype 2. The last round of mutagenesis was performed from four candidate mutants (two from phenotype 1 and two from phenotype 2); 60 clones had resistance phenotype 1, and 39 others had resistance phenotype 2.
DNA sequencing.
Deduced amino acid sequences revealed 38 different substitutions and one to six substitutions per enzyme (Table 2). One to three substitutions per CTX-M mutant were acquired after each cycle of mutagenesis.
TABLE 2.
Clones, their phenotypes, and the corresponding enzymes obtained from amino acid substitution in the CTX-M-9 enzyme during three cycles of mutagenesis
| Cycle of mutagenesis | Clone | Resistance phenotype | Enzyme | Substitution(s) |
|---|---|---|---|---|
| First (round A) | A1 | 1a | M-A1 | D240G |
| A2 | 1 | M-A2 | D240G, V29A | |
| A3 | 1 | M-A3 | D240G, I173T | |
| A4 | 2b | M-A4 | L169Q | |
| A5 | 2 | M-A5 | P167S, N106S | |
| A6 | 2 | M-A6 | P167S | |
| A7 | 2 | M-A7 | D179G, N106S, T86A | |
| A8 | 2 | M-A8 | R276S, A231V, R164H | |
| Second (round B) | A1B1 | 1 | M-A1B1 | D240G, R276H, Q87L |
| A1B2 | 1 | M-A1B1 | D240G, A219D | |
| A4B1 | 2 | M-A4B1 | D240G, L169Q | |
| A5B1 | 2 | M-A5B1 | P167S, N106S, T159S | |
| A6B1 | 2 | M-A6B1 | P167S, A109T | |
| A7B1 | 2 | M-A7B1 | D179G, N106S, T86A, A231V, T165I | |
| A7B2 | 2 | M-A7B2 | D179G, N106S, T86A, A231V | |
| A7B3 | 2 | M-A7B3 | D179G, N106S, T86A, R276H | |
| A8B1 | 2 | M-A8B1 | R276S, A231V, R164H, P167S | |
| A8B2 | 2 | M-A8B2 | R276S, A231V, R164H, P167H | |
| A8B3 | 2 | M-A8B3 | R276S, A231V, R164H, G289E, Q188R, D179N | |
| A8B4 | 2 | M-A8B4 | R2768, A231V, R164H, D179Y | |
| Third (round C) | A1B1C1 | 1 | M-A1B1C1 | D240G, R276H, Q87L, H112Y, T230I, A231V |
| A1B2C1 | 2 | M-A1B2C1 | D240G, A219D, G289W, H197R, L169M | |
| A5B1C1 | 2 | M-A5B1C1 | P167S, N106S, T159S, T171S, T209S | |
| A5B1C2 | 2 | M-A5B1C2 | P167S, N106S, T159S, A140V, A231V | |
| A6B1C1 | 2 | M-A6B1C1 | P167S, A109T, G146R, T227A, Q254P | |
| A6B1C2 | 2 | M-A6B1C2 | P167S, A109T, E166V | |
| A6B1C3 | 2 | M-A6B1C3 | P167S, A109T, E201D | |
| A6B1C4 | 2 | M-A6B1C4 | P167S, A109T, A231V | |
| A6B1C5 | 2 | M-A6B1C5 | P167S, A109T, A172V | |
| A6B1C6 | 2 | M-A6B1C6 | P167S, A109T, A77V, P268A |
Resistance phenotype 1 exhibits similar MICs for cefotaxime and ceftazidime.
Resistance phenotype 2 exhibits higher MICs for ceftazidime than for cefotaxime.
All CTX-M-9 mutants associated with resistance phenotype 1 harbored the Asp240Gly substitution, which is located in the β3 strand (Fig. 2). The CTX-M mutants harbored the Asp240Gly substitution alone (M-A1) or associated with substitution Val29Ala (M-A2) or Ile173Thr (M-A3) after the first round of mutagenesis. After the second round, the Asp240Gly substitution was associated with one (Ala219Asp in M-A1B2) or two (Gln87Leu and Arg276His in M-A1B1) additional substitutions. After the last round, three other substitutions appeared in mutants M-A1B2C1 (Gly289Trp, His197Arg, and Leu169Met) and M-A1B1C1 (His112Tyr, Thr230Ile, and Ala231Val).
FIG. 2.
Crystallographic structure of the CTX-M-9 β-lactamase. The omega loop is in dark blue, the β3 strand is in red, the H11 α-helix is in brown, the N-terminal extremity of the H2 α-helix is in light blue, and the loop between positions 102 and 110 is in purple. The locations of substitutions, which are discussed in the text, are indicated by green circles. Residues Ser70, Lys73, and Asn104 are indicated by red circles. The diagram was drawn with UCSF CHIMERA (30).
The mutants involved in resistance phenotype 2 harbored a larger diversity of substitutions than those implicated in resistance phenotype 1. Twenty-four additional substitutions were observed (Table 2). Substitutions at positions 167, 169, 179, and/or 164, which are located in the omega loop, appeared from the first round of mutagenesis (Fig. 2).
The Pro167Ser substitution appeared alone in mutant M-A6 or in association with substitution Asn106Ser in mutant M-A5. Their derivatives M-A5B1 and M-A6B1 harbored the additional substitutions Thr159Ser and Ala109Thr, respectively, and were at the origins of 8 out of 10 mutants obtained during the third round of mutagenesis (M-A5B1C1, M-A5B1C2, and M-A6B1C1 to M-A6B1C6). These mutants harbored a complex combination of substitutions, which comprised substitutions Ala77Val, Gly146Arg, Glu166Val, Thr171Ser, Ala172Val, Glu201Asp, Thr209Ser, Thr227Ala, Ala231Val, Gln254Pro, and Pro268Ala (Table 2).
The Leu169Gln substitution was observed after the first round of mutagenesis alone in mutant M-A4. After the second round of mutagenesis, this substitution was associated with substitution Asp240Gly in its derivative M-A4B1. During the third round of mutagenesis, a second type of substitution, Leu169Met, was observed in mutant M-A1B2C1. This enzyme, which derived from mutant M-A1B2, additionally harbored substitutions Asp240Gly, His197Arg, Ala219Asp, and Gly289Trp.
The Asp179Gly substitution was associated with substitutions Asn106Ser and Thr86Ala in mutant M-A7. During the second round of mutagenesis, the M-A7-encoding gene was at the origins of the three mutants M-A7B1, M-A7B2, and M-A7B3, which harbored the additional substitutions Thr165Ile, Ala231Val, and/or Arg276His.
The Arg164His substitution was obtained in mutant M-A8 after the first round of mutagenesis in association with substitutions Ala231Val and Arg276Ser. This enzyme was at the origin of four additional mutants (M-A8B1 to M-A8B4) after a second round of mutagenesis. These mutants harbored the substitution at position 164 in combination with other substitutions of the omega loop: Pro167Ser, Pro167His, Asp179Asn, and Asp179Tyr.
MICs of β-lactams.
MICs of β-lactams were determined for the 30 clones collected for blaCTX-M sequencing (Table 3). Overall, ceftazidime MICs increased from 1 μg/ml for CTX-M-9-producing E. coli ΔampC to 128 μg/ml for the mutant-producing clones (A6B1C1). MICs of ceftazidime ranged from 8 to 16, 8 to 64, and 16 to 128 μg/ml after the first, second, and third rounds of mutagenesis, respectively. Among the 30 CTX-M-producing clones, 16 had a high level of resistance to ceftazidime (MIC of ≥32 μg/ml). Of these, eight were obtained after the second round of mutagenesis, and the other eight were obtained after the third round. Clone A6B1C1, which had the highest ceftazidime MIC (128 μg/ml), was obtained after three cycles of mutagenesis.
TABLE 3.
β-Lactam MICs for CTX-M-producing mutants of E. coli ΔampC
| E. coli mutant | MIC (μg/ml) ofa:
|
|||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AMX | AMC | TIC | TCC | PIP | PIT | CF | CXM | CTX | CAZ | ATM | FEP | CPO | IMP | |
| ΔampC | <256 | 4 | 2 | 2 | 2 | 2 | 4 | 4 | 0.06 | 0.12 | 0.12 | 0.06 | 0.06 | 0.25 |
| M9b | >2,048 | 16 | >2,048 | 32 | 256 | 2 | 1,024 | 1,024 | 16 | 1 | 8 | 2 | 4 | 0.25 |
| A1 | >2,048 | 8 | >2,048 | 16 | 128 | 2 | 512 | 1,024 | 16 | 8 | 16 | 2 | 4 | 0.25 |
| A2 | 1,024 | 8 | >2,048 | 16 | 64 | 2 | 256 | 256 | 8 | 8 | 4 | 0.5 | 0.5 | 0.25 |
| A3 | >2,048 | 2 | >2,048 | 16 | 256 | 4 | 512 | 1,024 | 32 | 16 | 32 | 4 | 8 | 0.25 |
| A4 | 256 | 8 | 256 | 8 | 8 | 2 | 16 | 16 | 0.5 | 8 | 0.5 | 0.06 | 0.06 | 0.25 |
| A5 | 128 | 4 | 64 | 8 | 8 | 2 | 8 | 8 | 0.5 | 8 | 0.12 | 0.12 | 0.12 | 0.25 |
| A6 | 256 | 8 | 512 | 16 | 8 | 4 | 32 | 16 | 0.5 | 8 | 0.12 | 0.12 | 0.12 | 0.25 |
| A7 | 256 | 4 | 256 | 8 | 8 | 2 | 8 | 16 | 0.25 | 8 | 0.5 | 0.12 | 0.12 | 0.25 |
| A8 | 2,048 | 16 | >2,048 | 16 | 128 | 2 | 512 | 256 | 2 | 16 | 1 | 2 | 4 | 0.12 |
| A1B1 | >2,048 | 2 | >2,048 | 16 | 256 | 4 | 256 | 512 | 16 | 8 | 4 | 4 | 8 | 0.25 |
| A1B2 | >2,048 | 8 | >2,048 | 16 | 512 | 2 | 1,024 | 2,048 | 32 | 16 | 16 | 8 | 16 | 0.25 |
| A4B1 | 8 | 4 | 32 | 16 | 32 | 4 | 8 | 16 | 8 | 32 | 4 | 1 | 4 | 0.25 |
| A5B1 | 2,048 | 16 | >2,048 | 16 | 64 | 2 | 64 | 128 | 2 | 16 | 4 | 0.5 | 1 | 0.25 |
| A6B1 | 2,048 | 8 | >2,048 | 16 | 32 | 2 | 128 | 128 | 2 | 32 | 2 | 0.5 | 0.5 | 0.25 |
| A7B1 | 512 | 8 | 128 | 8 | 64 | 2 | 32 | 128 | 8 | 64 | 4 | 1 | 1 | 0.25 |
| A7B2 | 512 | 8 | 512 | 8 | 64 | 2 | 32 | 128 | 8 | 64 | 4 | 1 | 1 | 0.25 |
| A7B3 | 256 | 8 | 256 | 8 | 16 | 2 | 16 | 64 | 1 | 16 | 1 | 0.5 | 1 | 0.25 |
| A8B1 | 1,024 | 8 | 2,048 | 32 | 32 | 8 | 128 | 128 | 2 | 64 | 1 | 1 | 2 | 0.50 |
| A8B2 | 64 | 8 | 256 | 16 | 8 | 4 | 16 | 32 | 2 | 64 | 0.5 | 1 | 1 | 0.25 |
| A8B3 | 2,048 | 8 | >2,048 | 16 | 64 | 2 | 512 | 256 | 16 | 64 | 1 | 2 | 4 | 0.25 |
| A8B4 | 8 | 8 | 64 | 16 | 8 | 4 | 4 | 16 | 2 | 64 | 0.5 | 0.5 | 1 | 0.25 |
| A1B1C1 | >2,048 | 16 | >2,048 | 32 | 512 | 2 | 1,024 | 2,048 | 64 | 64 | 16 | 8 | 16 | 0.25 |
| A1B2C1 | 256 | 8 | 512 | 8 | 128 | 2 | 128 | 512 | 16 | 64 | 8 | 4 | 8 | 0.25 |
| A5B1C1 | 1,024 | 8 | 1,024 | 8 | 16 | 2 | 32 | 128 | 2 | 16 | 2 | 0.5 | 0.5 | 0.25 |
| A5B1C2 | >2,048 | 16 | >2,048 | 16 | 256 | 2 | 1,024 | 512 | 8 | 64 | 16 | 2 | 4 | 0.25 |
| A6B1C1 | >2,048 | 16 | >2,048 | 64 | 256 | 4 | 1,024 | 512 | 16 | 128 | 4 | 2 | 4 | 0.25 |
| A6B1C2 | 8 | 8 | 16 | 16 | 8 | 4 | 8 | 16 | 1 | 32 | 2 | 0.5 | 0.5 | 0.25 |
| A6B1C3 | 1,024 | 8 | 2,048 | 16 | 32 | 4 | 128 | 64 | 2 | 16 | 1 | 0.25 | 0.5 | 0.25 |
| A6B1C4 | >2,048 | 8 | >2,048 | 16 | 128 | 4 | 512 | 128 | 8 | 64 | 4 | 0.5 | 2 | 0.25 |
| A6B1C5 | 32 | 8 | 64 | 8 | 4 | 2 | 8 | 32 | 2 | 64 | 0.5 | 0.5 | 0.5 | 0.25 |
| A6B1C6 | 2,048 | 8 | >2,048 | 16 | 64 | 2 | 128 | 128 | 8 | 64 | 2 | 1 | 1 | 0.25 |
AMX, amoxicillin; AMC, amoxicillin and clavulanate (2 μg/ml); TIC, ticarcillin; TCC, ticarcillin and clavulanate (2 μg/ml); PIP, piperacillin; PIT, piperacillin and tazobactam (4 μg/ml); CF, cephalothin; CXM, cefuroxime; CTX, cefotaxime; CAZ, ceftazidime; ATM, aztreonam; FEP, cefepime; CPO, cefpirome; IMP, imipenem.
M9, CTX-M-9-encoding E. coli ΔampC.
In contrast to CTX-M-9-producing E. coli ΔampC, which exhibited higher MICs of cefotaxime than of ceftazidime (16 versus 1 μg/ml), mutant-producing E. coli ΔampC clones belonging to resistance phenotype 1 (A1 to A3, A1B1, A1B2, and A1B1C1) exhibited similar MICs of cefotaxime and ceftazidime (8 to 64 versus 8 to 64 μg/ml). MICs of ceftazidime were 8- to 64-fold higher for mutant-producing E. coli ΔampC than for the CTX-M-9-producing E. coli ΔampC. In comparison with CTX-M-9-producing E. coli ΔampC, mutant-producing E. coli ΔampC clones of resistance phenotype 1 exhibited no major modification of MICs of penicillins (64 to >2,048 versus 256 to >2,048 μg/ml), cephalothin (256 to 1,024 versus 1,024 μg/ml), cefuroxime (256 to 2,048 versus 1,024 μg/ml), and cefotaxime (8 to 64 versus 16 μg/ml).
The clones belonging to resistance phenotype 2 exhibited higher MICs of ceftazidime than of cefotaxime, unlike CTX-M-9-producing E. coli ΔampC. The MICs of cefotaxime for mutant-producing E. coli ΔampC defined two groups. Among the clones with cefotaxime MICs of 8 to 16 μg/ml (similar to those of CTX-M-9-producing E. coli DH5α-ΔampC), the MICs of amoxicillin were identical to those of CTX-M-9-producing E. coli ΔampC for clones A8B3, A5B1C2, A6B1C1, A6B1C4, and A6B1C6 and were lower (<1,024 μg/ml) for clones A4B1, A1B2C1, A7B1, and A7B2. The others clones exhibited cefotaxime MICs (0.25 to 2 μg/ml) lower than those for CTX-M-9-producing E. coli ΔampC. This decrease in cefotaxime MICs was not associated with major modifications of MICs of amoxicillin for clones A8, A5B1, A6B1, A8B1, A5B1C1, and A6B1C3 (1,024 to >2,048 μg/ml), but the MICs of amoxicillin were lower for clones A4, A5, A6, A7, A7B3, A8B2, A8B4, A6B1C2, and A6B1C5 (8 to 256 μg/ml).
For the 30 clones, the MICs of inhibitor-penicillin combinations, aztreonam, cefepime, cefpirome, and imipenem did not increase more than fourfold in comparison with those for CTX-M-9-producing E. coli ΔampC.
Kinetic constants.
The mutants designated M-A1B1C1, M-A6B1C1, and M-A8B3, were overexpressed in E. coli BL21(DE3) from pET9a-derived plasmids and were purified by liquid chromatography. One to 3 milligrams of β-lactamase per liter of culture medium was obtained, and the purity was estimated to be >98%.
The kinetic parameters for these strains are shown in Table 4. M-A1B1C1 exhibited typical enzymatic features of CTX-M mutants. Lower Km values were obtained for penicillins (Km, 14 to 35 μM) than for cephalosporins (140 to 450 μM). Cephalothin was the best substrate (kcat, 3,800 s−1), and a higher kcat was observed for cefotaxime (550 s−1) than for ceftazidime (35 s−1). However, the kcat value against ceftazidime was 17-fold higher for M-A1B1C1 than for CTX-M-9. In addition, the ceftazidime Km value of M-A1B1C1 was lower than that of CTX-M-9 (450 μM versus 600 μM). Conversely, the kinetic constants of M-A6B1C1 and M-A8B3 were different from those of typical CTX-M enzymes, such as CTX-M-9. kcat values against penicillins and cephalothin were 7- to 25-fold lower for the two mutants than for CTX-M-9. kcat values of M-A6B1C1 were also significantly lower than those of CTX-M-9 for oxyimino cephalosporins (cefotaxime, 17 versus 450 s−1; ceftazidime, 0.1 versus 2 s−1). kcat values of M-A8B3 against these substrates were still about 10-fold lower than those of M-A6B1C1. Although the Km values for cephalothin and cefotaxime were similar for M-A6B1C1 (250 and 200 μM) and CTX-M-9 (150 and 120 μM), the Km value against ceftazidime was considerably lower for M-A6B1C1 than for CTX-M-9 (8 versus 600 μM). Km values of M-A8B3 were impressively low for all β-lactams (2 to 13 μM), in particular for oxyimino cephalosporins (2 to 4 μM).
TABLE 4.
Kinetic parameters of CTX-M-9 and derivative mutants M-A1B1C1, M-A6B1C1, and M-A8B3
| Drug | CTX-M-9
|
M-A1B1C1
|
M-A6B1C1
|
M-A8B3
|
||||
|---|---|---|---|---|---|---|---|---|
| kcat (s−1) | Km (μM) | kcat (s−1) | Km (μM) | kcat (s−1) | Km (μM) | kcat (s−1) | Km (μM) | |
| Benzylpenicillin | 295 | 25 | 115 | 14 | 12 | 12 | 15 | 4 |
| Amoxicillin | 90 | 20 | 67 | 35 | 5.5 | 12 | 7 | 12 |
| Cephalothin | 3,000 | 150 | 3,800 | 140 | 420 | 250 | 200 | 13 |
| Cefotaxime | 450 | 120 | 550 | 200 | 17 | 200 | 2 | 4a |
| Ceftazidime | 2 | 600a | 35 | 450 | 0.1 | 8a | 0.01 | 2a |
Km values were determined as the Ki values by substrate competition with benzylpenicillin.
DISCUSSION
CTX-M enzymes exhibited a much greater hydrolytic activity against cefotaxime than against ceftazidime. A random mutagenesis technique was applied to the CTX-M-9-encoding open reading frame to investigate the substitutions which can improve the activity of CTX-M enzymes against ceftazidime. Thirty CTX-M mutants were recovered, and they harbored 38 distinct substitutions at 32 positions. Most positions were located in the vicinity of the binding site and can be categorized into three clusters: positions previously mutated among clinical CTX-M enzymes (positions 167 and 240) (4, 8, 16, 31, 33, 38), mutated positions observed among ceftazidimase TEM/SHV-type ESBLs (positions 164 and 179) (21), and new mutated positions (Fig. 2). These last positions were located close to the entrance of the binding site (positions 106, 109, and 276) and in the omega loop that forms part of the active-site depression (positions 159, 165, 166, 169, 171, 172, and 173).
Substitutions previously observed among clinical CTX-M enzymes. (i) Residue 167.
Residue 167 is located in the omega loop. The residue Pro is usually observed at position 167 in class A enzyme. Substitutions at position 167 (Pro167Ser/His) were observed in 14 CTX-M mutants, as in clinical ESBLs CTX-M-19, CTX-M-23, BPS-1m, and OXY-2-5, which exhibited an improved enzymatic activity against ceftazidime (17, 20, 26, 38). All these CTX-M mutants conferred a higher level of resistance to ceftazidime than to cefotaxime. However, this substitution alone was responsible for a dramatic decrease in MICs of penicillins and other cephalosporins. Comparisons of MICs for clones A6, A6B1, and A6B1C4 suggest that substitutions Ala109Thr and Ala231Val may partially compensate for this pernicious action. The effect of substitution Pro167Ser may be due to a decrease in stability (20). Chen et al. showed that substitution Ala231Val caused a 2°C increase in the protein melting temperature of CTX-M-9 and a 1.1-kcal/mol increase in stability (11). This effect may explain the increase in MICs induced by the addition of substitution Ala231Val to substitution Pro167Ser.
(ii) Residue 240.
Aspartate 240 is located at the end of the β3 strand, at the entrance of the binding site. The residue at position 240 is not conserved among β-lactamases of class A. Acid residues (Glu or Asp) are observed in TEM-1 and SHV-1 penicillinases and CTX-Ms. Residue Gly240 is present in the ESBLs PER, VEB-1, and BES-1, which have hydrolytic activity against ceftazidime (6, 32). The Asp240Gly substitution was obtained in eight CTX-M mutants, as in natural enzymes CTX-M-15, CTX-M-16, CTX-M-27, and CTX-M-32, which exhibited improved activity against ceftazidime (4, 8, 16, 31). CTX-M mutant M-A1 has the same amino acid sequence as CTX-M-16. Its derivative M-A1B1C1, which harbored the additional substitutions Ala231Val, Gln87Leu, His112Tyr, Thr230Ile, and Arg276His, conferred high-level resistance against all β-lactams, which therefore is the best compromise in the resistance phenotype. This enzyme had greater hydrolytic activity against ceftazidime (kcat, 35 s−1) than did natural CTX-M enzymes, including those harboring substitutions Pro167Ser and Asp240Gly. These results suggest that the natural CTX-M enzymes harboring the substitution Asp240Gly are the most probable phylum for new mutants conferring the highest level of resistance to β-lactams.
Mutated positions observed among ceftazidimase TEM/SHV-type ESBLs. (i) Residues 164 and 179.
Residues Arg164 and Asp179 establish a salt bridge that anchors the base of the omega loop in TEM/SHV penicillinases and CTX-M enzymes (19, 22, 35). Substitutions Arg164Ser/His and Asp179Ala/Gly/Asn/Glu are common among TEM/SHV-type ESBLs (15, 21). These changes are involved in the extension of substrate specificity to extended-spectrum cephalosporins such as ceftazidime by increasing flexibility in the omega loop. However, these substitutions have never been observed in natural CTX-M enzymes. Substitutions at positions 164 and 179 were obtained after one round of mutagenesis. During the three round of mutagenesis, the substitutions were obtained in nine mutants and always in combination with additional substitutions. The substitutions at positions 231 and/or 276 were harbored in eight of these mutants, which conferred a higher level of resistance to ceftazidime than to cefotaxime. Surprisingly, substitutions Arg164His and Asp179Asn/Tyr were both obtained simultaneously in the same mutants. Mutant M-A8B3, which harbored substitutions Arg164His and Asp179Asn in combination with Gln188Arg, Ala231Val, Arg276Ser, and Gly289Glu, conferred 64-fold higher resistance to ceftazidime than the parental enzyme CTX-M-9. However, its hydrolytic activities against oxyimino cephalosporins, including ceftazidime, were greatly inferior to those of CTX-M-9. In fact, the increase in activity against ceftazidime for M-A8B3 resulted in an impressively low Km value (2 μM, versus 600 μM for CTX-M-9).
(ii) Residue 169.
Residue 169 is highly conserved in β-lactamases. In vitro mutagenesis experiments with the TEM-1 enzyme and the recent characterization of the ESBL SHV-57 showed that substitutions Leu169Pro and Leu169Arg resulted in activity against ceftazidime with a concomitantly significant compromise in the resistance to penicillins (25, 40). Two different substitutions were obtained at position 169 in our CTX-M mutants, Leu169Gln and Leu169Met, which seem to confer similar behavior against penicillins and ceftazidime. These substitutions induced an inversion of the resistance phenotype against ceftazidime and cefotaxime in comparison to the phenotype induced by the parental enzyme CTX-M-9, as observed with the other mutants harboring substitutions at positions 164, 167, and 179 located in the omega loop. The association of substitution Asp240Gly with Leu169Gln in mutant A4B1 raised the MICs of ceftazidime and cefotaxime in comparison with those for mutant A4 (ceftazidime MICs, 32 versus 8 μg/ml; cefotaxime MICs, 8 versus 0.5 μg/ml).
Substitutions not observed among clinical CTX-M, TEM, and SHV enzymes. (i) Residue 276.
Residue 276 is in the terminal α-11 helix. CTX-M enzymes do not contain Arg244, which interacts with the carboxylate function of substrates and inhibitors in most ESBLs. This interaction is critical for the catalysis and the inhibition process of TEM-1 penicillinase (9). Residue Arg276 of CTX-M enzymes was predicted to be a substitute for Arg244. A substitution at position 276 was obtained during three distinct mutational events. However, the Arg276His substitution in association with substitutions Asp179Gly, Asn106Ser, and Thr86Ala caused only a modest increase in MICs against ceftazidime (8 μg/ml conferred by mutants M-A7 versus 16 μg/ml conferred by mutant M-A7B3). The MICs of inhibitor β-lactam combinations were not significantly modified by these substitutions, in contrast with the substitution at position 244 in TEM enzymes (9).
(ii) Residues 106 and 109.
Residues 106 and 109 are located in the loop harboring residue 104, in the vicinity of residue 132, which are implicated in the binding of β-lactams in CTX-M catalytic cavity (35). Residues Asn106 and Ala109, observed in clinical CTX-M enzymes, were replaced in 15 CTX-M mutants by residues Ser106 and Thr109, which are observed in TEM and SHV enzymes (19, 22, 35). Residues 106 and 109 are implicated in the placing of side chains of residues 104 and 132, respectively (35). In association with the substitution Pro167Ser, Ala109Thr increased the ceftazidime MIC (32 μg/ml conferred by mutant M-A6B1 versus 8 μg/ml conferred by mutant M-A6). In addition, the Ala109Thr substitution seems to compensate for the pernicious effect of substitution Pro167Ser on activity against penicillins (32 to >2,048 μg/ml versus 8 to 512 μg/ml) and the other cephalosporins (0.5 to 128 μg/ml versus 0.12 to 32 μg/ml). Mutant M-A6B1C1, which harbored the association Pro167Ser and Ala109Thr in combination with substitutions Gly146Arg, Thr227Ala, and Gln254Pro, had the highest MIC of ceftazidime (128 μg/ml). This was due to the very low Km (8 μM) of the enzyme with regard to ceftazidime, as observed with mutant M-A8B3.
(iii) Residue 166.
The role of Glu166 in both the acylation and deacylation steps of TEM β-lactamases has been well argued from kinetic and modeling studies (27, 28). Recent crystallographic data indicate that the Lys73 side chain may replace Glu166 in the acylation step of CTX-M β-lactamases (11, 12, 18, 37). In this case, a substitution at position 166 would inactivate the CTX-M enzyme. The Glu166Val-harboring mutant M-A6B1C2 conferred a dramatic decrease in the MICs of β-lactams, except for ceftazidime (32 μg/ml), as observed with the Glu166Ala-harboring mutant of PER-1 (7). The unexpected activity of M-A6B1C2 against ceftazidime suggests the intervention of other residues in the process of deacylation of ceftazidime in this mutant, which harbored the additional substitutions Pro167Ser and Ala109Thr. Recent crystallographic data showed that residue Lys73, which is able to interact with residue Ser70 and the catalytic water molecule, was greatly mobile in the enzyme CTX-M-9 (11). Hydrolysis might be catalyzed in M-A6B1C2 by a symmetric process mediated by residue Lys73, which may activate residue Ser70 during the acylation step and the catalytic water molecule during the deacylation step. However, this process seems to be substrate dependent and efficient only against ceftazidime.
In conclusion, 30 clones with ceftazidime MICs (8 to 128 μg/ml) higher than those induced by the CTX-M-9 enzyme (1 μg/ml) were obtained. The substitutions involved in this in vitro evolution include both those previously observed in natural CTX-M enzymes and new substitutions. This wide diversity emphasizes the evolutionary potential of CTX-M enzymes. The substitutions may emerge in the future under selection pressure driven by the therapeutic use of ceftazidime.
Acknowledgments
We thank Marlene Jan, Rolande Perroux, and Dominique Rubio for technical assistance and Sophie Quevillon-Cheruel for providing us the modified pET9a plasmid.
This work was supported by “Contrat Quadriennal de Recherche” and “Bonus Qualité Recherche” grants from the Ministère de l'Education Nationale, de l'Enseignement Supérieur et de la Recherche, Paris, France.
REFERENCES
- 1.Ambler, R. P., A. F. Coulson, J. M. Frere, J. M. Ghuysen, B. Joris, M. Forsman, R. C. Levesque, G. Tiraby, and S. G. Waley. 1991. A standard numbering scheme for the class A beta-lactamases. Biochem. J. 276:269-270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bauernfeind, A., H. Grimm, and S. Schweighart. 1990. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection 18:294-298. [DOI] [PubMed] [Google Scholar]
- 3.Bonnet, R. 2004. Growing group of extended-spectrum beta-lactamases: the CTX-M enzymes. Antimicrob. Agents Chemother. 48:1-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bonnet, R., C. Dutour, J. L. Sampaio, C. Chanal, D. Sirot, R. Labia, C. De Champs, and J. Sirot. 2001. Novel cefotaximase (CTX-M-16) with increased catalytic efficiency due to substitution Asp-240→Gly. Antimicrob. Agents Chemother. 45:2269-2275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bonnet, R., C. Recule, R. Baraduc, C. Chanal, D. Sirot, C. De Champs, and J. Sirot. 2003. Effect of D240G substitution in a novel ESBL CTX-M-27. J. Antimicrob. Chemother. 52:29-35. [DOI] [PubMed] [Google Scholar]
- 6.Bonnet, R., J. L. Sampaio, C. Chanal, D. Sirot, C. De Champs, J. L. Viallard, R. Labia, and J. Sirot. 2000. A novel class A extended-spectrum beta-lactamase (BES-1) in Serratia marcescens isolated in Brazil. Antimicrob. Agents Chemother. 44:3061-3068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bouthors, A. T., N. Dagoneau-Blanchard, T. Naas, P. Nordmann, V. Jarlier, and W. Sougakoff. 1998. Role of residues 104, 164, 166, 238 and 240 in the substrate profile of PER-1 beta-lactamase hydrolysing third-generation cephalosporins. Biochem. J. 330:1443-1449. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Cartelle, M., M. del Mar Tomas, F. Molina, R. Moure, R. Villanueva, and G. Bou. 2004. High-level resistance to ceftazidime conferred by a novel enzyme, CTX-M-32, derived from CTX-M-1 through a single Asp240-Gly substitution. Antimicrob. Agents Chemother. 48:2308-2313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chaibi, E. B., D. Sirot, G. Paul, and R. Labia. 1999. Inhibitor-resistant TEM beta-lactamases: phenotypic, genetic and biochemical characteristics. J. Antimicrob. Chemother. 43:447-458. [DOI] [PubMed] [Google Scholar]
- 10.Chaveroche, M. K., J. M. Ghigo, and C. d'Enfert. 2000. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28:E97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Chen, Y., J. Delmas, J. Sirot, B. Shoichet, and R. Bonnet. 2005. Atomic resolution structures of CTX-M beta-lactamases: extended spectrum activities from increased mobility and decreased stability. J. Mol. Biol. 348:349-362. [DOI] [PubMed] [Google Scholar]
- 12.Chen, Y., B. Shoichet, and R. Bonnet. 2005. Structure, function, and inhibition along the reaction coordinate of CTX-M beta-lactamases. J. Am. Chem. Soc. 127:5423-5434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Cherepanov, P. P., and W. Wackernagel. 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9-14. [DOI] [PubMed] [Google Scholar]
- 14.Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Delmas, J., F. Robin, F. Bittar, C. Chanal, and R. Bonnet. The unexpected enzyme TEM-126: role of mutation Asp179Glu. Antimicrob. Agents Chemother. 49:4280-4287. [DOI] [PMC free article] [PubMed]
- 16.Dhawan, B., R. Bonnet, N. K. Shukla, P. Mathur, B. K. Das, and A. Kapil. 2003. Infection with an extended-spectrum beta-lactamase-producing strain of Serratia marcescens following tongue reconstruction. J. Clin. Microbiol. 41:2233-2234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ho, P. L., T. K. Cheung, W. C. Yam, and K. Y. Yuen. 2002. Characterization of a laboratory-generated variant of BPS beta-lactamase from Burkholderia pseudomallei that hydrolyses ceftazidime. J. Antimicrob. Chemother. 50:723-726. [DOI] [PubMed] [Google Scholar]
- 18.Ibuka, A. S., Y. Ishii, M. Galleni, M. Ishiguro, K. Yamaguchi, J. M. Frere, H. Matsuzawa, and H. Sakai. 2003. Crystal structure of extended-spectrum beta-lactamase Toho-1: insights into the molecular mechanism for catalytic reaction and substrate specificity expansion. Biochemistry 42:10634-10643. [DOI] [PubMed] [Google Scholar]
- 19.Jelsch, C., L. Mourey, J. M. Masson, and J. P. Samama. 1993. Crystal structure of Escherichia coli TEM1 beta-lactamase at 1.8 A resolution. Proteins 16:364-383. [DOI] [PubMed] [Google Scholar]
- 20.Kimura, S., M. Ishiguro, Y. Ishii, J. Alba, and K. Yamaguchi. 2004. Role of a mutation at position 167 of CTX-M-19 in ceftazidime hydrolysis. Antimicrob. Agents Chemother. 48:1454-1460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Knox, J. R. 1995. Extended-spectrum and inhibitor-resistant TEM-type beta-lactamases: mutations, specificity, and three-dimensional structure. Antimicrob. Agents Chemother. 39:2593-2601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kuzin, A. P., M. Nukaga, Y. Nukaga, A. M. Hujer, R. A. Bonomo, and J. R. Knox. 1999. Structure of the SHV-1 beta-lactamase. Biochemistry 38:5720-5727. [DOI] [PubMed] [Google Scholar]
- 23.Labia, R., J. Andrillon, and F. Le Goffic. 1973. Computerized microacidimetric determination of beta lactamase Michaelis-Menten constants. FEBS Lett. 33:42-44. [DOI] [PubMed] [Google Scholar]
- 24.Leulliot, N., S. Quevillon-Cheruel, I. Sorel, M. Graille, P. Meyer, D. Liger, K. Blondeau, J. Janin, and H. van Tilbeurgh. 2004. Crystal structure of yeast allantoicase reveals a repeated jelly roll motif. J. Biol. Chem. 279:23447-23452. [DOI] [PubMed] [Google Scholar]
- 25.Ma, L., J. Alba, F. Y. Chang, M. Ishiguro, K. Yamaguchi, L. K. Siu, and Y. Ishii. 2005. Novel SHV-derived extended-spectrum beta-lactamase, SHV-57, that confers resistance to ceftazidime but not cefazolin. Antimicrob. Agents Chemother. 49:600-605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Mammeri, H., L. Poirel, and P. Nordmann. 2003. In vivo selection of a chromosomally encoded beta-lactamase variant conferring ceftazidime resistance in Klebsiella oxytoca. Antimicrob. Agents Chemother. 47:3739-3742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Matagne, A., J. Lamotte-Brasseur, and J. M. Frere. 1998. Catalytic properties of class A beta-lactamases: efficiency and diversity. Biochem. J. 330:581-598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Minasov, G., X. Wang, and B. K. Shoichet. 2002. An ultrahigh resolution structure of TEM-1 beta-lactamase suggests a role for Glu166 as the general base in acylation. J. Am. Chem. Soc. 124:5333-5340. [DOI] [PubMed] [Google Scholar]
- 29.Munday, C. J., D. A. Boyd, N. Brenwald, M. Miller, J. M. Andrews, R. Wise, M. R. Mulvey, and P. M. Hawkey. 2004. Molecular and kinetic comparison of the novel extended-spectrum beta-lactamases CTX-M-25 and CTX-M-26. Antimicrob. Agents Chemother. 48:4829-4834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Pettersen, E. F., T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt, E. C. Meng, and T. E. Ferrin. 2004. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem. 25:1605-1612. [DOI] [PubMed] [Google Scholar]
- 31.Poirel, L., M. Gniadkowski, and P. Nordmann. 2002. Biochemical analysis of the ceftazidime-hydrolysing extended-spectrum beta-lactamase CTX-M-15 and of its structurally related beta-lactamase CTX-M-3. J. Antimicrob. Chemother. 50:1031-1034. [DOI] [PubMed] [Google Scholar]
- 32.Poirel, L., T. Naas, M. Guibert, E. B. Chaibi, R. Labia, and P. Nordmann. 1999. Molecular and biochemical characterization of VEB-1, a novel class A extended-spectrum beta-lactamase encoded by an Escherichia coli integron gene. Antimicrob. Agents Chemother. 43:573-581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Poirel, L., T. Naas, I. Le Thomas, A. Karim, E. Bingen, and P. Nordmann. 2001. CTX-M-type extended-spectrum beta-lactamase that hydrolyzes ceftazidime through a single amino acid substitution in the omega loop. Antimicrob. Agents Chemother. 45:3355-3361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Shimamura, T., A. Ibuka, S. Fushinobu, T. Wakagi, M. Ishiguro, Y. Ishii, and H. Matsuzawa. 2002. Acyl-intermediate structures of the extended-spectrum class A beta-lactamase, Toho-1, in complex with cefotaxime, cephalothin, and benzylpenicillin. J. Biol. Chem. 277:46601-46608. [DOI] [PubMed] [Google Scholar]
- 36.Sirot, D., C. Chanal, R. Labia, and J. Sirot. 1989. Susceptibility of new beta-lactams to the expanded-spectrum beta-lactamase CTX-1. Infection 17:28-30. [DOI] [PubMed] [Google Scholar]
- 37.Strynadka, N. C., H. Adachi, S. E. Jensen, K. Johns, A. Sielecki, C. Betzel, K. Sutoh, and M. N. James. 1992. Molecular structure of the acyl-enzyme intermediate in beta-lactam hydrolysis at 1.7 A resolution. Nature 359:700-705. [DOI] [PubMed] [Google Scholar]
- 38.Sturenburg, E., A. Kuhn, D. Mack, and R. Laufs. 2004. A novel extended-spectrum beta-lactamase CTX-M-23 with a P167T substitution in the active-site omega loop associated with ceftazidime resistance. J. Antimicrob. Chemother. 54:406-409. [DOI] [PubMed] [Google Scholar]
- 39.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Vakulenko, S., and D. Golemi. 2002. Mutant TEM beta-lactamase producing resistance to ceftazidime, ampicillins, and beta-lactamase inhibitors. Antimicrob. Agents Chemother. 46:646-653. [DOI] [PMC free article] [PubMed] [Google Scholar]