PRP-Derived Exosomes Promote Cartilage Repair by Suppressing Oxidative Stress and Inflammatory Signaling in Chondrocytes: An In Vitro and Ex Vivo Study

Abstract

Osteoarthritis (OA) is a degenerative musculoskeletal condition characterized by progressive cartilage degradation accompanied by joint inflammation, for which current treatments offer only symptomatic relief without halting progression. This study compared the regenerative and anti-inflammatory properties of platelet-rich plasma (PRP) and its exosome-enriched derivative (PRP-Exos) on human chondrocytes and cartilage explants under IL-1β stimulated inflammatory conditions. PRP-derived exosomes (PRP-Exos) were extracted using an aqueous two-phase separation method and subsequently evaluated for their morphological characteristics and particle size distribution by transmission electron microscopy and nanoparticle tracking analysis. The findings revealed that treatment with PRP-Exos produced greater improvements in chondrocyte proliferation, migratory capacity, and extracellular matrix synthesis compared with PRP. Furthermore, PRP-Exos more effectively suppressed regulation of inflammatory cytokines and cartilage-degrading enzymes, including MMP-3 and MMP-13, through modulation of the Wnt5a, NF-κB, and MAPK signaling pathways. Ex vivo analysis confirmed that PRP-Exos treatment led to superior cartilage structural maintenance and increased proteoglycan content in chondral defects. These findings conclude that PRP derived exosomes possess superior regenerative properties and improved tissue penetration over conventional PRP, positioning them as promising cell free, next generation therapeutics for OA.

1. Introduction

Osteoarthritis (OA) is a chronic musculoskeletal condition characterized by the progressive loss and structural deterioration of articular cartilage, including persistent pain, and functional disability, presenting substantial clinical and socioeconomic burdens worldwide. − Conventional therapeutic strategies primarily focus on symptom management, including analgesics, anti-inflammatory medications, and, in advanced cases, surgical intervention. However, these approaches do not adequately target the underlying cartilage degeneration or the sustained inflammatory processes that contribute to irreversible joint destruction. The development of regenerative strategies that can effectively suppress disease progression while facilitating the restoration of damaged joint tissues remains a critical therapeutic priority. Platelet-rich plasma (PRP) is an autologous blood-derived preparation containing a concentrated population of platelets within a plasma matrix, has emerged as a promising biologic intervention derived directly from a patient’s own blood. The therapeutic rationale lies in the fact that platelets act as a rich source of bioactive growth factors and cytokines, which play essential roles in orchestrating tissue repair and controlling inflammatory processes. Upon activation, PRP contains a variety of bioactive mediators, including platelet-derived growth factor (PDGF), transforming growth factor-β (TGF-β), and hepatocyte growth factor (HGF), which collectively support the healing of injured tissues. Initial clinical and preclinical studies in orthopedics and sports medicine demonstrated that PRP can enhance the repair of tendons, ligaments, and chronic soft tissue injuries, which led to growing interest in its use for cartilage regeneration.

As PRP therapy gained attention, clinical trials in OA reported reduced pain, improved joint function, and, in select cases, delayed progression of cartilage degeneration following intraarticular administration. Patients frequently noted decreased stiffness and enhanced mobility, with individuals who were younger or at earlier stages of OA demonstrating the greatest benefit. These promising outcomes positioned PRP as a safe and minimally invasive alternative for patients seeking to postpone or avoid joint replacement surgery. Nonetheless, questions remain regarding variability in patient responses, durability of clinical outcomes, and the precise mechanisms underlying PRP’s therapeutic effects. Recent advancements in cell and molecular biology have revealed greater complexity in PRP mediated signaling. Platelets not only secrete soluble factors but also release nanosized extracellular vesicles known as exosomes. These vesicles function as natural delivery systems that protectively encapsulate growth factors, cytokines, and regulatory RNAs within a lipid bilayer and transport them to target cells with high specificity. This discovery provided the foundation for a more refined therapeutic strategy: PRP derived exosomes (PRP-Exos). PRP-Exos rapidly gained scientific interest because, unlike the heterogeneous mixture of proteins and cells in PRP, exosomes represent a cell free modality with targeted biomolecular cargo delivery. In preclinical studies, PRP-Exos have promoted chondrocyte proliferation, reduced apoptosis, and enhanced cell migration, which are central processes in cartilage regeneration. They have additionally demonstrated potent immunomodulatory effects, including suppression of pro-inflammatory mediators, including interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α), while promoting the production of anti-inflammatory factors such as interleukin-10 (IL-10) and lipoxin A4 (LXA4). , Importantly, PRP-Exos promote M2 macrophage polarization, contributing to tissue regeneration and the attenuation of inflammatory responses.

Mechanistically, PRP-Exos may influence the Wnt/β-catenin signaling pathway, a central regulator of chondrocyte function and cartilage homeostasis. Through modulation of this pathway, PRP-Exos support chondrocyte survival and proliferation while inhibiting extracellular matrix degradation, thereby counteracting the catabolic processes that contribute to OA progression. In animal models, PRP-Exos outperformed activated PRP in preserving cartilage integrity, improving joint function, and reducing histological indicators of OA severity. These findings suggest that exosomes may offer the regenerative benefits of PRP with greater specificity and biological efficiency. Although clinical translation of PRP-Exos remains in early development, their advantages as therapeutic agents are compelling. As cell free biologics, exosomes have a lower risk of immune rejection or tumorigenicity, and their nanoscale dimensions enable enhanced tissue penetration and controlled delivery of therapeutic cargo. Furthermore, exosomes can be engineered to carry customized molecular components, presenting a promising avenue for personalized interventions in OA and other degenerative disorders.

Given these complexities, precise regulation of Wnt/β-catenin, NF-κB, and MAPK signaling is emerging as a key therapeutic strategy in OA. However, the precise mechanisms by which PRP-Exos influence these signaling pathways remain to be fully elucidated. Accordingly, in the present study, we compared the biological effects of PRP-Exos and PRP in In Vitro and Ex Vivo OA models and specifically investigated whether PRP-Exos mitigate OA related pathology by influencing these signaling networks. By elucidating these mechanisms, this work aims to support the advancement of targeted regenerative therapies that address the fundamental molecular drivers of osteoarthritis.

2. Materials and Methods

2.1. Experimental Reagents and Antibodies

Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), and penicillin–streptomycin solution (5000 U/mL) were obtained from Gibco (Life Technologies, Thermo Fisher Scientific). Recombinant human interleukin-1β (IL-1β) was purchased from R&D Systems (Minneapolis, MN) and reconstituted in phosphate-buffered saline (PBS) containing 0.5% bovine serum albumin (BSA). Protein concentrations were determined using a bicinchoninic acid (BCA) assay kit purchased from Pierce (Thermo Scientific). Primary antibodies against type II collagen (COL2), transforming growth factor-β (TGF-β), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), aggrecan (ACAN), WNT5a, and cyclooxygenase-2 (COX-2) were obtained from Abcam (Boston, MA). Antibodies directed against matrix metalloproteinase-3 (MMP-3) and matrix metalloproteinase-13 (MMP-13) were purchased from Bioss. Antibodies recognizing p65, phosphorylated p65 (p-p65), ERK, phosphorylated ERK (p-ERK), p38, phosphorylated p38 (p-p38), JNK, phosphorylated JNK (p-JNK), CD63, and CD81 were obtained from Cell Signaling Technology (Danvers, MA). The ALIX antibody was purchased from Santa Cruz Biotechnology (Dallas, TX). HRP-conjugated goat antirabbit IgG (H+L) and antimouse IgG (H+L) secondary antibodies were obtained from Novex Life Technologies (Thermo Fisher Scientific), while goat antimouse IgG (ZyMax) was purchased from Thermo Fisher Scientific. The chemiluminescent detection reagent was obtained from Amersham Biosciences (U.K.).

2.2. Source of Chondrocytes

Primary human articular chondrocytes were obtained from ScienCell Research Laboratories (Catalog No. 4650). The cells were maintained in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin–streptomycin and incubated at 37 °C under humidified conditions with 5% CO₂. Once cells reached approximately 80% confluence, they were subcultured using standard trypsinization procedures. All experiments were performed using cells within passages 3–5. Donor specific information was not provided by the manufacturer; investigators requiring additional donor characterization or inclusion criteria may contact ScienCell directly. ,

2.3. PRP Preparation and PRP-Exos Isolation

Whole blood samples were collected from human donors at Chonnam National University Bitgoeul Hospital prior to surgery using EDTA coated collection tubes. PRP was prepared from 10 mL of whole blood using a two-step centrifugation procedure. Briefly, the blood was centrifuged at 2000g for 5 min to separate the plasma layer from erythrocytes and leukocytes. The recovered plasma was carefully transferred into a new tube and centrifuged again at 2000g for 10 min. Following the second centrifugation, the supernatant was removed, and the resulting platelet-rich pellet was gently resuspended in the remaining plasma, producing approximately 1 mL of PRP. PRP used in this study was employed in its whole, nonactivated form. No activation with calcium chloride or thrombin was performed prior to treatment, as the objective was to compare the biological effects of intact PRP with PRP-Exos under identical experimental conditions. PRP was prepared from peripheral whole blood collected from 2–3 healthy adult donors (28–35 years of age). All donors were free from known inflammatory or musculoskeletal disorders and had not received medications known to affect platelet function prior to blood collection. The collected blood was processed immediately for PRP preparation as described above. PRP-derived exosomes (PRP-Exos) were obtained using an aqueous two-phase system (ATPS) consisting of polyethylene glycol (PEG) and dextran (DEX) in equal volumes. The PRP–ATPS mixture was kept at 4 °C overnight to facilitate phase formation and subsequently centrifuged at 5000g for 5 min. The DEX-rich phase containing the exosome fraction was collected and subjected to repeated washing with the ATPS solution until the interfacial layer became clear and free of visible viscosity. The purified vesicles were then resuspended in PBS, rapidly frozen, and stored at −80 °C before lyophilization. Following freeze-drying, the resulting PRP-Exos preparation was stored at −80 °C until subsequent experiments. ,

2.4. Characterization of PRP-Exos

The morphology of PRP-derived exosomes was evaluated by depositing the vesicles onto 2 nm copper grids, followed by imaging with a JEOL JEM-2100F field-emission transmission electron microscope (FE-TEM) to assess their structural characteristics and integrity. Particle size distribution and concentration were determined using nanoparticle tracking analysis (NTA). Exosome-associated proteins were further examined by Western blotting, with CD63, CD81, and ALIX used as characteristic markers to confirm the identity of the isolated vesicles.

2.5. Cellular Internalization of Exosomes Assessed by PKH67 Fluorescent Labeling

To assess the internalization of PRP-derived exosomes, the vesicles were fluorescently tagged with PKH67 using the PKH67 mini Kit (MINI67, Sigma-Aldrich) in accordance with the manufacturer’s protocol. Briefly, freshly prepared exosome pellets were suspended in 100 μL of Diluent C and incubated with 4 μL of PKH67 dye. The mixture was gently agitated for 30 s and maintained at 37 °C for 2 h to facilitate fluorescent membrane labeling. Subsequently, chondrocytes were exposed to the PKH67-labeled PRP-Exos for 24 h at 37 °C to evaluate cellular uptake. Internalization of exosomes was confirmed by fluorescence microscopy, where labeled vesicles were detected as green punctate signals within the cells.

2.6. DCFDA Assay

Intracellular ROS levels were quantified using a DCFDA-based fluorescence assay. Briefly, cells were plated in suitable culture vessels and exposed to the specified experimental treatments, including IL-1β alone or in combination with PRP or PRP-derived exosomes. Following treatment, the cells were rinsed with PBS and incubated with the DCFDA working solution in the dark at 37 °C, following the manufacturer’s recommended protocol. Following incubation, excess dye was removed, and fluorescence was observed using a fluorescence microscope with appropriate green fluorescence settings. Representative images were captured under identical exposure conditions for all groups, and ROS generation was compared based on DCFDA fluorescence intensity.

2.7. Evaluation of PRP-Exos in an IL-1β-Induced Chondrocyte Inflammation Model In Vitro

Human articular chondrocytes were seeded in 65 mm culture dishes at a density of 5 × 10⁵ cells/dish and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 37 °C in a humidified atmosphere containing 5% CO₂. After 24 h of incubation, the culture medium was replaced with serum-free, exosome-compatible medium containing 10 ng/mL interleukin-1β (IL-1β) to establish an in vitro inflammatory chondrocyte model. This concentration has previously been shown to effectively mimic OA like conditions. Following IL-1β stimulation, cells were treated with PRP or PRP derived exosomes at 10 μg/mL, normalized according to total protein content. Exosome treatment was initiated 24 h after IL-1β exposure to model post inflammatory intervention rather than prophylactic effects. After a subsequent 24 hour incubation period, total RNA was isolated using TRIzol reagent. Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer containing 0.5% sodium deoxycholate and 1% NP-40, supplemented with freshly added protease and phosphatase inhibitors. The resulting lysates were collected and used for subsequent protein analyses.

2.8. Cellular Cytotoxicity Using CCK-8 Assay

Cell viability was determined using a Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Japan). Human articular chondrocytes were seeded in 96-well plates at 1 × 10⁴ cells/well and cultured for 24 h. Cells were then treated with PRP or PRP-derived exosomes (PRP-Exos) at concentrations of 0.1–100 μg/mL, calculated according to total protein content, and incubated for a further 24 h. Subsequently, 10 μL of CCK-8 solution was added to each well and incubated for 2 h at room temperature. The absorbance was measured at 450 nm using a Synergy HTX multimode microplate reader (Agilent Technologies). Cell viability was assessed based on the measured metabolic activity.

2.9. PCR

Total RNA was isolated from cultured cells, and 0.5 μg of RNA was used for first-strand cDNA synthesis. Reverse transcription was carried out in a 20 μL reaction containing 200 U of M-MLV reverse transcriptase, 0.25 mM dithiothreitol (DTT), and 250 μM each of dATP, dCTP, dGTP, and dTTP. The reaction was initiated by incubation at room temperature for 10 min, followed by 12 cycles of 25 °C for 30 s, 45 °C for 4 min, and 55 °C for 30 s. Reverse transcriptase was inactivated at 95 °C for 5 min, and the reaction mixtures were subsequently maintained at 4 °C using a GeneAmp PCR System 2700 thermal cycler (Applied Biosystems, Foster City, CA). The resulting cDNA was used as the template for conventional PCR amplification with AccuPower GreenStar PCR Premix (Bioneer, Daejeon, Republic of Korea) using a MyGenie 96/384 thermal cycler (Bioneer). The expression of collagen type II (COL-II), cyclooxygenase-2 (COX-2), interleukin-6 (IL-6), matrix metalloproteinase-3 (MMP-3), matrix metalloproteinase-13 (MMP-13), transforming growth factor-β (TGF-β), and aggrecan (ACAN) was examined, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the reference gene. The forward and reverse primer sequences are provided in Table . PCR products were separated by agarose gel electrophoresis and visualized under UV illumination. Relative expression was assessed by comparison of the target gene band intensity with that of GAPDH. Because conventional end-point RT-PCR was used, gene expression was evaluated from the resulting PCR amplicons rather than by quantitative cycle-threshold analysis; therefore, ΔΔCt-based quantification and qPCR primer-efficiency calculations were not applied.

1. Primer Sequences Used in this Study.

Gene	Forward Primer	Reverse Primer
COL-II	5′-TCTGCAACATGGAGACTGGC-3′	5′-GAAGCAGACCGGCCCTATGT-3′
COX-2	5′-TTC AAATGAGATTGTGGGAAA-3′	5′-AGATCATCTCTGCCTGAGTATCTT-3′
IL-6	5′ GGATGCTTCCAATCTGGATTCAATGAG 3′	5′ CGCAGAATGAGATGAGTTGTCATGTCC 3′
MMP-3	5′-GGCAGTTTGCTCAGCCTATC-3′	5′-GTCACCTCCAATCCAAGGAA-3′
MMP-13	5′-GATGAAGACCCCAACCCTAAA-3′	5′- CTGGCCAAAATGATTTCGTTA-3′
TNF-α	5′-AGGCGGTGCTTGTTCCTC-3′	5′-GTTCGAGAAGATGATCTGACTGCC-3′
TGF-β	5′-CCCAGCATCTGCAAAGCTC-3′	5′-GTCAATGTACAGCTGCCGCA-3′
ACAN	5′-ACGAGTGGCAGCGGTGAAT-3′	5′-GCCCTTCTCCTGCCTCTTG-3′
GAPDH	5′-ACCACAGTCCATGCCATCAC-3′	5′-TCCACCACCCTGTTGCTGTA-3′

2.10. Whole Cell Lysate Preparation and Western Blot Analysis

Following treatment, cells were collected and lysed in radioimmunoprecipitation assay (RIPA) buffer containing protease and phosphatase inhibitor cocktails. Total protein was quantified using a bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, Waltham, MA) following the manufacturer’s protocol. Briefly, protein samples and standards were dispensed into a 96-well plate and combined with the BCA working reagent, followed by incubation at 37 °C for 30 min. Absorbance was recorded at 562 nm, and protein concentrations were determined from the standard curve. For immunoblotting, 8 μg of protein from each sample was denatured at 95 °C for 5 min, resolved by SDS–polyacrylamide gel electrophoresis (SDS-PAGE), and electrotransferred to poly­(vinylidene fluoride) (PVDF) membranes. The membranes were blocked with 5% nonfat dry milk (Difco, Becton Dickinson, NJ) for 90 min at 4 °C and subsequently incubated overnight at 4 °C with primary antibodies against COX-2, type II collagen (COL-II), IL-6, ACAN, TGF-β, MMP-3, MMP-13, p65, phosphorylated p65 (p-p65), ERK, phosphorylated ERK (p-ERK), p38, phosphorylated p38 (p-p38), JNK, phosphorylated JNK (p-JNK), WNT5a, and GAPDH at a 1:1000 dilution. After washing with Tris-buffered saline containing 0.1% Tween 20 (TBST), the membranes were incubated with HRP-conjugated secondary antibodies (1:5000) for 2 h at 4 °C. Immunoreactive bands were detected using enhanced chemiluminescence (ECL), and band intensities were quantified by densitometric analysis using ImageJ software (v1.54j; National Institutes of Health, Bethesda, MD).

2.11. Scratch Wound Assay

Chondrocyte motility was evaluated using a scratch wound-healing assay. Cells were seeded in 6-well plates and maintained until a uniform confluent monolayer was established. A straight wound approximately 1 mm wide was generated across the cell monolayer using a sterile 200 μL pipet tip. The wells were subsequently washed twice with phosphate-buffered saline (PBS) to remove detached cells and cellular debris. Control wells received fresh culture medium, whereas experimental wells were treated with 10 μg/mL of PRP or PRP derived exosomes (PRP-Exos). Cells were maintained at 37 °C in a humidified atmosphere containing 5% CO₂. Wound areas were monitored by phase-contrast microscopy at 0, 24, 36, and 48 h following IL-1β-induced injury, and images were acquired using a microscope coupled to a digital imaging system. Wound closure was quantified at each time point by analyzing the remaining wound area with ImageJ software

2.12. Transwell Assay

Chondrocyte migratory activity was examined using a Transwell chamber assay. Cells were exposed to IL-1β for 24 h and subsequently adjusted to 1 × 10⁴ cells/mL in suspension. The cell suspension was then loaded into the upper compartments of Transwell inserts (Millicell, Sigma-Aldrich) placed in 6-well plates. The lower compartments contained 1 mL of DMEM supplemented with 10% FBS and either PRP or PRP-derived exosomes (PRP-Exos) at 10 μg/mL. PRP and PRP-Exos were used as chemoattractant stimuli to evaluate chondrocyte migration toward the lower chamber. The Transwell inserts were maintained at 37 °C in a humidified incubator containing 5% CO₂ for 24 h to allow cell migration. Following incubation, cells remaining on the upper surface of the membrane were carefully removed using a cotton swab. The inserts were washed twice with PBS, fixed with 70% ethanol, and subsequently stained with 0.2% crystal violet for 30 min at room temperature. Following thorough rinsing with distilled water, membranes were air-dried. Migrated cells adhering to the lower membrane surface were visualized under a brightfield confocal microscope, and migration was quantified by manual counting.

2.13. Immunofluorescence

Chondrocytes were seeded on sterile glass coverslips and cultured for 24 h prior to staining. Cells were fixed in 4% paraformaldehyde prepared in PBS for 15 min at room temperature and subsequently permeabilized with 0.1% Triton X-100 for 15 min. Nonspecific binding was reduced by blocking the cells with 1% BSA in 0.1% Triton X-100 for 1 h. The samples were then incubated overnight at 4 °C with primary antibodies against MMP-13 and type II collagen (COL-II), each diluted 1:200. Following incubation, the coverslips were washed with PBS and treated with the appropriate secondary antibodies at a 1:400 dilution. After further washing, F-actin was labeled with phalloidin for 15 min, and cell nuclei were counterstained with DAPI. The coverslips were mounted using an antifade mounting medium, and fluorescence images were acquired using a Lionheart FX automated fluorescence microscope (BioTek, Agilent Technologies, Republic of Korea).

2.14. Establishment of an Ex Vivo Osteoarthritis Model

Human articular cartilage specimens collected during knee surgical procedures were utilized to develop an ex vivo model of osteoarthritis (OA). The explants, comprising articular cartilage with subchondral bone, were carefully dissected and rinsed with PBS containing 1% penicillin-streptomycin. Using a surgical blade, the cartilage was trimmed into uniform discs measuring approximately 8–10 mm in diameter. A full thickness chondral defect approximately 3 mm deep was created at the center of each explant using a biopsy punch. The cartilage explants were maintained for 3 days in DMEM/F12 supplemented with 1% penicillin–streptomycin at 37 °C under a humidified atmosphere containing 5% CO₂ to allow tissue acclimatization and preserve viability before subsequent experimentation. After confirming sterility, explants were assigned to three groups: (1) untreated OA control, (2) OA defect treated with PRP, and (3) OA defect treated with PRP-Exos. A concentration of 100 μg/mL PRP-Exos was used for the ex vivo cartilage explant experiments to compensate for the limited diffusion and penetration of exosomes within the dense three-dimensional extracellular matrix of cartilage. In contrast, 10 μg/mL was used for the in vitro monolayer culture, where exosomes have direct access to the cells. The ex vivo concentration was selected based on published literature and the reduced transport of extracellular vesicles in cartilage tissue.

2.15. Collection and Preparation of Cartilage Tissue

Human cartilage specimens were immersed in 4% paraformaldehyde for 24 h and subsequently decalcified in nitric acid for 2–3 days. The tissues were then processed through a graded ethanol series for dehydration, embedded in paraffin, and sectioned sagittally at 5 μm thickness. Tissue sections were stained with hematoxylin and eosin (H&E) for evaluation of general tissue architecture, Safranin O–fast green for assessment of proteoglycan abundance, and picrosirius red (Abcam, ab150681) for visualization of collagen organization and distribution. Staining was performed according to standard protocols, with Safranin O intensity reflecting proteoglycan levels and picrosirius red indicating collagen fiber organization.

2.16. Statistical Analysis

Statistical analyses were conducted using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA). Data were analyzed by one-way or two-way analysis of variance (ANOVA), as appropriate, followed by Tukey’s multiple-comparison test for normally distributed data. Results are presented as the mean ± standard deviation (SD) from three independent experiments (n = 3). A value of p < 0.05 was considered statistically significant. Statistical significance is indicated as follows: ns, not significant; * p < 0.05; ** p < 0.01; *** p < 0.001; and **** p < 0.0001, unless otherwise specified.

3. Results

3.1. Isolation and Characterization of Exosomes from PRP

Exosomes derived from platelet-rich plasma (PRP-Exos) were isolated using a sequential multistep protocol beginning with the collection of whole blood, sequential centrifugation, and polymer based separation. As illustrated in Figure A, 10 mL of whole blood was first collected and centrifuged to separate plasma containing the buffy coat, blood counts are stated in Supporting Table S1. Approximately 1 mL of plasma was subsequently obtained and subjected to additional centrifugation to yield the final PRP fraction. Exosome isolation was performed using the ATPS method, as shown in Figure B. In this process, sample components were partitioned into distinct PEG (upper) and dextran (lower) phases, with exosomes effectively concentrated within the dextran layer. The exosome rich dextran phase was then collected and freeze-dried to obtain purified PRP-derived exosomes. Comprehensive characterization of the isolated PRP-Exos was performed using multiple analytical techniques. NTA revealed a predominant size distribution of 128.4 ± 10 nm (Figure C, left panel), while microscopic visualization confirmed the presence of abundant exosomal particles (Figure C, right panel) and the detailed information stated in Supporting Table S2. Transmission electron microscopy (TEM) demonstrated the characteristic spherical morphology of the vesicles Figure D. Western blot analysis further validated the exosomal identity of the isolates through the detection of canonical markers CD63, CD81, and ALIX in PRP-Exos samples, compared with PRP Figure E. Additionally, immunofluorescence staining using DAPI, PKH67, and phalloidin confirmed the cellular internalization of PRP-Exos by chondrocytes, as indicated by distinct intracellular fluorescent signals. These results collectively verify the successful isolation, structural integrity, and uptake capability of PRP-derived exosomes, supporting their functional relevance in chondrocyte modulation and cartilage repair Figure F. Figure G. shows IL-1β markedly increased IL-1β treatment markedly increased DCFDA fluorescence relative to the untreated control, indicating enhanced intracellular ROS accumulation. In contrast, treatment with PRP, with a more pronounced effect observed for PRP-derived exosomes, attenuated the IL-1β-induced increase in green fluorescence, suggesting that these treatments exerted a protective effect against oxidative stress.

1.

Isolation, characterization, and biological evaluation of PRP-Exos. (A) Schematic illustration of the platelet rich plasma (PRP) preparation procedure used for exosome isolation. (B) Workflow of the ATPS employed for exosome isolation, consisting of polyethylene glycol (PEG; Polymer 1) and dextran (DEX; Polymer 2), enabling efficient separation of PRP-derived exosomes. (C) Physicochemical characterization of PRP-Exos. Left: Nanoparticle tracking analysis (NTA) illustrating the size distribution and particle concentration of the isolated exosomes. Right: Representative microscopic image of purified PRP-Exos. (D) Transmission electron microscopy (TEM) demonstrating the characteristic spherical/cup shaped morphology of PRP-Exos. Scale bar = 100 nm. (E) Western blot analysis demonstrating the presence of the exosomal marker proteins CD63, CD81, and ALIX in PRP-derived exosome (PRP-Exos) preparations, with comparatively lower levels observed in whole PRP. GAPDH was used as the loading control. (F) Cellular uptake of PKH67 labeled PRP-Exos by recipient cells visualized by confocal fluorescence microscopy. Cell nuclei were counterstained with DAPI (blue), whereas F-actin was labeled with phalloidin (red) and internalized PRP-Exos were labeled with PKH67 (green). The merged images demonstrate successful uptake and intracellular localization of PRP-Exos. Scale bar = 20 μm. (G) Intracellular ROS levels were evaluated using a DCFDA-based fluorescence assay. Representative fluorescence images illustrate ROS levels in each treatment group, with green fluorescence corresponding to oxidized DCF. Scale bar = 100 μm.

3.2. Cell Cytotoxicity

The cytotoxicity of PRP and PRP-derived exosomes (PRP-Exos) toward human chondrocytes was evaluated using a Cell Counting Kit-8 (CCK-8) assay at concentrations of 0.1, 1, 10, and 100 μg/mL. Cell viability was calculated as a percentage relative to the untreated control, which was assigned a value of 100%. As shown in the left panel of Figure A, treatment with PRP at 0.1–100 μg/mL did not induce significant cytotoxicity in chondrocytes. Cell Viability assessment remained comparable to that of the control group at all tested concentrations, with values consistently near or above 100%. PRP treatment did not produce a concentration-dependent decrease in cell viability, indicating that PRP was well tolerated by human chondrocytes across the tested dose range. Similarly, the right panel of Figure B shows that PRP-Exos at equivalent concentrations did not exert cytotoxic effects, as cell viability values remained comparable to the control condition across all tested doses. These findings confirm that both PRP and PRP-Exos exhibit minimal cytotoxicity toward chondrocytes up to 100 μg/mL. On the basis of these results, 10 μg/mL was selected as the reference concentration for subsequent In Vitro experiments. Collectively, these observations indicate that both PRP and its exosomal derivatives are safe for In Vitro application and suitable for downstream functional and mechanistic studies.

2.

Cell cytotoxicity of PRP and PRP-derived exosomes (PRP-Exos) on chondrocytes as assessed by CCK-8 assay. Chondrocytes were exposed to increasing concentrations (0.1, 1, 10, and 100 μg/mL) of (A) PRP or (B) PRP-derived exosomes (PRP-Exos) for 24 h. Both PRP and PRP-Exos exhibited minimal cytotoxicity across all tested concentrations, with no significant differences compared to controls. Data are expressed as the mean ± standard deviation (SD) for three independent replicates (n = 3).

3.3. PRP and PRP-Exos Suppress IL-1β-Induced Inflammatory Gene Expression in Chondrocytes

To investigate the anti-inflammatory effects of PRP and PRP-Exos on chondrocytes, following IL-1β stimulation, the expression levels of key inflammatory and catabolic genes were evaluated at the mRNA level. Chondrocytes were exposed to IL-1β (10 ng/mL) for 24 h, either alone or together with PRP or PRP-derived exosomes (PRP-Exos) at 10 μg/mL. The mRNA levels of COX-2, IL-6, TNF-α, MMP-3, and MMP-13 were subsequently evaluated by conventional RT-PCR, with GAPDH serving as the internal control. As shown in Figure , IL-1β stimulation markedly upregulated the expression of all five genes compared with the untreated control group, confirming successful induction of an inflammatory phenotype. Co-treatment with PRP or PRP-Exos significantly reduced IL-1β-induced the transcriptional levels of COX-2, IL-6, TNF-α, MMP-3, and MMP-13. Notably, the suppression of these inflammatory and catabolic mediators was more pronounced in the relative to the PRP-treated group, suggesting an enhanced anti-inflammatory effect of exosome-based treatment. These results indicate that both PRP and PRP-Exos effectively attenuate IL-1β-triggered inflammatory responses and extracellular matrix degradation in chondrocytes, with PRP-Exos demonstrating superior efficacy. This enhanced anti-inflammatory potential underscores the therapeutic promise of PRP-derived exosomes as a cell free intervention for osteoarthritis.

3.

PRP and PRP-derived exosomes (PRP-Exos) suppress IL-1β-induced inflammatory and catabolic gene expression in chondrocytes. (A) Chondrocytes were stimulated with IL-1β (10 ng/mL) for 24 h and subsequently treated with PRP or PRP-derived exosomes (PRP-Exos), each at 10 μg/mL. Conventional RT-PCR analysis demonstrated that both treatments attenuated the IL-1β-induced expression of COX-2, IL-6, TNF-α, MMP-3, and MMP-13, with a greater reduction observed following PRP-Exos treatment. (B) The amplified products were subjected to qualitative analysis. Data are expressed as the mean ± standard deviation (SD) (n = 3). Statistical significance was defined as p < 0.05, *p < 0.01, **p < 0.001, and ***p < 0.0001; ns, not significant, relative to the control group. GAPDH was used as a loading control.

3.4. PRP and PRP-Exos Restore Chondrogenic Gene Expression Following IL-1β Stimulation

To assess the effects of PRP and PRP-Exos on anabolic gene expression in chondrocytes exposed to inflammatory stress, the mRNA levels of transforming growth factor β (TGF-β), aggrecan (ACAN), and collagen type II (COL-2) were analyzed by RT-PCR. Chondrocytes were exposed to IL-1β at a concentration of 10 ng/mL to induce inflammation, with or without cotreatment with PRP (10 μg/mL) or PRP-Exos (10 μg/mL) for 24 h. GAPDH was used as the internal reference control. IL-1β stimulation significantly reduced the expression of TGF-β, ACAN, and COL-2 compared with untreated controls, indicating suppression of anabolic and cartilage matrix–related genes. Treatment with PRP partially reversed this downregulation, whereas PRP-Exos treatment led to a more pronounced restoration of anabolic gene expression, with expression levels approaching those of the untreated control group. These observations indicate that both PRP and PRP-Exos can counteract IL-1β-induced suppression of anabolic genes in chondrocytes, with PRP-Exos demonstrating superior restorative efficacy Figure .

4.

(A) PRP and PRP derived exosomes (PRP-Exos) restore anabolic gene expression in IL-1β-stimulated chondrocytes. RT-PCR analysis of TGF-β, ACAN, and COL-II mRNA expression in chondrocytes stimulated with IL-1β (10 ng/mL) for 24 h and subsequently subjected to the indicated treatments of the inflamed chondrocytes with PRP (10 μg/mL) or PRP-Exos (10 μg/mL). IL-1β significantly reduced anabolic gene expression compared to control (p < 0.01). Both PRP and PRP-Exos reversed this suppression, with PRP-Exos showing a greater effect. (B) The amplified PCR products were subjected to qualitative analysis. Data are expressed as the mean ± standard deviation (SD) (n = 3). Statistical significance was defined as p < 0.05, *p < 0.01, **p < 0.001, and ***p < 0.0001; ns, not significant, compared with the control group. GAPDH was used as a loading control.

3.5. PRP and PRP-Exos Attenuate IL-1β Induced Inflammatory and Catabolic Protein Expression in Chondrocytes

To further elucidate the anti-inflammatory and anticatabolic effects of PRP and PRP-Exos, Western blot analysis was performed to assess the protein expression of key inflammatory mediators (COX-2, IL-6, and TNF-α) and matrix-degrading enzymes (MMP-3 and MMP-13). Chondrocytes were stimulated with IL-1β (10 ng/mL) for 24 h in the absence or presence of PRP (10 μg/mL) or PRP-Exos (10 μg/mL). GAPDH served as the loading control. As illustrated in Figure , exposure to IL-1β substantially upregulated the protein expression of COX-2, IL-6, TNF-α, MMP-3, and MMP-13 compared with the untreated control group, confirming successful induction of an inflammatory and catabolic phenotype. Treatment with PRP or PRP-Exos substantially reduced the IL-1β induced upregulation of these proteins. Notably, PRP-Exos exhibited a more pronounced inhibitory effect than PRP, with protein expression levels approaching those of untreated controls. These findings indicate that both PRP and PRP-Exos effectively mitigate IL-1β-Induced inflammatory and catabolic responses in chondrocytes, with PRP-Exos demonstrating greater suppressive efficacy.

5.

PRP and PRP derived exosomes (PRP-Exos) attenuate IL-1β induced inflammatory and catabolic protein expression in chondrocytes. (A) Western blotting was performed to assess the protein expression of COX-2, IL-6, TNF-α, MMP-3, and MMP-13 in chondrocytes stimulated with IL-1β (10 ng/mL) for 24 h and subsequently subjected to the indicated treatments of the inflamed chondrocytes with PRP (10 μg/mL) or PRP-Exos (10 μg/mL). (B) Followed by quantitative analysis. GAPDH was used as a loading control. Both PRP and PRP-Exos reduced the IL-1β induced upregulation of inflammatory and catabolic proteins, with PRP-Exos showing a more pronounced inhibitory effect. (C) Immunofluorescence staining showing MMP-13 expression with treatment following stimulation with IL-1β (10 ng/mL) alone or together with PRP (10 μg/mL) or PRP-derived exosomes (PRP-Exos; 10 μg/mL) for 24 h. DAPI (blue) for nuclear staining, MMP-13 (green), Phalloidin (red) for actin filaments, and merged image demonstrating the interaction of exosomes with cells. Scale bar: 200 μm. Data are expressed as the mean ± standard deviation (SD) of three independent experiments (n = 3). ns denoting no significant difference, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 relative to the control group. GAPDH was used as a loading control.

3.6. PRP and PRP-Exos Restore Anabolic Altered Protein Expression Following IL-1β Stimulation

To determine the restorative effects of PRP and PRP-Exos on anabolic protein expression in chondrocytes exposed to inflammatory stimuli, The protein level of transforming growth factor-β (TGF-β), aggrecan (ACAN), and collagen type II (COL-2) was assessed by Western blot analysis. As shown in Figure , IL-1β exposure substantially decreased the protein expression of TGF-β, ACAN, and COL-2 compared with the untreated control group, confirming suppression of anabolic signaling under inflammatory conditions. Treatment with PRP partially restored the expression of these proteins, whereas PRP-Exos treatment resulted in a more robust recovery, with protein levels approaching those observed in untreated controls. GAPDH was used as a loading control. These findings indicate that both PRP and PRP-Exos effectively reverse IL-1β induced suppression of anabolic markers, with PRP-Exos demonstrating superior restorative efficacy.

6.

PRP and PRP derived exosomes (PRP-Exos) restore anabolic protein expression in IL-1β-treated chondrocytes. (A) Representative Western blotting data of TGF-β, ACAN, and COL-2 in Chondrocytes, prior stimulation with IL-1β (10 ng/mL) for 24 h, subsequently exposed to the inflamed chondrocytes with PRP (10 μg/mL) or PRP-Exos (10 μg/mL). (B) Followed by quantitative analysis. IL-1β significantly decreased anabolic protein levels compared to control (p < 0.01). Both PRP and PRP-Exos reversed this effect, with PRP-Exos showing a greater restorative impact. (C) Immunofluorescence staining showing COL-II expression with treatment of IL-1β at 10 ng/mL, administered alone or alongside PRP (10 μg/mL) or PRP-Exos (10 μg/mL) for 24 h. DAPI (blue) for nuclear staining, COL-2 (green), Phalloidin (red) for actin filaments, and merged image demonstrating the interaction of exosomes with cells. Scale bar: 200 μm. Data are shown as mean ± standard deviation (n = 3). ns, not significant, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 comparison with the control group. GAPDH was used as a loading control.

3.7. PRP and PRP-Exos Promote Chondrocyte Migration in an In Vitro Wound Closure Assay

To evaluate the impact of PRP and PRP-Exos on chondrocyte migration under inflammatory stress, an In Vitro scratch wound healing assay was performed following IL-1β stimulation. Confluent chondrocyte monolayers were scratched to create a uniform wound and treated with IL-1β at 10 ng/mL, administered alone or alongside PRP at 10 μg/mL or PRP-Exos (10 μg/mL). Cell migration into the Wound closure was assessed by imaging at 0, 24, 36, and 48 h Figure . In the untreated control group, extensive cell migration was observed, with near complete wound closure by 48 h. In contrast, IL-1β treatment markedly inhibited chondrocyte migration, resulting in a persistent wound gap throughout the observation period. Cotreatment with PRP partially restored migratory capacity, as evidenced by increased cell movement into the wound area compared with IL-1β treated cells. Notably, the PRP-Exos group exhibited the most pronounced recovery, with wound closure rates approaching those of the control group by 48 h. These results demonstrate that both PRP and PRP-Exos can counteract IL-1β induced inhibition of chondrocyte migration, with PRP-Exos showing superior efficacy in promoting wound healing and cell motility.

7.

PRP and PRP derived exosomes (PRP-Exos) enhance chondrocyte migration in a scratch wound healing assay under inflammatory conditions. (A) Representative images of chondrocyte monolayers at 0, 24, 36, and 48 h after scratch injury. Chondrocytes were initially stimulated with IL-1β (10 ng/mL) for 24 h, after which the inflamed cells were treated with PRP (10 μg/mL) or PRP-Exos (10 μg/mL). (B) Wound closure percentage was measured at 0, 24, 36, and 48 h. PRP and PRP-Exos both promoted wound closure compared to IL-1β alone, with PRP-Exos showing the greatest enhancement of cell migration. Scale bars: 1000 μm.

3.8. PRP and PRP-Exosomes Modulate MAPK, NF-κB, and WNT5a Signaling Pathways in IL-1β Stimulated Chondrocytes

To investigate the molecular basis of PRP’s effects and PRP-Exos on chondrocytes under inflammatory conditions, the activation status of key intracellular signaling pathways was analyzed by Western blotting, and protein expression levels were quantified. Key signaling cascades, including the MAPK pathways (ERK, p38, JNK) and the NF-κB pathway (p65) are principal mediators of inflammation and cellular stress in chondrocytes, whereas WNT5a plays a pivotal role in maintaining cartilage health, and evidence connects it to the advancement of osteoarthritic degradation through its effects on chondrocyte inflammation and matrix degradation. IL-1β stimulation markedly enhanced the addition of a phosphate group to of ERK, p38, JNK, and p65, as well as increased WNT5a expression, compared with untreated controls Figure . Treatment with PRP or PRP-Exos significantly attenuated the phosphorylation of ERK, p38, JNK, and p65, and reduced WNT5a expression in IL-1β stimulated chondrocytes. Notably, PRP-Exos exerted a more pronounced inhibitory effect than PRP, as reflected by lower phosphorylated to total protein ratios and decreased WNT5a/GAPDH expression levels. These findings indicate that both PRP and PRP-Exos effectively suppress IL-1β stimulation triggers the MAPK, NF-κB, and WNT5a signaling cascades, with PRP-Exos demonstrating superior regulatory efficacy. Furthermore, PRP-Exos may contribute to cartilage regeneration and inflammation resolution, in part, by associated with WNT signaling through the delivery of WNT related proteins, thereby supporting both anabolic and reparative processes in chondrocytes.

8.

(A) Representative Western blot images showing the expression and phosphorylation dynamics of ERK, p38, JNK, p65, and WNT5a in chondrocytes exposed to 10 ng/mL IL-1β for 24 h prior to PRP (10 μg/mL) or PRP-Exos (10 μg/mL). (B) Quantitative analysis of protein expression ratios (pERK/ERK, pp38/p38, pJNK/JNK, pp65/p65, and WNT5a/GAPDH) for each group. presented as mean ± SD ($n = 3$). Statistical significance relative to the control group is indicated as follows: p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns = not significant. IL-1β stimulation increases pathway activation, while PRP and PRP-Exos attenuate these effects, with PRP-Exos showing the strongest inhibition.

3.9. Chondrocyte Migration is Enhanced by PRP and PRP-Exosomes Treatment

The migratory capacity of chondrocytes was further evaluated using a Transwell migration assay to assess the therapeutic potential of PRP and PRP-Exos under inflammatory conditions. Representative microscopic images revealed distinct differences in migration patterns among treatment groups. IL-1β stimulation significantly reduced chondrocyte migration versus the control group, confirming the inhibitory impact of pro-inflammatory mediators on cellular motility. The IL-1β treated group exhibited a marked reduction in migrated cells, indicative of impaired migration under inflammatory stress. Both PRP and PRP-Exos treatments effectively restored and enhanced chondrocyte migration in the presence of IL-1β. Cells in the IL-1β + PRP group displayed a higher number of migrated cells than those in the IL-1β only group, while the IL-1β + PRP-Exos group exhibited the greatest migration capacity among all treatment conditions (Figure ). These results demonstrate that although IL-1β induced inflammation suppresses chondrocyte migration, both PRP and PRP-Exos can reverse this impairment, with PRP-Exos showing superior efficacy in promoting chondrocyte motility and cell migration.

9.

(A) Schematic representation of the experiment for the Chondrocyte migration by Transwell migration assay under different treatment conditions. (B) Chondrocytes were assigned to four experimental conditions: Control, IL-1β, IL-1β + PRP, and IL-1β + PRP-Exos. To induce inflammation, cells were pretreated with 10 ng/mL IL-1β for 24 h before receiving PRP therapeutic intervention. Cell migration was subsequently evaluated by crystal violet staining and microscopic visualization. (C) followed by qualitative analysis. The IL-1β group exhibited reduced chondrocyte migration compared to the control, while both PRP and PRP-Exos treatments restored and enhanced cell migration, with the IL-1β + PRP-Exos group showing the highest number of migrating cells. Scale bars: 200 μm.

3.10. Histological Staining of Ex Vivo Treated Human Cartilage Samples

We assessed the effects of PRP and PRP-Exos on cartilage regeneration using an established Ex Vivo model with biopsy punch–induced chondral defects. Outcomes were evaluated via histological staining: H&E for cellular architecture, Safranin O for proteoglycan content, and Picrosirius Red for collagen organization. H&E staining at days 14 and 28 demonstrated that the chondral defect group exhibited poor structural integrity and irregular surface morphology. The PRP treated group formed a thin, continuous, and transparent reparative layer across the defect, suggesting early matrix deposition and initial integration with host tissuethis feature was especially noticeable at day 14. In the PRP-Exos group, more extensive and uniform restoration of the cartilage surface was apparent, with markedly improved tissue architecture and increased cellularity compared to both other groups. Safranin O staining indicated that proteoglycan (GAG) content was moderately increased in the PRP group relative to the untreated defect, but significantly more intense and evenly distributed in the PRP-Exos group, reflecting enhanced matrix synthesis and retention. Collagen staining correspondingly showed the neo cartilaginous layer integrity following PRP exposure, whereas the PRP-Exos group reached peak levels of collagen matrix deposition at both time points Figure . By day 28, the PRP-Exos group demonstrated the most robust and homogeneous repair tissue, whereas the PRP group maintained the characteristic transparent layer but with less organized and less abundant matrix. Additionally, we assessed non defect group as well to observe the morphological changes in cartilage along with its GAG and collagen content Figure . Collectively, these data suggests that PRP-Exos treatment yielded superior defect filling and structural regeneration coverage, as evidenced by enhanced cellularity, GAG content, and collagen organization, compared to PRP or untreated defects.

10.

Representative histological images of Ex Vivo osteoarthritis (OA) cartilage defect repair at days 14 and 28, stained with H&E, Safranin O (Saf O), and Collagen staining. Groups include untreated chondral defect, defect treated with PRP, and defect treated with PRP-Exos. PRP treatment resulted in a regenerated, transparent neo cartilaginous layer over the defect, whereas PRP-Exos promoted more robust matrix deposition and restoration. Scale bars: 500 μm.

11.

Representative histological images of Ex Vivo osteoarthritis (OA) with no cartilage defect repair at days 0, 14 and 28, stained with (A) H&E (B) Safranin O (Saf O), and (C) Collagen. Groups include treated IL-1β, IL-1β with PRP, and IL-1β with PRP derived exosomes (PRP-Exos). PRP treatment resulted in a cartilage structure preservation, whereas PRP-Exos promoted more robust matrix homeostasis and retention of GAG and Collagen content. Scale bars: 200 μm.

4. Discussion

4.1. Primary Outcomes

Our findings establish that both PRP and PRP-derived extracellular vesicles (PRP-Exos) confer substantial anti-inflammatory and tissue-restorative benefits in IL-1β-exposed human chondrocytes alongside an ex vivo cartilage model. Notably, PRP-Exos markedly downregulated key pro-inflammatory factors (COX-2, IL-6, TNF-α) and matrix-catabolic metalloproteinases MMP-3 and MMP-13, while restoring anabolic markers including TGF-β, ACAN, and COL-2. In addition, PRP-Exos promoted chondrocyte migration in both scratch wound healing and transwell migration assays and improved cartilage matrix preservation in the ex vivo cartilage model. Under the protein normalized experimental conditions used in this study, PRP-Exos consistently demonstrated greater biological activity than conventional PRP (Figure ).

12.

Schematic representation of the proposed mechanism by which PRP-derived exosomes modulate inflammatory and oxidative responses in chondrocytes. Platelet-rich plasma (PRP) contains platelets, leukocytes, soluble bioactive factors, and extracellular vesicles, including exosomes, which may deliver WNT5a and other regulatory molecules to chondrocytes. WNT5a-mediated signaling modulates the IKK/NF-κB and MEK/MAPK pathways, thereby limiting NF-κB activation and downstream p38, ERK, and JNK signaling. This pathway modulation correlates with attenuated oxidative damage and downregulation of key inflammatory drivers, such as MMP-13, IL-6, TNF-α, and COX-2, while promoting an anti-inflammatory and cartilage-associated response. Overall, the proposed mechanism illustrates how PRP-derived exosomes may attenuate inflammatory and oxidative stress signaling and contribute to the preservation of chondrocyte homeostasis.

4.2. Mechanistic Interpretation

Emerging evidence suggests that PRP-Exos mediate their phenotypic actions primarily by transporting and transferring of concentrated bioactive molecules, including biologically active factors, inflammatory mediators, and noncoding RNAs, to recipient cells. , In the present study, Western blot assays confirmed that IL-1β priming markedly elevated phosphate incorporation into MAPK (ERK, p38, and JNK) and NF-κB (p65) signaling proteins, whereas treatment with PRP, particularly PRP-Exos, reduced the phosphorylation levels of these proteins. In addition, PRP-Exos reduced WNT5a protein expression, suggesting regulation of WNT5a associated noncanonical Wnt signaling. However, β-catenin and other downstream components of the canonical Wnt pathway were not evaluated. Therefore, the involvement of canonical Wnt/β-catenin signaling cannot be concluded from the present study, although previous studies have reported interactions between WNT5a-associated signaling and cartilage homeostasis. These findings indicate an association between PRP-Exos treatment and reduced activation of inflammatory signaling pathways under IL-1β stimulation.

4.3. Comparison with Previous Studies

The current results corroborate previous reports demonstrating the regenerative and anti-inflammatory properties of PRP derived exosomes in osteoarthritis. PRP-Exos have been reported to reduce M1 macrophage polarization, thereby attenuating inflammation and promoting tissue repair in OA models. , Similarly, IL-1β stimulated chondrocytes typically exhibit increased expression of WNT5a, β-catenin, RUNX2, and matrix degrading enzymes associated with cartilage degeneration. Previous studies have also shown that PRP-Exos suppress matrix metalloproteinases while enhancing anabolic signaling, thereby promoting extracellular matrix preservation and cartilage regeneration. Our findings substantiate these reported outcomes and further support the therapeutic potential of PRP derived exosomes in regulating inflammatory and anabolic responses in osteoarthritic conditions.

4.4. Study Limitations

These findings should be contextualized within the framework of a few study limitations. First, PRP and PRP-Exos were normalized based on total protein concentration (10 μg/mL) rather than particle number. Although protein normalization is widely used for extracellular vesicle studies, it does not represent biologically equivalent dosing because PRP and PRP-Exos differ substantially in protein composition. Therefore, the greater efficacy of PRP-Exos should be interpreted within the context of the protein normalized dosing strategy used in this study. Future investigations employing nanoparticle tracking analysis (NTA) based particle normalization together with dose response studies are required for direct comparison. Second, signaling pathway activation was evaluated at a single 24 h time point. Because MAPK and NF-κB activation is dynamic and time dependent, additional early and late time point analyses would provide a more comprehensive understanding of pathway regulation by PRP-Exos. Third, oxidative stress assessment was limited to qualitative DCFDA fluorescence imaging without quantitative ROS analysis or complementary oxidative stress biomarkers. Future studies incorporating quantitative ROS measurements and additional oxidative stress markers are warranted to further validate the antioxidative potential of PRP derived exosomes. Finally, the experimental model has inherent limitations. Although IL-1β stimulation is a well established in vitro model for mimicking osteoarthritic inflammation, it cannot fully reproduce the complex phenotype, cellular heterogeneity, and chronic pathological environment of osteoarthritic cartilage. Likewise, the short-term ex vivo cartilage explant model does not fully recapitulate the mechanical loading, immune interactions, vascular influences, and systemic factors present in the osteoarthritic joint. Accordingly, our data provide preliminary proof-of-concept evidence, and further validation in long-term in vivo models and clinical studies is necessary.

4.5. Translational Outlook

Despite these limitations, the present data substantiate the therapeutic potential of PRP derived exosomes serving as an acellular regenerative intervention for osteoarthritis. Recent evidence suggests that the nanoscale dimensions of PRP derived exosomes may facilitate improved tissue distribution and targeted delivery of therapeutic cargo compared with conventional PRP, thereby supporting their development as an advanced regenerative platform. Nevertheless, several challenges remain before clinical translation can be achieved, including the lack of standardized protocols for PRP and exosome preparation, uncertainty regarding optimal dosing strategies, donor to donor variability, and limited long-term safety data. Future studies should focus on identifying the specific exosomal components responsible for therapeutic efficacy, optimizing delivery systems, establishing standardized manufacturing protocols, and conducting well designed nonclinical models together with clinical trials to validate the long-term biocompatibility and safety of PRP derived exosomes. Collectively, the present study supports the functional utility of PRP-Exos as a robust cell free therapeutic approach for attenuating osteoarthritis associated inflammation and promoting cartilage regeneration while highlighting the need for further mechanistic and translational investigations before routine clinical application.

5. Conclusions

This study supports the therapeutic potential of PRP and PRP-Exos in modulating chondrocyte function and attenuating OA related inflammation and tissue degradation. Unlike conventional PRP therapy, which contains a heterogeneous mixture of cells, growth factors, and bioactive components, PRP derived exosomes represent a cell free therapeutic approach with the potential advantages of improved characterization, reproducibility, storage stability, and reduced concerns associated with cellular transplantation. These properties may support the future development of standardized exosome based regenerative therapies; however, rigorous preclinical testing and subsequent clinical validation are required to determine the long-term tolerability and therapeutic potency of PRP-Exos.

All data generated and analyzed during the current study are available.

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.6c07801.

• Detailed information on the blood samples used in this study (PDF)

• Nanoparticle tracking analysis (NTA) of PRP-Exos (PDF)

J.S.: Conceptualization, methodology, data curation and analysis, and original draft preparation: writing–review and editing; H.Y.Y. & H.K.K.: conceptualization, supervision, and manuscript review; J.Y.K.: Supervision and assistance; Y.Z & S.S.K.: Assistance; J.K.S.: Conceptualization, supervision, project administration, final approval, and funding acquisition. All authors have read and agreed to the published version of the manuscript.

This research was supported by the Korean Fund for Regenerative Medicine­(KFRM) grant funded by the Korea government­(the Ministry of Science and ICT, the Ministry of Health & Welfare). (22C0603L1–11)

The study was conducted in accordance with the Declaration of Chonnam National University Hwasun hospital and approved by the Institutional Review Board or Ethics Committee (No. CNUHH-2025–069, date of approval: 22 April 2025) for studies involving humans.

The authors declare no competing financial interest.