Skip to main content
NCBI home page
BMC Medical Genomics logoLink to BMC Medical Genomics
. 2026 Sep 8;19:155. doi: 10.1186/s12920-026-02466-8

Identification and splicing assessment of a novel homozygous CFAP65 splice-site variant associated with oligozoospermia and complete asthenozoospermia

Congcong Teng 1,2,#, Xinhua Tang 1,3,5,#, Lin Li 2,6, Yaxian Ma 6, Yuancun Zhao 3,5, Qing Chen 3,5, Hong Shi 2,✉, Jie Zhang 1,3,4,5,✉
PMCID: PMC13670435  PMID: 42875786

Abstract

Background

Pathogenic variants in CFAP65 have been reported in male infertility with sperm motility defects. This study investigated a novel homozygous CFAP65 splice-site variant identified in a consanguineous family in which the proband presented with oligozoospermia and complete asthenozoospermia.

Methods

Whole-exome sequencing was performed to identify candidate variants, followed by population- and disease-database annotation. Kinship and runs of homozygosity analyses were used to assess familial relatedness and autozygosity. RNA Splicer prediction and a minigene assay in HEK-293T cells were performed to evaluate the splicing effect of the identified variant.

Results

Semen analysis showed a sperm concentration of 8.1 × 10⁶/mL, with total and progressive motility of 0%. Whole-exome sequencing identified a novel homozygous canonical splice-site variant in CFAP65 (NM_194302.4:c.645 + 1G > A), which was classified as pathogenic according to ACMG guidelines. ROH analysis showed increased autosomal homozygosity in the proband (FROH = 7.88%), supporting parental consanguinity. The minigene assay demonstrated complete exon 6 skipping, resulting in a 103-bp transcript deletion and a predicted frameshifted truncated protein p.(Pro182ArgfsTer29).

Conclusion

This study expands the CFAP65 mutational spectrum and supports exon 6 skipping-mediated loss of function as the likely pathogenic mechanism. These findings highlight the value of genetic screening and functional splicing assessment in male infertility with sperm motility defects.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12920-026-02466-8.

Keywords: Whole-exome sequencing, CFAP65, Male infertility, Novel variant, Oligozoospermia, Asthenozoospermia

Introduction

Infertility is a major global health concern. According to the World Health Organization (WHO), approximately one in six people worldwide experience infertility during their lifetime [1]. Male factors are solely responsible for approximately 20–30% of infertility cases and contribute to about 50% of cases overall [2]. Genetic factors represent an important cause of male infertility, accounting for at least 15% of cases [3]. However, the genetic etiology remains unresolved for a substantial proportion of affected individuals, underscoring the need to identify additional disease-causing variants and clarify their functional consequences.

Complete asthenozoospermia (i.e., 100% immotile spermatozoa) is a severe form of male infertility in which all sperm in the ejaculate lack motility. It had been reported at a frequency of approximately 1/5000 [4, 5]. This condition often falls within the spectrum of multiple morphological abnormalities of the sperm flagella (MMAF), which is characterized by absent, short, coiled, bent, or irregular flagella [6, 7]. The pathogenic variants in more than 17 genes encoding proteins essential for sperm flagellar structure and function had been implicated, including dynein axonemal heavy chain (DNAH) family members and cilia and flagella associated protein (CFAP) family members [8–10]. Functional validation of candidate variants is critical to establish causality and to refine genotype-phenotype correlations in MMAF-related infertility.

Among the genes implicated in MMAF, CFAP65 has emerged as an important contributor. CFAP65 encodes a testis-enriched protein that is essential for maintaining sperm flagellar integrity [11]. It has been proposed to participate in the assembly and stabilization of the axonemal dynein regulatory complex, a key structure involved in regulating flagellar beating. Biallelic pathogenic variants (homozygous or compound heterozygous) in CFAP65 had been shown to disrupt this architecture, leading to MMAF and complete sperm immotility [12]. However, for a substantial proportion of reported variants, transcript-level functional validation remains limited. This is particularly relevant for canonical splice-site variants, which can produce diverse pre-mRNA splicing outcomes that cannot be reliably inferred from genomic position alone [13–15].

In this study, a consanguineous family was investigated in which the proband presented with primary infertility. WES identified a novel homozygous canonical splice-site variant in CFAP65, which was absent from ClinVar and population databases. Kinship and ROH analyses supported parental consanguinity and were consistent with an autosomal recessive inheritance pattern. A minigene splicing assay demonstrated that c.645 + 1G > A caused complete skipping of exon 6, resulting in a 103-bp deletion at the transcript level and a predicted splice-mediated loss-of-function effect. This study expands the mutational spectrum of CFAP65 and further supports its critical role in the genetic etiology of male infertility.

Materials and methods

Ethics approval

This study was approved by the Ethics Review Board of the First People’s Hospital of Yunnan Province (KHLL2025-KY279) and was conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from the family after all participants were fully informed about the study.

Semen analysis and clinical evaluation

The proband underwent clinical evaluation at the outpatient clinic of medical genetics, the first people’s hospital of Yunnan province. Semen samples were collected by masturbation after an appropriate period of sexual abstinence and analyzed according to standard semen analysis procedures. Semen parameters, including sperm concentration, sperm vitality, total motility (TM), progressive motility (PR), non-progressive motility (NP), and immotility (IM), were recorded. Family history and reproductive history were obtained through structured interviews and preconception evaluation.

Whole-exome sequencing

Genomic DNA was extracted from peripheral venous blood samples of the proband and both parents. WES was performed at MyGenostics Medical Laboratory (Beijing, China). Variants were annotated and filtered by integrating the clinical phenotype with disease databases, population allele frequency data, and in silico prediction tools. Candidate variants were interpreted and classified according to the ACMG guidelines. The CFAP65 c.645 + 1G > A variant was subsequently validated by Sanger sequencing in the proband and both parents. Genomic coordinates were reported according to the GRCh37/hg19 human reference genome assembly. In addition, genome-wide single-nucleotide variant (SNV) data were used to perform homozygosity analysis to support the diagnosis of autosomal recessive disorders and to assess parental consanguinity.

Runs of Homozygosity (ROH) analysis

Genome-wide ROH analysis was performed using PLINK v1.9 on high-quality autosomal single-nucleotide variant (SNV) calls derived from WES data. ROH were defined as contiguous homozygous segments meeting the following criteria: a minimum length of 1.5 Mb, spanning at least 50 consecutive homozygous SNVs, with a maximum gap of 100 kb between adjacent variants and no more than one heterozygous call permitted per sliding window. The total autosomal ROH length was summed, and the genomic inbreeding coefficient (FROH) was calculated as the proportion of the autosomal genome covered by ROH (total ROH length / total autosomal genome length). For reference, the expected proportion of autozygosity in the offspring of a first-cousin union is approximately 6.25% (F = 1/16), although ROH-based estimates may vary depending on platform coverage, variant density, and detection parameters [16, 17].

Structural visualization of wild-type CFAP65

The wild-type CFAP65 protein structure model (UniProtKB: Q6ZU64, CFAP65_HUMAN) was obtained from the AlphaFold Protein Structure Database. PyMOL v2.0 was used for structural visualization. Because the c.645 + 1G > A variant affects a canonical splice donor site and is expected to alter the transcript through aberrant splicing rather than a single amino acid substitution, mutant structural modeling was not performed. The wild-type structure was used to visualize the location of Pro182, the predicted frameshift initiation site identified after splicing analysis.

Kinship analysis

Kinship analysis was performed using WES-derived SNV data from the proband and both parents. The pairwise similarity metrics were plotted in a two-dimensional scatterplot to visualize clustering patterns corresponding to different degrees of relatedness. Based on WES samples routinely analyzed, empirical cluster boundaries were defined: first-degree relatives (e.g., parent-child pairs and full siblings) typically showed genotype correlation values of 0.50–0.60 and overlap percent values of 70%-80%, whereas unrelated individuals (e.g., spouses) usually showed genotype correlation values of 0.40–0.50 and overlap percent values of 55.5%-70%. These empirical boundaries were used as thresholds for the tentative classification of sample pairs as first-degree relatives, more distant relatives, or unrelated individuals.

RNA splice variant prediction

For the CFAP65 variant identified by WES (NM_194302.4:c.645 + 1G > A), its potential impact on pre-mRNA splicing was assessed using the RNA Splicer tool from the Rare Disease Data Center (RDDC) (https://rddc.tsinghua-gd.org/zh/tool/rna-splicer/). This tool integrates deep-learning-based DanQ [18] and Transformer models. By inputting the variant and transcript information (CFAP65: c.645 + 1G > A, NM_194302.4), the potential splicing alterations in mRNA caused by this nucleotide change was predicted.

Minigene assay

To functionally assess the splicing consequences of the CFAP65 c.645 + 1G > A variant, a minigene splicing assay was performed. Genomic DNA from the proband carrying the homozygous c.645 + 1G > A variant was used as the template for construction of the mutant-type (MT) minigene. In parallel, genomic DNA from a healthy control without the c.645 + 1G > A variant was used to construct the wild-type (WT) minigene using the same procedure. The amplified CFAP65 fragment included exon 5, a partial intron 5 sequence, exon 6, intron 6, and exon 7. Given the considerable length of intron 5, primers were designed using seamless cloning technology. Two target insertion gene fragments (CFAP65-A and CFAP65-B) were obtained by amplifying the homozygous variant c.645 + 1G > A. The primer sequences were as follows: (AF) AAGCTTGGTACCGAGCTCGGATCCCCCGCAAGCTCCATGGACACTCAGATGC; (AR) AGAGCTGTAGGGTATTCCCCAGAAAAACTCTTGTACTTATG; (BF) GGGGAATACCCTACAGCTCTGCTGAGGTCTCTGGAAAGGCATC; (BR) TTAAACGGGCCCTCTAGACTCGAGCCCACATTATCCAGGCAGAAAAAGGCCTCA.

The pMini-CopGFP plasmid was first digested with BamHI and XhoI restriction enzymes. The digested products were then separately subjected to recombinant ligation with the CFAP65-A and CFAP65-B fragments. Wild-type (WT) and mutant-type (MT) minigene plasmids were subsequently screened. Following transformation of the recombinant plasmids, single colonies were selected for PCR identification using the following verification primers: Intron-F: GATATACACTGTTTGAGATGAGGA, CX-1R: TTAGTAGAGGTGGGGTTTCG. The plasmids were transfected into HEK-293T cells using Lipofectamine 2000. The culture medium was replaced 6 hours post-transfection, and cells were harvested 48 hours after transfection. Transcripts were analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using the following primers: forward primer 5’-GGCTAACTAGAGAACCCACTGCTTA-3’ and reverse primer 5’-CCCACATTATCCAGGCAGAAAAAG-3’. Finally, the WT and MT PCR products were separately analyzed by 1.0% agarose gel electrophoresis and verified by Sanger sequencing.

Literature search of reported CFAP65 variants

Published reports of CFAP65-associated male infertility were searched in PubMed and Web of Science using combinations of the terms “CFAP65,” “male infertility,” “asthenozoospermia,” “asthenoteratozoospermia,” “multiple morphological abnormalities of the sperm flagella,” and “MMAF.” Articles published up to May 2026 were reviewed, and reported biallelic CFAP65 variants and associated clinical phenotypes were extracted and summarized in Table S1.

Results

Clinical characteristics of the proband

The proband was a 36-year-old man with a 10-year history of primary infertility. Following 3 days of sexual abstinence, semen analysis showed a semen volume of 7.5 mL, a total sperm number of 60.75 × 10⁶, a sperm concentration of 8.1 × 10⁶/mL, sperm vitality of 51.7%, TM of 0%, PR of 0%, NP of 0%, and IM of 100%, consistent with oligozoospermia accompanied by complete asthenozoospermia [19]. Semen viscosity was abnormal. The total abnormal morphology rate was 88.0%, including a head defect rate of 85.2%. Family history was obtained through interviews and preconception evaluation. According to the reported family history, the proband’s parents were first cousins. The proband and his wife were non-consanguineous. The wife had no prior pregnancies and reported no family history of hereditary disease.

Identification of a novel homozygous CFAP65 c.645 + 1G > A variant

A homozygous canonical splice-donor variant in CFAP65, NM_194302.4:c.645 + 1G > A, affecting the invariant + 1 nucleotide at the exon 6-intron 6 junction, was identified in the proband by WES. Sanger sequencing further confirmed the homozygous c.645 + 1G > A variant in the proband and heterozygous carrier status in both parents (Fig. 1A). The primary phenotypes associated with CFAP65 gene variants include abnormal sperm morphology, oligozoospermia, and male infertility. According to the ACMG guidelines, the c.645 + 1G > A variant was classified as “Pathogenic” based on the criteria PVS1 + PM2_supporting + PM3_supporting. The variant (NM_194302.4:c.645 + 1G > A), mapped to chr2:219897191 (GRCh37/hg19), had not been recorded in ClinVar or reported in the literature at the time of analysis. It has now been deposited in ClinVar under accession number SCV007613784. Conservation analysis showed that Pro182, the predicted frameshift initiation site following exon 6 skipping, is highly conserved across species (Fig. 1B). The wild-type CFAP65 structure was obtained from the AlphaFold Protein Structure Database and visualized using PyMOL. Because the c.645 + 1G > A variant causes exon 6 skipping leading to a frameshift and premature termination p.(Pro182ArgfsTer29), the resulting truncated protein is not suitable for reliable structural modeling. Therefore, only the wild-type structure is shown, and the arrow in Fig. 1C marks the frameshift initiation site (Pro182).

Fig. 1.

Fig. 1

Open in a new tab

Identification of a novel CFAP65 variant in a Chinese family. A Sanger sequencing revealed that the patient carries a homozygous intronic variant in CFAP65 (c.645 + 1G > A), while both parents are heterozygous carriers. The variant site is indicated by a red arrow. B Conservation of Pro182, the predicted frameshift initiation site following exon 6 skipping, across species, highlighted by arrowheads. C Three-dimensional structure of wild-type CFAP65 obtained from the AlphaFold Protein Structure Database. The arrow indicates Pro182, the predicted initiation site of the frameshift. Mutant structural modeling was not performed because the c.645 + 1G > A variant is predicted to generate a truncated protein

Kinship analysis of proband’s family

The correlation versus overlap percent scatterplot (Fig. 2) showed that sample pairs clustered according to their inferred kinship category. Genotype correlation was shown on the x-axis and overlap percent on the y-axis. In the core family (highlighted in red), the child-father and child-mother comparisons fell within the “parent-child” region, with genotype correlation of ~ 0.58 and overlap percent of ~ 78%. These values were consistent with a first-degree parent-offspring relationship and confirmed the parent-child relationships within this family. By contrast, the father-mother pair deviated from the distribution expected for unrelated individuals: their genotype correlation (0.48) and overlap percent (68%) were higher than those typically observed for unrelated sample pairs, indicating increased genetic similarity between the parents.

Fig. 2.

Fig. 2

Open in a new tab

Kinship analysis of trio samples. Sample 25B120251310 is the proband, 25B120251311 is the father, and 25B120251312 is the mother. The proband-father and proband-mother comparisons clustered within the expected range for first-degree parent-offspring relationships. In contrast, the father-mother comparison deviated from the distribution of unrelated individuals, indicating increased genetic similarity

In addition, ROH analysis identified multiple long contiguous homozygous segments distributed across the proband’s autosomes, yielding a total autosomal ROH length of approximately 227 Mb, corresponding to 7.88% of the autosomal genome. This value is compatible with the expected autozygous proportion for offspring of a first-cousin union (F = 1/16, approximately 6.25%), taking into account variation related to recombination, platform coverage, and ROH detection parameters. Taken together, the kinship and ROH findings provided genomic support for the parental consanguinity documented by family history and suggested an autozygous basis for the proband’s homozygous CFAP65 c.645 + 1G > A variant.

RNA Splicer prediction of CFAP65 c.645 + 1G > A

RNA Splicer analysis of the CFAP65 c.645 + 1G > A variant predicted marked disruption of normal splicing. Two aberrant splice patterns were suggested. In splice pattern 1, the variant created a novel donor site at exon 6, introducing a 5-bp insertion and leading to a frameshift with premature termination (Fig. 3A). In splice pattern 2, the variant caused complete skipping of exon 6, resulting in a 103-bp deletion from the transcript and another frameshift with a premature stop codon (Fig. 3B).

Fig. 3.

Fig. 3

Open in a new tab

In silico prediction of aberrant splicing caused by CFAP65 c.645 + 1G > A. RNA Splicer predicts two abnormal splice patterns: A A 5-bp insertion caused by activation of a novel splice donor site, resulting in a frameshift and premature termination. B A 103-bp deletion caused by exon 6 skipping, resulting in a frameshift and premature termination

Exon 6 skipping caused by CFAP65 c.645 + 1G > A

To validate the pathogenicity of this intronic variant, an in vitro minigene splicing assay was performed. The minigene construct contained genomic sequences spanning CFAP65 exons 5–7 and carried either the WT sequence or the mutant allele (c.645 + 1G > A) (Fig. 4A). RT-PCR analysis showed that cells transfected with the WT construct produced a 529-bp amplicon, whereas cells transfected with the mutant construct generated a 426-bp amplicon (Fig. 4B). Sanger sequencing confirmed the splicing junctions. Collectively, these results indicated that the c.645 + 1G > A variant caused complete skipping of exon 6, resulting in a 103-bp deletion in the transcript (Fig. 4C, D).

Fig. 4.

Fig. 4

Open in a new tab

Minigene constructs and in vitro splicing assay. A Schematic workflow for construction of the CFAP65 minigene containing exons 5–7. The fragment was cloned into the Mini-CopGFP vector at the BamHI and XhoI sites. B Agarose gel electrophoresis of RT-PCR products. Lane 1, DNA ladder; lane 2, wild-type (WT) minigene, yielding a 529-bp product; lane 3, mutant (MT) minigene, yielding a 426-bp product. C Schematic illustration of splicing outcomes: the WT minigene generates a transcript including exons 5, 6, and 7, whereas the MT minigene produces a transcript with complete skipping of exon 6. D Sanger sequencing of RT-PCR products confirmed that the c.645 + 1G > A variant causes exon 6 skipping, resulting in a 103-bp deletion

Literature review of CFAP65 gene variants

After reviewing published reports on CFAP65-associated male infertility, reported variants were summarized according to their biallelic genotypes or variant combinations. Among the unique CFAP65 variant alleles summarized in Table S1, 12 were truncating variants, including nonsense and frameshift variants, whereas two were splice-region variants, c.645G > A and c.3047T > G, and one was a missense variant. These findings indicate that biallelic loss of CFAP65 function is likely the predominant disease mechanism, although transcript-level functional validation was not reported for the previously described splice-region variants. Reported patients commonly presented with severe asthenozoospermia or MMAF-like phenotypes, with complete sperm immotility or complete loss of progressive motility in most cases with available motility data. When transmission electron microscopy (TEM) data were available, recurrent ultrastructural abnormalities included acrosome hypoplasia, mitochondrial sheath defects, central pair complex defects, fibrous sheath abnormalities, and severe axonemal disorganization involving missing or disorganized CP, DMT, and ODF structures [11, 12, 20, 21].

Discussion

In this study, a novel homozygous splice-donor variant in CFAP65 (NM_194302.4:c.645 + 1G > A) was identified in a 36-year-old man with oligozoospermia and complete asthenozoospermia. Semen analysis revealed a sperm concentration of 8.1 × 10⁶/mL, total motility of 0%, and 100% immotile sperm. According to the family history, the proband was born to first-cousin parents. According to ACMG criteria, the canonical splice-site location, rarity in population databases, and homozygous occurrence support classification of c.645 + 1G > A as a pathogenic CFAP65 variant (PVS1 + PM2_supporting + PM3_supporting) [22, 23]. Functional analysis demonstrated that this variant caused complete skipping of exon 6, resulting in a 103-bp deletion at the transcript level and a predicted frameshifted truncated protein, p.(Pro182ArgfsTer29). The aberrant transcript was predicted to undergo nonsense-mediated decay, or, if translated, to produce a truncated CFAP65 protein, supporting a splice-mediated loss-of-function mechanism [23]. This mechanism is consistent with previous reports showing that biallelic loss-of-function variants in CFAP65 are associated with severe asthenozoospermia, sperm flagellar abnormalities, and male infertility [11, 12]. Among previously reported CFAP65 variants, transcript-level characterization of splice-related variants remains limited. In the present study, the novel canonical splice-donor variant c.645 + 1G > A was shown by a minigene assay to cause complete exon 6 skipping, thereby defining its specific splicing consequence and supporting a splice-mediated loss-of-function mechanism. Although this study provided functional evidence for the pathogenicity of CFAP65 c.645 + 1G > A, the findings were based on a single family. Further studies in larger clinical cohorts are needed to better define the genotype-phenotype relationship of CFAP65-related male infertility.

Clinically, the proband presented with oligozoospermia and complete asthenozoospermia (IM 100%, PR and NP 0%), which is consistent with previously reported CFAP65-related male infertility phenotypes [12, 21]. Notably, sperm vitality remained at 51.7% despite the complete absence of motility, indicating that a substantial proportion of spermatozoa were viable but immotile. This distinction may have clinical relevance in assisted reproduction, where assessment of sperm viability is important when immotile sperm are considered for use. A synthesis of reported CFAP65-associated cases suggests a predominant biallelic loss-of-function mechanism, and complete sperm immotility appears to be a recurrent feature when motility data are available. The abnormal morphology rate was 88.0%, predominantly involving head defects. However, because detailed sperm morphology classification, TEM analysis, and flagellar ultrastructural assessment were not available, direct comparison with the specific flagellar subtypes and ultrastructural features reported in prior CFAP65 cases is limited [11, 21]. Therefore, whether this patient fully meets the criteria for MMAF cannot be determined. Future cases incorporating comprehensive morphological and ultrastructural analyses would help refine genotype-phenotype correlations for CFAP65-related male infertility. Moreover, identification of biallelic CFAP65 variants supported an autosomal recessive inheritance pattern and highlighted the importance of genetic risk assessment and counseling for affected families.

This study also highlighted the value of integrating genomic and pedigree information in the setting of parental consanguinity. Kinship and homozygosity analyses based on genome-wide SNVs confirmed the parent-child relationships and showed that long runs of homozygosity accounted for approximately 7.88% of the proband’s autosomal genome, with a total autosomal ROH length of approximately 227 Mb, supporting parental consanguinity. Similar to other recessive sperm flagellar disorders, several reported CFAP65-associated cases involve homozygous pathogenic variants, particularly in consanguineous families, consistent with autozygosity increasing the likelihood of homozygous pathogenic variants [12, 21, 24]. Collectively, these findings supported the use of WES combined with runs-of-homozygosity analysis as an effective strategy to prioritize candidate genes and variants underlying male infertility in such families.

Methodologically, this study underscored the value of integrating in silico prediction with functional validation for splice-site variants. The RDDC RNA Splicer tool predicted two possible aberrant splicing patterns for the CFAP65 c.645 + 1G > A variant, including the creation of a novel donor site resulting in a 5-bp insertion and complete skipping of exon 6. The minigene assay experimentally supported the latter outcome, demonstrating complete exon 6 skipping. The resulting transcript lacked 103 bp and was predicted to cause a frameshift beginning at residue 182, producing p.(Pro182ArgfsTer29). This aberrant transcript is predicted to undergo nonsense-mediated decay, consistent with a splice-mediated loss-of-function mechanism and supporting the pathogenic classification of this CFAP65 variant [23]. Together, the in silico prediction and minigene assay provided functional evidence for the pathogenicity of this variant. However, because CFAP65 is highly and preferentially expressed in the testis, RT-PCR validation using patient-derived peripheral blood RNA could not be performed [11]. Although the minigene assay confirmed exon 6 skipping, the HEK-293T based system may not fully recapitulate tissue-specific splicing regulation in testicular germ cells. Therefore, future studies using appropriate reproductive samples or germ-cell-related models would be important to further clarify the downstream molecular consequences of CFAP65 deficiency and its effect on sperm flagellar function.

In conclusion, this study identified a novel homozygous splice-donor variant in CFAP65 (c.645 + 1G > A) in a patient with oligozoospermia and complete sperm immotility. Functional validation demonstrated that this variant caused complete skipping of exon 6, resulting in the predicted frameshifted truncated protein p.(Pro182ArgfsTer29). These findings support a splice-mediated loss-of-function mechanism and the pathogenic role of the variant in oligozoospermia and complete asthenozoospermia. This study expands the mutational spectrum of CFAP65 and highlights the utility of an integrated approach combining WES, AI-assisted splicing prediction, and minigene assays for diagnosing rare genetic causes of male infertility.

Supplementary Information

Supplementary Material 1. (92.9KB, pdf)

Acknowledgements

We thank the patients and their families participating in this study.

Authors' contributions

CC.T. and XH.T. conducted the genetic data analysis and wrote the manuscript. CC.T. and L.L. performed the experimental work. YX.M. collected the case data and performed the clinical phenotype analyses. Q.C. and YC.Z. collected, analyzed, and interpreted clinical data. J.Z. and H.S. designed the experiments and revised the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by National Natural Science Foundation of China (82160319), Young and Middle-Aged Academic Leaders Planning Commission of Yunnan Province (202105AC160034), Key Project of Yunnan Provincial Clinical Medicine Center for Hematological Diseases (2024YNLCYXZX0263), and Basic Research Project-Key Projects of Yunnan Province (202301AS070007), Basic Research Projects of Yunnan Province (202501AY070001-021), High-end Medical Talents of Yunnan Provincial Health Commission (L-2024016).

Data availability

The CFAP65 variant identified in this study has been submitted to ClinVar under accession number SCV007613784. The data supporting the findings of this study are included in the article and its supplementary information files. The FASTA sequences supporting genomic Sanger confirmation and minigene splicing validation are provided as Additional file 2. The raw whole-exome sequencing data are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

This study was approved by the Ethics Review Board of the First People’s Hospital of Yunnan Province (KHLL2025-KY279) and was conducted in accordance with the principles of the Declaration of Helsinki. Written informed consent was obtained from the family after all participants were fully informed about the study.

Consent for publication

The informed consents for publication was obtained from all participants.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Congcong Teng and Xinhua Tang contributed equally to this work.

Contributor Information

Hong Shi, Email: shih@kust.edu.cn.

Jie Zhang, Email: kmzhjie@aliyun.com.

References

  • 1.World Health Organization. Infertility prevalence estimates, 1990–2021.Geneva: World Health Organization; 2023.
  • 2.Agarwal A, Mulgund A, Hamada A, Chyatte MR. A unique view on male infertility around the globe. Reprod Biol Endocrinol. 2015;13:37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tournaye H, Krausz C, Oates RD. Concepts in diagnosis and therapy for male reproductive impairment. Lancet Diabetes Endocrinol. 2017;5(7):554–64. [DOI] [PubMed] [Google Scholar]
  • 4.Eliasson R, Mossberg B, Camner P, Afzelius BA. The immotile-cilia syndrome. A congenital ciliary abnormality as an etiologic factor in chronic airway infections and male sterility. N Engl J Med. 1977;297(1):1–6. [DOI] [PubMed] [Google Scholar]
  • 5.Ortega C, Verheyen G, Raick D, Camus M, Devroey P. Absolute asthenozoospermia and ICSI: what are the options? Hum Reprod Update. 2011;17(5):684. [DOI] [PubMed] [Google Scholar]
  • 6.Tang S, Wang X, Li W, Yang X, Li Z, Liu W, Li C, Zhu Z, Wang L, Wang J. Biallelic Mutations in CFAP43 and CFAP44 Cause Male Infertility with Multiple Morphological Abnormalities of the Sperm Flagella. Am J Hum Genet. 2017;100(6):854–64. [DOI] [PMC free article] [PubMed]
  • 7.Coutton C, Vargas AS, Amiri-Yekta A, Kherraf Z-E, Ben Mustapha SF, Le Tanno P, Wambergue-Legrand C, Karaouzène T, Martinez G, Crouzy S. Mutations in CFAP43 and CFAP44 cause male infertility and flagellum defects in Trypanosoma and human. Nat Commun. 2018;9(1):686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Jiao SY, Yang YH, Chen SR. Molecular genetics of infertility: loss-of-function mutations in humans and corresponding knockout/mutated mice. Hum Reprod Update. 2021;27(1):154–89. [DOI] [PubMed] [Google Scholar]
  • 9.Khelifa MB, Coutton C, Zouari R, Karaouzène T, Rendu J, Bidart M, Yassine S, Pierre V, Delaroche J, Hennebicq S. Mutations in DNAH1, which encodes an inner arm heavy chain dynein, lead to male infertility from multiple morphological abnormalities of the sperm flagella. Am J Hum Genet. 2014;94(1):95–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Amiri-Yekta A, Coutton C, Kherraf Z-E, Karaouzène T, Le Tanno P, Sanati MH, Sabbaghian M, Almadani N, Sadighi Gilani MA, Hosseini SH. Whole-exome sequencing of familial cases of multiple morphological abnormalities of the sperm flagella (MMAF) reveals new DNAH1 mutations. Hum Reprod. 2016;31(12):2872–80. [DOI] [PubMed]
  • 11.Zhang X, Shen Y, Wang X, Yuan G, Zhang C, Yang Y. A novel homozygous CFAP65 mutation in humans causes male infertility with multiple morphological abnormalities of the sperm flagella. Clin Genet. 2019;96(6):541–8. [DOI] [PubMed] [Google Scholar]
  • 12.Wang W, Tu C, Nie H, Meng L, Tan YQ. Biallelic mutations in CFAP65 lead to severe asthenoteratospermia due to acrosome hypoplasia and flagellum malformations. J Med Genet. 2019;56(11):jmedgenet–2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gaildrat P, Killian A, Martins A, Tournier I, Frébourg T, Tosi M. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods Mol Biol. 2010;653:249–57. [DOI] [PubMed]
  • 14.van der Klift HM, Jansen AM, van der Steenstraten N, Bik EC, Tops CM, Devilee P, Wijnen JT. Splicing analysis for exonic and intronic mismatch repair gene variants associated with Lynch syndrome confirms high concordance between minigene assays and patient RNA analyses. Mol Genet Genom Med. 2015;3(4):327–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Soens ZT, Branch J, Wu S, Yuan Z, Li Y, Li H, Wang K, Xu M, Rajan L, Motta FL. Leveraging splice-affecting variant predictors and a minigene validation system to identify Mendelian disease‐causing variants among exon‐captured variants of uncertain significance. Hum Mutat. 2017;38(11):1521–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sund KL, Rehder CW. Detection and reporting of homozygosity associated with consanguinity in the clinical laboratory. Hum Hered. 2014;77(1–4):217–24. [DOI] [PubMed] [Google Scholar]
  • 17.Gonzales PR, Andersen EF, Brown TR, Horner VL, Horwitz J, Rehder CW, Rudy NL, Robin NH, Thorland EC, On Behalf Of The Acmg Laboratory Quality Assurance C. Interpretation and reporting of large regions of homozygosity and suspected consanguinity/uniparental disomy, 2021 revision: A technical standard of the American College of Medical Genetics and Genomics (ACMG). Genet Med. 2022;24(2):255–61. [DOI] [PubMed] [Google Scholar]
  • 18.Daniel Q, Xiaohui X. DanQ: a hybrid convolutional and recurrent deep neural network for quantifying the function of DNA sequences. Nucleic Acids Res. 2016;44(11):e107. [DOI] [PMC free article] [PubMed]
  • 19.Pallotti F, Lombardo F, Paoli D et al. Comment on Boitrelle. The Sixth Edition of the WHO Manual for Human Semen Analysis: A Critical Review and SWOT Analysis. Life 2021, 11, 1368. 2022, 12(7). [DOI] [PMC free article] [PubMed]
  • 20.Lu Y, Ran L, Liu S, Wang J, Li T, Li H, Wang B. The compound heterozygous mutations of CFAP65 cause multiple morphological abnormalities of sperm flagella in infertile men. QJM. 2023;116(12):1020–2. [DOI] [PubMed] [Google Scholar]
  • 21.Li W, Wu H, Li F, Tian S, Kherraf ZE, Zhang J, Ni X, Lv M, Liu C, Tan Q, et al. Biallelic mutations in CFAP65 cause male infertility with multiple morphological abnormalities of the sperm flagella in humans and mice. J Med Genet. 2020;57(2):89–95. [DOI] [PubMed] [Google Scholar]
  • 22.Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med Official J Am Coll Med Genet. 2015;17(5):405–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Abou Tayoun AN, Pesaran T, DiStefano MT, Oza A. Recommendations for interpreting the loss of function PVS1 ACMG/AMP variant criterion. Hum Mutat. 2018;39(11):1517–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang J, Wang W, Shen L, Zheng A, Meng Q, Li H, Yang S. Clinical detection, diagnosis and treatment of morphological abnormalities of sperm flagella: A review of literature. Front Genet. 2022;13:1034951. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (92.9KB, pdf)

Data Availability Statement

The CFAP65 variant identified in this study has been submitted to ClinVar under accession number SCV007613784. The data supporting the findings of this study are included in the article and its supplementary information files. The FASTA sequences supporting genomic Sanger confirmation and minigene splicing validation are provided as Additional file 2. The raw whole-exome sequencing data are available from the corresponding author upon reasonable request.

Articles from BMC Medical Genomics are provided here courtesy of BMC

RESOURCES