Chrysanthemum morifolium extract prevents oxidative stress and ferroptosis in cerebral ischemia-reperfusion injury by modulating the miR-144/Nrf2 pathway

Abstract

BACKGROUND/OBJECTIVES

Cerebral ischemia-reperfusion injury (CIRI) is characterized by oxidative stress (OS) and ferroptosis. Chrysanthemum morifolium extract (CME) has been reported to have antioxidant activity. This study evaluated its protective effects and underlying mechanisms against CIRI.

MATERIALS/METHODS

In vitro, H19-7 cells were pretreated with CME before oxygen-glucose deprivation/reoxygenation (OGD/R). Cell viability, apoptosis, OS markers (reactive oxygen species [ROS], malondialdehyde [MDA], glutathione [GSH], and superoxide dismutase [SOD]), ferroptosis markers, and the related proteins of the miR-144/nuclear factor erythroid 2-related factor 2 (Nrf2) pathway were assessed. The targeting relationship between miR-144 and Nrf2 was confirmed by dual-luciferase reporter assay. Rescue experiments were performed using Nrf2 overexpression. An in vivo rat middle cerebral artery occlusion (MCAO) model was established, and the effects of CME, agomir-144 (miR-144 agonist), and bardoxolone (BARD; Nrf2 agonist) on the cerebral infarct volume, histopathology, apoptosis, and the aforementioned molecular pathways were evaluated.

RESULTS

A CME pretreatment significantly restored the cell viability, reduced apoptosis, and suppressed OS and ferroptosis in OGD/R-induced H19-7 cells, as evidenced by decreased ROS, MDA, apoptosis, lipid peroxidation, and Fe²⁺ levels, and increased GSH, SOD, and the expression of nuclear Nrf2 and its downstream proteins (heme oxygenase-1, glutamate-cysteine ligase modifier subunit, solute carrier family 7 member 11, and glutathione peroxidase 4). These protective effects were reversed by miR-144 mimic but rescued by Nrf2 overexpression. Consistently, the in vivo results showed that CME reduced cerebral infarction, ameliorated neuronal damage and apoptosis in MCAO rats, and modulated the miR-144/Nrf2 pathway and related OS/ferroptosis markers. Agomir-144 attenuated these benefits, while a BARD co-treatment restored them.

CONCLUSION

CME alleviates CIRI by inhibiting OS and ferroptosis via the miR-144/Nrf2 pathway, providing novel insights into CIRI treatment strategies.

INTRODUCTION

Ischemic stroke (IS), the second-highest cause of mortality worldwide, is a serious neurological disease affecting many individuals [1]. Currently, thrombolysis is the mainstay treatment for IS, which involves dissolving thrombi to recover the blood supply before a brain injury [2]. Nevertheless, the return of blood flow inevitably leads to substantial cell death and tissue damage in the perfused area, a phenomenon known as cerebral ischemia-reperfusion injury (CIRI) [3]. Currently, efficacious therapies (drug and mechanical treatments) for CIRI always come with adverse effects. Consequently, there is a strong need to understand the mechanisms in depth and develop novel therapies for treating CIRI.

Oxidative stress (OS) is vital for the onset and progression of CIRI [4]. Furthermore, ferroptosis, an iron-dependent form of regulated cell death driven by lipid peroxidation, has recently been identified as a crucial pathogenic mechanism in CIRI [5]. The interplay between OS and ferroptosis produces a vicious cycle that amplifies neuronal damage. Thus, targeting CIRI-induced OS and ferroptosis could be an efficient strategy to counter CIRI. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key regulator that can protect cells from OS [6]. In particular, Nrf2 also serves as a central regulator of ferroptosis by transcriptionally activating a network of genes involved in iron metabolism, glutathione (GSH) synthesis, and antioxidant defense [7]. Upon activation, Nrf2 translocates to the nucleus and binds to the antioxidant response element (ARE), promoting the transcription of downstream cytoprotective genes, including heme oxygenase-1 (HO-1), the glutamate-cysteine ligase modifier subunit (GCLM), the solute carrier family 7 member 11 (SLC7A11), and glutathione peroxidase 4 (GPX4) [8]. These proteins collectively form a comprehensive defense system that coordinately counteracts OS and suppresses ferroptosis: HO-1 degrades pro-oxidant heme; GCLM facilitates GSH biosynthesis; SLC7A11 enables cystine uptake for GSH production; and GPX4 directly reduces lipid hydroperoxides [9]. Emerging evidence suggests that miR-144 directly targets Nrf2, and miR-144 overexpression exacerbates high-glucose-induced OS and apoptosis, which can be mitigated using an Nrf2 activator [10]. Scholars have also reported that targeting the miR-144/Nrf2 axis can alleviate ischemia–reperfusion injury by suppressing OS [11,12]. Nevertheless, its role in regulating ferroptosis in CIRI remains unexplored. Therefore, targeting the miR-144/Nrf2 pathway is a potentially effective approach to ameliorate CIRI by inhibiting OS and ferroptosis.

Chrysanthemum morifolium Ramat. (CM) is a traditional oriental herbal medicine with diverse health benefits, including anti-tumorigenic, antioxidant, anti-inflammatory, and hepatoprotective activities [13]. Several studies have researched the antioxidant activity of CM, providing evidence of its powerful ability to scavenge reactive oxygen free radicals and prevent oxidative injury [14]. Furthermore, C. morifolium extract (CME) has been reported to reduce oxidative damage to ARPE-19 cells by activating the Nrf2/HO-1 pathway [15] and alleviate CIRI by exerting its antioxidant properties [16]. Nevertheless, it is unclear whether CME can reduce OS in CIRI by regulating the miR-144/Nrf2 pathway.

This study used oxygen-glucose deprivation and reoxygenation (OGD/R)-induced cell damage in H19-7 cells to stimulate CIRI models in vitro, and developed middle cerebral artery occlusion (MCAO) surgery-induced brain damage in rats to establish CIRI models in vivo. The study examined the effects of CME on the OS and ferroptosis in CIRI models and their underlying molecular mechanisms. Overall, the findings of this research can offer a novel target for CIRI therapy.

MATERIALS AND METHODS

Cell culture and transfection

Hippocampal neuronal cells H19-7 (HTX3536), supplied by Otwo Biotech (Shenzhen, China), were cultured in Dulbecco's Modified Eagle Medium (DMEM; 37°C, 5% CO₂). miR-144 mimics were supplied by Guangzhou RiboBio Co., Ltd. (Guangzhou, China), and lentivirus-packaged Nrf2 plasmids (oe-Nrf2) were procured from GenePharma Co., Ltd. (Shanghai, China) H19-7 cells grown in 6-well plates were transfected using Lipofectamine 2000 with either miR-144 mimics alone or in combination with oe-Nrf2. After 24 h, quantitative polymerase chain reaction (qPCR) was performed to assess the transfection efficiency.

CME preparation

C. morifolium was supplied by EFUTON GLOBAL TEA (Hangzhou, China). According to a previous study, an analysis of CME using ultra-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry revealed the presence of various flavonoids, including rutin, luteolin, quercetin, schaftoside, quercitrin, apigenin-7-glucoside, apigenin, and naringenin. The extraction method is reported elsewhere [17].

CME pretreatment and OGD/R injury

The effects of CME on CIRI were examined by pretreating H19-7 cells with increasing concentrations of CME for 24 h: 50 μg/mL (CME-L + OGD/R group), 100 μg/mL (CME-M + OGD/R group), and 200 μg/mL (CME-H + OGD/R group), before being subjected to OGD/R [17]. The mechanisms by which CME influenced CIRI were analyzed. Accordingly, cells that had been transfected with miR-144 mimics alone (CME + miR-144 mimic + OGD/R group) or in combination with oe-Nrf2 (CME + miR-144 mimic + oe-Nrf2 + OGD/R group) were pretreated with 200 μg/mL of CME, followed by a challenge with OGD/R. During the OGD/R procedure, H19-7 cells were initially cultured in DMEM without glucose and then transferred to an anoxic incubator containing a premixed gas (1% O₂, 5% CO₂, and 94% N₂) for 2 h at 37°C [18]. Subsequently, the cells were cultured in normal complete medium under normal oxygen conditions (5% CO₂ and 95% air) at 37 °C for 24 h for reoxygenation [19]. The cells that had not undergone any treatment were considered the control group, while those exposed to OGD/R but not pretreated with CME were used as the OGD/R group.

Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay

After the OGD/R treatment, the H19-7 cells were collected and seeded into 96-well plates for 24 h. Subsequently, 20 µL of MTT solution (ST316; Beyotime, Shanghai, China) was added to each well, and the H19-7 cells were kept in the dark for 4 h. Subsequently, the formazan crystals that formed were dissolved in dimethyl sulfoxide, and the absorbance at 490 nm was examined.

Immunofluorescence

The cells were fixed, permeabilized, and blocked. They were then incubated with primary antibody Nrf2 (ab313825; Abcam, Cambridge, UK) at 4°C overnight. After washing with phosphate-buffered saline (PBS), the cells were incubated with fluorescent secondary antibody (ab150077; Abcam) and 4′,6-diamidino-2-phenylindole in the dark, mounted, and observed by fluorescence microscopy.

Dual-luciferase reporter assay

Briefly, the cells were co-transfected with miR-NC or miR-144, and Nrf2 wild-type (WT) or Nrf2 mutant (MUT) by Lipofectamine 2000. Forty-eight h later, the luciferase activities were quantified using a dual-luciferase reporter assay system, with the Renilla luciferase activity serving as the internal control.

Cell Counting Kit-8 (CCK-8) assay

After undergoing different treatments, the H19-7 cells were harvested and incubated for 24 h. Subsequently, the H19-7 cells were treated with CCK-8 solution (C0039; Beyotime) for another 2 h. Finally, the absorbance was measured at 450 nm using a microplate reader, and the cell viability was calculated.

Reactive oxygen species (ROS) measurement

The ROS levels in the H19-7 cells were assessed using a commercial detection kit (S0033M; Beyotime) with the fluorescent probe 2′,7′-dichlorofluorescein diacetate (DCFH-DA). Briefly, after undergoing various treatments, H19-7 cells were rinsed and then exposed to DCFH-DA at 10 μM. After incubation for 20 min, the intracellular ROS levels in the H19-7 cells were measured by detecting the DCFH fluorescence intensity using flow cytometry.

Flow cytometry analysis

After the treatments, H19-7 cells were collected, washed, and centrifuged. The cell pellets were then suspended in a binding buffer, after which Annexin V-FITC/PI (556547; BD, Franklin Lakes, NJ, USA) was added. After incubation in the dark for 15 min, the apoptosis rates of the cells were measured within 1 h using a flow cytometer.

FerroOrange staining

After washing with PBS, cells were incubated with a 1 μM FerroOrange working solution (MX4559-24UG; Shanghai Maokang Biotechnology Co., Ltd., Shanghai, China) at 37°C in the dark for 30 min. After incubation, the cells were washed with PBS, resuspended as a single-cell suspension, and analyzed by flow cytometry.

BODIPY 581/581 C11 staining

After the drug treatment, the H19-7 cells were stained with 2 μM BODIPY 581/591 C11 for 30 min at 37°C in the dark, washed, and immediately observed and photographed under an inverted fluorescence microscope. Lipid peroxidation was assessed by comparing the intensities of reduced (red fluorescence) and oxidized (green fluorescence) forms and calculating the green/red fluorescence ratio.

Detection of ferrous ions

After undergoing various treatments, the H19-7 cells were washed and centrifuged. The ferrous ion (BC5415; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) levels in the H19-7 cell supernatants were assessed using the corresponding commercial detection kits.

Animals

In the study, male Sprague–Dawley rats (weighing 220–240 g) were supplied by Shanghai SLAC Laboratory Animal Co., Ltd. The rats were maintained under controlled conditions (21–23°C, 50–70% humidity, and 12-h light/dark cycles). Approval for all animal experiments performed in this study was granted by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (ZJEY-20230907-01), and this study adhered strictly to the guidelines of the Institutional Animal Care and Use Committee.

Animal grouping and modeling

The rats were assigned randomly to 4 groups: MCAO, MCAO + CME, MCAO + CME + agomir-144, and MCAO + CME + agomir-144 + bardoxolone (BARD; n = 6). The rats in the agomir-144 group received an intravenous administration of 3.46 nmol agomir-144 [20]. The rats in the agomir-144 + BARD group received an intravenous administration of 3.46 nmol agomir-144, and an intraperitoneal injection of 2 mg/kg BARD [21]. All rats, except the MCAO group, were then administered 200 mg/kg CME by gavage [17]. In the MCAO group, the rats received identical volumes of saline via gavage. After 90 min, all rats underwent MCAO surgery.

CIRI animal models were established by MCAO surgery as reported elsewhere [17,22]. After animals were anesthetized with 3.5% isoflurane, an incision was made in the neck to carefully expose the left common carotid artery, external carotid artery (ECA), and internal carotid artery (ICA). The blood flow was blocked by passing a suture through the ECA into the ICA until the tip of the suture reached the entrance of the middle cerebral artery. After 1.5 h of ischemia, the suture was removed, and reperfusion was achieved.

Histopathological analysis of brain tissues

Twenty-four h after reperfusion, all animals were euthanized using an overdose of CO₂. The rat brain tissues were removed, fixed in paraformaldehyde, embedded in paraffin, and sectioned into continuous slices. These sections were treated with 2,3,5-triphenyltetrazolium chloride (TTC) solution (F603BA0025; Sangon Biotech, Shanghai, China) and hematoxylin-eosin (HE) staining reagents (H3136; Sigma-Aldrich, St. Louis, MO, USA; E4009; Sigma-Aldrich), respectively. The images of the brain tissues were obtained and observed using a microscope.

Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining

Briefly, the brain tissue slices were immersed in a TUNEL mixture (C1090; Beyotime) for 2 h. The slices were then incubated with 4′,6-diamidino-2′-phenylindole dihydrochloride kits (ab104139; Abcam) for nuclear staining in the dark for 10 min. The slices were then examined and analyzed with a fluorescence microscope.

qPCR

After various treatments, the total RNA from H19-7 cells or brain tissues was isolated using RNA extraction kits (AG21024; Accurate Biology, Changsha, China). The isolated RNA was then converted into cDNA using a reverse transcription kit (CW2569M; Jiangsu Cowin Biotech Co., Ltd., Taizhou, China). qPCR was conducted using a SYBR Green qPCR kit (11201ES03; Yeasen, Shanghai, China). Table 1 lists the primer sequences used in the process.

Table 1. Primer sequence used in the study.

Gene	Forward primer	Reverse primer
Rat miR-144	GGGCCTTGGCTGGGATATCAT	GGGGTACCCAGACTAGTACATCA
Rat Nrf2	ACTACAGTCCCAGCAGGACA	ATTGAACTCCACCGTGCCTT
Rat GAPDH	AAGGTCGGTGTGAACGGATTT	CTTTGTCACAAGAGAAGGCAGC

Nrf2, nuclear factor erythroid 2-related factor 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Immunohistochemistry

For paraffin sections, after deparaffinization, rehydration, and antigen retrieval, the sections were quenched with endogenous peroxidase with 3% H₂O₂ and blocked with serum. Subsequently, Nrf2 (AF0639; Affinity, San Francisco, CA, USA) primary antibody was then applied and incubated overnight at 4°C in a humidified chamber. After washing with PBS, the horseradish peroxidase (HRP)-conjugated secondary antibody (ab97080; Abcam) was applied and incubated for 1 h at room temperature. Finally, the color was developed with a DAB substrate, counterstained with hematoxylin, dehydrated, cleared, and mounted for microscopic examination.

Detection of malondialdehyde (MDA), GSH, and superoxide dismutase (SOD) activity

After undergoing various treatments, the H19-7 cells were washed and centrifuged. The rat brain tissues were homogenized. The levels of MDA (A003-1), GSH (A006-2-1), and SOD (A001-1) in the H19-7 cell supernatants and brain tissues were assessed using the corresponding commercial detection kits.

Detection of lipid peroxide (LPO)

The LPO levels in H19-7 cells and brain tissue were measured using a LPO assay kit (A106-1; Nanjing Jiancheng Bioengineering Institute, Nanjing, China). H19-7 cells after drug treatment or brain tissue (weighed and minced) were collected. The cell samples were mixed with a homogenization medium and disrupted by ultrasonication, while the brain tissue samples were mixed with pre-cooled homogenization medium and homogenized mechanically to prepare tissue homogenates. The homogenates were then centrifuged at 2,500 r/min for 10 min. The supernatant was then carefully collected. The LPO content in the samples was detected strictly according to the manufacturer's instructions.

Western blot

The cells were harvested to extract the total protein levels. The proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane using the wet method. The membrane was blocked with 5% skim milk for 1 h at room temperature, and incubated with the corresponding primary antibodies Nrf2 (AF0639; Affinity), HO-1 (27282-1-AP; Proteintech, Rosemont, IL, USA), GCLM (DF7268; Affinity) SLC7A11 (DF12509; Affinity), GPX4 (DF6701; Affinity), β-actin (81115-1-RR; Proteintech), histone H3 (BF9211; Affinity) overnight at 4°C. After washing with TBST, the membranes were incubated with the HRP-conjugated secondary antibody (7074; CST, Danvers, MA, USA) for 1 h at room temperature. The signal was developed using an ECL reagent, and imaged for analysis using glyceraldehyde 3-phosphate dehydrogenase or β-actin as an internal control for normalization.

Statistical analysis

Data analysis was conducted using SPSS 20.0 (IBM Corp., Armonk, NY, USA), with all values presented as the mean ± SD. One-way analysis of variance with Tukey tests was used to compare the statistics between multiple groups. A Kruskal–Wallis H test was used in cases where the variances were not homogeneous. P-values < 0.05 were considered significant.

RESULTS

CME restored the cell viability and Nrf2 expression levels, but decreased the miR-144 level in OGD/R-induced H19-7 cells

After induction from OGD/R, the H19-7 cells in the OGD/R group exhibited decreased viability. Pretreatment CME restored the H19-7 cell viability, particularly in the CME-M + OGD/R and CME-H + OGD/R groups (Fig. 1A). At the transcriptional level, qPCR results showed an increase in miR-144 mRNA (Fig. 1B) but a decrease in Nrf2 (Fig. 1C) after OGD/R induction, both of which were reversed by the CME pretreatment. Nrf2 expression was detected. Immunofluorescence staining revealed a weakened Nrf2 fluorescence intensity in the OGD/R group, which was enhanced and displayed marked nuclear accumulation after the CME treatment, indicating the activation of Nrf2 signaling (Fig. 1D). Western blot analysis showed that compared to the Control group, OGD/R exposure reduced the protein levels of total Nrf2, cytoplasmic Nrf2, and nuclear Nrf2 significantly in H19-7 cells. In particular, the CME pretreatment effectively reversed these alterations (Fig. 1E-H). Compared to the OGD/R group, the total and nuclear Nrf2 expression increased significantly in the CME-M and CME-H groups, while the cytoplasmic Nrf2 levels decreased significantly in all CME pretreatment groups (Fig. 1E-H).

Fig. 1. CME restored cell viability and Nrf2 expression levels, but decreased the miR-144 levels in OGD/R-induced H19-7 cells. (A) The cell viability was measured using an methylthiazolyldiphenyl-tetrazolium bromide assay. (B, C) The relative levels of miR-144 and Nrf2 expression were determined by quantitative polymerase chain reaction. (D) Representative immunofluorescence images showing Nrf2 subcellular localization and intensity, scale bar, 100 μm (200×), 50 μm (400×). (E) Representative Western blot bands of Nrf2 protein. (F-H) Quantitative analysis of the total Nrf2, cytoplasmic Nrf2, and nuclear Nrf2 protein expression in H19-7 cells. Results were presented as the mean ± SD.

CME, Chrysanthemum morifolium extract; Nrf2, nuclear factor erythroid 2-related factor 2; OGD/R, oxygen-glucose deprivation and reoxygenation; DAPI, 4′,6-diamidino-2-phenylindole.

^&P < 0.05, ^&&P < 0.01 vs. control group; ^*P < 0.05, ^**P < 0.01 vs. OGD/R group.

miR-144 antagonizes the neuroprotective effect of CME by directly targeting Nrf2

Dual-luciferase reporter assays were performed to validate Nrf2 as a direct target of miR-144. The Nrf2 3'UTR fragment containing the predicted miR-144 binding site was cloned into the pmirGLO vector to generate WT (Nrf2-WT) and seed region MUT (Nrf2-MUT) constructs (Fig. 2A). Transfection with miR-144 mimic significantly reduced the luciferase activity in Nrf2-WT-transfected cells compared to the miR-NC control. In contrast, Nrf2-MUT activity remained unaffected, showing that miR-144 directly targets the specific sequence in Nrf2 3'UTR. Building upon the finding that Nrf2 was a direct target of miR-144, the functional relevance of this target in the neuroprotective effects of CME was examined. The protective effects of CME on the cell viability following OGD/R were significantly abrogated by a co-treatment with the miR-144 mimic, suggesting that miR-144 mimic inhibits the cytoprotective effect of CME (Fig. 2B). Importantly, this inhibitory effect was substantially rescued by the concurrent overexpression of Nrf2, suggesting that restoring Nrf2 expression can counteract the detrimental consequences of miR-144. The expression levels of key molecules were measured to confirm the molecular interactions underlying this functional rescue. qPCR analysis confirmed that the CME-treated downregulation of miR-144 (Fig. 2C) and upregulation of Nrf2 (Fig. 2D) were effectively blocked by the miR-144 mimic. This effect was then reversed by the concurrent overexpression of Nrf2. Immunofluorescence staining for Nrf2 provided visual confirmation at the protein level. The enhanced fluorescence intensity and robust nuclear accumulation of Nrf2 promoted by CME were diminished significantly by miR-144 mimic (Fig. 2E). Crucially, this blockade was overcome when Nrf2 overexpression was restored, returning the strong nuclear signal of Nrf2. Consistent with the immunofluorescence and qPCR data, the CME treatment increased the total Nrf2 protein expression significantly, which was suppressed by the miR-144 mimic. Importantly, this suppression was effectively reversed by the concurrent overexpression of Nrf2 (Fig. 2F and G). These Western blot results collectively show that miR-144 negatively regulates Nrf2 expression and that CME exerts its neuroprotective effect, at least in part, by modulating the miR-144/Nrf2 axis.

Fig. 2. miR-144 antagonizes the neuroprotective effect of CME by directly targeting Nrf2. (A) Dual-luciferase reporter assay showing the relative luciferase activity in H19-7 cells transfected with the indicated reporter constructs and miR-NC or si miR-144. (B) Cell viability measured by Cell Counting Kit-8 assay in H19-7 cells subjected to OGD/R and treated with CME, miR-144 mimic, or oe-Nrf2 as indicated. (C, D) The relative mRNA expression levels of miR-144 and Nrf2 were determined by quantitative polymerase chain reaction. (E) Representative immunofluorescence images showing the subcellular localization and intensity of Nrf2 under different treatments, Scale bar, 100 μm (200×), 50 μm (400×). (F) Representative Western blot bands of Nrf2 protein. (G) Quantitative analysis of Nrf2 protein expression normalized to β-actin. The results are presented as the mean ± SD.

CME, Chrysanthemum morifolium extract; Nrf2, nuclear factor erythroid 2-related factor 2; OGD/R, oxygen-glucose deprivation and reoxygenation; NC, negative control; WT, wild-type; MUT, mutant; DAPI, 4′,6-diamidino-2-phenylindole.

^**P < 0.01 vs. miR-NC or OGD/R; ^##P < 0.01 vs. CME-H; ⁺⁺P < 0.01 vs. miR-144 mimic.

CME improved the OS and apoptosis of OGD/R-induced H19-7 cells

This study next investigated whether the miR-144/Nrf2 pathway mediates the protective effects of CME against OS and cellular apoptosis induced by OGD/R. Accordingly, the key OS markers were assessed. The intracellular ROS levels were markedly increased after OGD/R induction, as detected by the fluorescent probe and quantitative analysis (Fig. 3A and B). This increase was attenuated by the CME pretreatment. Nevertheless, the antioxidant effects of CME were largely abolished by the miR-144 mimic, which was in turn rescued by concurrent Nrf2 overexpression. Consistent with the ROS results, the CME pretreatment significantly reduced the lipid peroxidation product MDA (Fig. 3C) and restored the depleted levels of the antioxidant GSH (Fig. 3D) and the activity of SOD (Fig. 3E) after OGD/R. In particular, these beneficial effects of CME on the antioxidant system were again reversed by miR-144 mimic and restored by Nrf2 overexpression. The ultimate effects on cell apoptosis were examined. Annexin V/PI flow cytometry showed that the anti-apoptotic effects of CME were compromised by the miR-144 mimic, while Nrf2 overexpression significantly reduced the number of apoptotic cells (Fig. 3F and G). Collectively, these data show that CME alleviates OGD/R-induced OS and apoptosis by modulating the miR-144/Nrf2 pathway.

Fig. 3. CME improved the oxidative stress and apoptosis of OGD/R-treated H19-7 cells. (A) Representative fluorescent images of the intracellular ROS levels detected by 2′,7′-dichlorofluorescein diacetate probe, scale bar, 50 μm. (B) Quantitative analysis of the relative ROS fluorescence intensity. (C-E) Quantitative analysis of the MDA content, GSH level, and SOD activity in different treatment groups (F) Representative flow cytometry plots of Annexin V-FITC/PI staining for apoptosis detection. (G) Quantitative analysis of the apoptotic cell rates. The results are presented as mean ± SD.

CME, Chrysanthemum morifolium extract; OGD/R, oxygen-glucose deprivation and reoxygenation; ROS, reactive oxygen species; MDA, malondialdehyde; GSH, glutathione; SOD, superoxide dismutase; DAPI, 4′,6-diamidino-2-phenylindole.

^**P < 0.01 vs. miR-NC or OGD/R; ^##P < 0.01 vs. CME-H; ⁺⁺P < 0.01 vs. miR-144 mimic.

CME inhibited ferroptosis of OGD/R-induced H19-7 cells

Considering the established role of Nrf2 in regulating ferroptosis, this study next investigated whether CME confers protection by modulating this form of cell death. Lipid peroxidation, a hallmark of ferroptosis, was assessed using BODIPY 581/591 C11 staining. The green/red fluorescence ratio, indicative of lipid peroxidation, was significantly lower in the CME-H + OGD/R group than in the OGD/R group. This reduction was reversed by the miR-144 mimic co-treatment, while subsequent Nrf2 overexpression restored the inhibitory effects of CME (Fig 4A and B). Consistently, the LPO levels measured by biochemical assay kits showed the same pattern. The CME pretreatment significantly decreased the LPO levels compared to the OGD/R group (Fig. 4C), an effect that was abrogated by the miR-144 mimic and rescued by Nrf2 overexpression. Intracellular iron accumulation, another critical feature of ferroptosis, was further examined. The Fe²⁺ assay kit results showed that the CME pretreatment markedly suppressed the OGD/R-induced increase in Fe²⁺ content (Fig. 4D). This finding was corroborated by the FerroOrange staining results, which showed that CME reduced the intracellular iron levels significantly compared to the OGD/R group (Fig. 4E and F). In particular, the ability of CME to alleviate iron overload was compromised by the miR-144 mimic, whereas concurrent Nrf2 overexpression effectively restored this iron-chelating effect, rescuing the cells from iron-dependent damage.

Fig. 4. CME inhibited ferroptosis of OGD/R-induced H19-7 cells. (A) Representative images of BODIPY 581/591 C11 staining for detecting the intracellular lipid peroxidation levels, scale bar: 50 μm. (B) Quantitative analysis of the green/red fluorescence ratio of BODIPY 581/591 C11 staining. (C) Quantitative analysis of intracellular lipid peroxidation levels measured using biochemical assay kits. (D) Quantitative measurement of the intracellular Fe²⁺ levels using a commercial iron assay kit. (E) Representative flow cytometry plots of FerroOrange staining for intracellular Fe²⁺ detection. (F) Quantitative analysis of FerroOrange fluorescence intensity. The results are presented as the mean ± SD.

CME, Chrysanthemum morifolium extract; OGD/R, oxygen-glucose deprivation and reoxygenation; DAPI, 4′,6-diamidino-2-phenylindole.

^**P < 0.01 vs. miR-NC or OGD/R; ^#P < 0.05, ^##P < 0.01 vs. CME-H; ⁺⁺P < 0.01 vs. miR-144 mimic.

CME inhibited ferroptosis of OGD/R-induced H19-7 cells by regulating the miR-144/Nrf2 pathway

Finally, the expression of key proteins in the Nrf2-ferroptosis pathway was examined. Western blot analysis showed that the CME pretreatment upregulated the protein levels of total Nrf2, nuclear Nrf2, and its downstream targets, including the antioxidant enzyme HO-1, the GSH synthesis modulator GCLM, the cystine/glutamate antiporter subunit SLC7A11, and the key ferroptosis inhibitor GPX4 (Fig. 5), accompanied by a concomitant decrease in cytoplasmic Nrf2 protein expression. Importantly, these CME-induced enhancements were largely abolished by the miR-144 mimic. Crucially, Nrf2 overexpression reversed the inhibitory effects of the miR-144 mimic, restoring the expression of these critical ferroptosis-related proteins. Collectively, CME inhibits ferroptosis in OGD/R-induced H19-7 cells by regulating the miR-144/Nrf2 pathway.

Fig. 5. CME inhibited ferroptosis of OGD/R-induced H19-7 cells by regulating the miR-144/Nrf2 pathway. (A) Representative Western blot bands of Nrf2, HO-1, GCLM, SLC7A11, and GPX4. (B-G) Quantitative analysis of Nrf2, HO-1, GCLM, SLC7A11, and GPX4 protein levels normalized to histone H3 or β-actin. The results are presented as the mean ± SD.

CME, Chrysanthemum morifolium extract; OGD/R, oxygen-glucose deprivation and reoxygenation; Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase-1; GCLM, glutamate-cysteine ligase modifier subunit; SLC7A11, solute carrier family 7 member 11; GPX4, glutathione peroxidase 4.

^**P < 0.01 vs. miR-NC or OGD/R; ^##P < 0.01 vs. CME-H; ⁺⁺P < 0.01 vs. miR-144 mimic.

CME exerts neuroprotective effects in MCAO rats

A rat MCAO model was established to validate the neuroprotective effects of CME via the miR-144/Nrf2 pathway in vivo. An evaluation of cerebral infarction by TTC staining revealed extensive white infarct areas in the brains of model rats, which were significantly reduced by the CME treatment. This protective effect was attenuated by agomir-144, a miR-144 agonist, whereas the administration of the Nrf2 agonist BARD notably rescued the infarction area, restoring the protective phenotype (Fig. 6A and B). A histopathological examination by HE staining revealed severe neuronal damage in the ischemic cortex of the MCAO group, characterized by widespread neuronal shrinkage and vacuolization. The CME treatment markedly ameliorated these pathological changes, an effect compromised by agomir-144 but restored with the BARD co-treatment (Fig. 6C). Furthermore, TUNEL staining indicated a significant increase in apoptotic neural cells in the MCAO group. The CME treatment significantly reduced the rate of TUNEL-positive cells. Consistent with previous findings, this anti-apoptotic effect was reversed by agomir-144 and then rescued by BARD (Fig. 6D-E). Collectively, these in vivo results corroborate the cellular findings, showing that CME alleviates cerebral ischemia–reperfusion injury by suppressing miR-144 to activate the Nrf2 pathway.

Fig. 6. CME exerts neuroprotective effects in MCAO rats. (A) Representative TTC-stained brain sections. (B) Quantitative analysis of the cerebral infarction volume. (C) Representative HE-stained images of the ischemic cerebral cortex, scale bar, 100 μm (200×). The black arrows indicate damaged and shrunken neuronal cells. (D) Representative TUNEL-stained images of brain sections, scale bar: 50 μm. (E) Quantitative analysis of TUNEL-positive cells. The results are presented as the mean ± SD.

CME, Chrysanthemum morifolium extract; MCAO, middle cerebral artery occlusion; TTC, 2,3,5-triphenyltetrazolium chloride; HE, hematoxylin-eosin; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling; DAPI, 4′,6-diamidino-2-phenylindole; BARD, bardoxolone.

^**P < 0.01 vs. MCAO group; ^##P < 0.01 vs. CME + MCAO group; ⁺P < 0.05, ⁺⁺P < 0.01 vs. CME + MCAO + agomir-144 group.

CME suppressed OS and ferroptosis of MCAO rats by regulating the miR-144/Nrf2 pathway

The miR-144/Nrf2 pathway and its downstream targets were examined comprehensively to elucidate the molecular mechanisms underlying the neuroprotective effects of CME in MCAO rats. qPCR analysis showed that the MCAO group significantly upregulated miR-144 expression at the transcriptional level (Fig. 7A) and downregulated Nrf2 mRNA (Fig. 7B), both of which were effectively reversed by the CME treatment. Immunohistochemical staining further confirmed the finding, showing significantly higher Nrf2 protein expression in the CME-treated group than in the MCAO group (Fig. 7C and D). This study next assessed the OS parameters and lipid peroxidation in brain tissues. The CME treatment significantly attenuated the MCAO-induced elevation in MDA content (Fig. 7E), restored the depleted GSH levels (Fig. 7F), enhanced the SOD activity (Fig. 7G), and reduced the LPO levels (Fig. 7H). These beneficial effects were consistent with the in vitro findings and were consistently counteracted by agomir-144, whereas co-treatment with BARD effectively reversed the alterations induced by agomir-144.

Fig. 7. CME suppressed oxidative stress and ferroptosis of MCAO rats by regulating the miR-144/Nrf2 pathway. (A, B) The relative mRNA expression levels of miR-144 and Nrf2 in brain tissue were determined by quantitative polymerase chain reaction. (C) Representative immunohistochemical images of Nrf2 in brain sections, Scar bar, 100 μm (200×), 50 μm (400×). (D) Quantitative analysis of Nrf2 expression. (E-G) Quantitative analysis of the MDA content, GSH level, and SOD activity in brain tissues. (H) Quantitative analysis of lipid peroxidation levels in brain tissue measured using biochemical assay kits. (I) Representative Western blot bands of Nrf2, HO-1, GCLM, SLC7A11, and GPX4. (J-P) Quantitative analysis of Nrf2, HO-1, GCLM, SLC7A11, and GPX4 protein. The results are presented as the mean ± SD.

CME, Chrysanthemum morifolium extract; MCAO, middle cerebral artery occlusion; Nrf2, nuclear factor erythroid 2-related factor 2; MDA, malondialdehyde; GSH, glutathione; SOD, superoxide dismutase; HO-1, heme oxygenase-1; GCLM, glutamate-cysteine ligase modifier subunit; SLC7A11, solute carrier family 7 member 11; GPX4, glutathione peroxidase 4; BARD, bardoxolone.

^*P < 0.05, ^**P < 0.01 vs. MCAO group; ^##P < 0.01 vs. CME + MCAO group; ⁺P < 0.05, ⁺⁺P < 0.01 vs. CME + MCAO + agomir-144 group.

Furthermore, the protein expression of key ferroptosis-related regulators downstream of Nrf2 was analyzed to establish the connection between the observed neuroprotection and ferroptosis inhibition in vivo. Western blot analysis of brain tissues showed that CME treatment significantly upregulated the protein expression of total Nrf2, nuclear Nrf2, and its downstream targets critical for ferroptosis defense, including HO-1, GCLM, SLC7A11, and GPX4 (Fig. 7I-P), accompanied by a concomitant decrease in cytoplasmic Nrf2 protein expression. This upregulation was consistent with the reduced iron levels observed in the cellular models and confirms the activation of the coherent anti-ferroptosis program. Importantly, these CME-induced enhancements in the ferroptosis defense system were largely abolished by agomir-144. Crucially, a co-treatment with BARD effectively restored the expression of these protective proteins, rescuing the ferroptosis.

DISCUSSION

CIRI is a serious brain disease that causes disability and mortality, which severely threatens the health of patients [23]. CIRI arises from a temporary interruption in the blood supply to the brain, followed by restoration of the blood supply and reoxygenation, whereby reperfusion causes neuronal damage [24]. Unfortunately, the therapeutic options for CIRI are limited. Thus, novel and effective therapies are urgently needed. This study found that CME could prevent OS in CIRI animal and cell models, and the underlying mechanisms may involve the miR-144/Nrf2 pathway.

CME is derived from the purple chrysanthemum flower and contains high levels of chlorogenic acid and luteolin [25]. Recent studies have suggested that CM or CME participates in ischemic reperfusion disorders. For example, CM has cardioprotective functions in heart ischemia reperfusion [26]. In addition, the total flavones from CM can prevent CIRI by inhibiting OS and mitochondrial swelling [16]. In this study, a CME pretreatment enhanced cell viability and inhibited apoptosis in H19-7 cells subjected to OGD/R. In CIRI rat models, the CME pretreatment reduced the cerebral infarct volume, alleviated cerebral tissue damage, and attenuated cerebral apoptosis, indicating that CME was effective in preventing CIRI.

OS is closely linked to the development of CIRI [27]. Several studies have reported that some preparations with antioxidant properties can protect against CIRI [28,29]. In addition, a clinical study confirmed that markers of OS in urine can foresee stroke, myocardial infarction, and cardiovascular death rate, suggesting that an imbalanced redox status is strongly involved in CIRI development [30]. Thus, suppressing OS could be a promising strategy to mitigate CIRI. CM has been reported to alleviate many diseases by suppressing OS, such as liver injury [31] and lung injury [32]. In this study, OS damage was observed in OGD/R-stimulated H19-7 cells and CIRI rat models, as evidenced by the increased ROS production and the MDA and LPO levels, alongside decreased SOD and GSH levels. Nevertheless, a pretreatment with CME could reverse these situations, suggesting that CME may prevent CIRI by inhibiting OS.

Accumulating evidence has recently positioned ferroptosis, an iron-dependent form of regulated cell death characterized by lipid peroxidation, as a pivotal event in CIRI [33]. The connection between OS and ferroptosis is intimate, and lipid peroxide accumulation is a hallmark of both processes [34]. The present study bridges these 2 key pathological events by showing that the antioxidant effects of CME are coupled with robust anti-ferroptotic activity. In cellular models, the CME pretreatment significantly suppressed OGD/R-induced intracellular lipid peroxidation levels and Fe²⁺ accumulation. They were the fundamental driver of ferroptosis. This result is consistent with Zhang et al. [29], who reported that neutral polysaccharide from Gastrodia elata inhibits intracellular Fe²⁺ accumulation through the Nrf2/HO-1 signaling pathway to alleviate CIRI.

As mentioned previously, the level of the Nrf2 protein is remarkably higher than its mRNA, suggesting that the elevated Nrf2 protein level is modulated by miRNAs during translation [35]. Some miRNAs, such as miR-153 [36] and miR-144 [37], help regulate Nrf2. Moreover, Nrf2 plays a crucial role in controlling OS. Furthermore, Nrf2 is a well-established master regulator of ferroptosis, transcriptionally activating a comprehensive defense program against lipid peroxidation and iron toxicity [38]. Under normal conditions, Nrf2 is combined with cytosolic Keap1. On the other hand, when the ROS level within the cell was high enough to modify the reactive thiol groups of Keap1, Nrf2 dissociates from Keap1, translocates to the nucleus, and activates the transcription of downstream antioxidant genes [39]. These results showed that in the cellular and animal models of CIRI, CME promoted the nuclear translocation of Nrf2, significantly increasing its nuclear levels, and upregulated key ferroptosis-related proteins downstream of Nrf2, including HO-1, GCLM, SLC7A11, and GPX4. This coordinated upregulation, which was abolished by miR-144 agonism and rescued by Nrf2 activation, provides a mechanistic basis for the observed reduction in ferroptotic cell death. Chen et al. [40] reported that Procyanidins alleviate CIRI by activating the Nrf2/HO-1 pathway and inhibiting ferroptosis, as evidenced by the reduced Fe²⁺ levels and upregulated GPX4 and SLC7A11 expression. Chu et al. [41] reported that Ginsenoside Rg1 can alleviate OS after CIRI by suppressing the miR-144 activity and facilitating Nrf2/ARE signaling. Moreover, scholars have noted that CM plays a protective role against oxidative damage in cells by stimulating the Nrf2/HO-1 pathway [15]. The present study found that miR-144 levels directly targeted Nrf2, and the miR-144 level was increased while Nrf2 mRNA expression was decreased after the H19-7 cells were stimulated with OGD/R. CME pretreatment reversed miR-144 level and Nrf2 mRNA expression in CIRI models. In particular, in CIRI cell models, the miR-144 mimics counteracted the effects of CME on promoting the viability, inhibiting apoptosis, and reducing OS. On the other hand, further Nrf2 overexpression counteracted the effects of the miR-144 mimics. Similar phenomena were also observed in the CIRI animal models. These findings showed that CME may prevent OS in CIRI by modulating the miR-144/Nrf2 pathway.

This study had several limitations. First, only a single cell type (H19-7 cells) was used, which may limit the generalizability of these findings. Hence, further validation in other neuronal cell lines or primary neurons is warranted. Second, the specific bioactive components in CME responsible for its protective effects against CIRI remain to be identified, and future studies combining chromatographic separation with activity-guided assays are needed to characterize its primary active constituents. Third, although BARD is used widely as an Nrf2 agonist, its potential off-target effects cannot be completely excluded, and the absence of a BARD-only control group (MCAO + BARD) prevents an independent evaluation of its therapeutic effects or potential interactions with CME. In addition, the precise molecular mechanism by which CME regulates miR-144 expression (transcriptional repression or accelerated degradation) remains to be investigated. Future studies will address these important questions.

In summary, this study showed that CME has neuroprotective effects against CIRI by mitigating OS and suppressing ferroptosis through the miR-144/Nrf2 pathway. These findings show that CME downregulates miR-144, relieving its translational repression of Nrf2. The subsequent activation of Nrf2 signaling enhances the expression of key antioxidant and anti-ferroptotic proteins, including HO-1, GCLM, SLC7A11, and GPX4, ultimately reducing neuronal damage and improving the functional recovery. These results revealed a novel mechanism by which CME alleviates CIRI and highlighted the miR-144/Nrf2 pathway as a potential therapeutic target for IS. Future studies should validate these findings in diverse cell models and explore the translational potential of CME in clinical settings.