Low frequency sinusoidal electromagnetic field accelerating intervertebral fusion through YAP/β-catenin axis

Abstract

Objective

Lumbar interbody fusion plays a crucial role in treating lumbar degenerative diseases, but its fusion rate is influenced by various factors. As a non-invasive physical therapy, low-frequency sinusoidal electromagnetic fields have been proven to promote bone tissue regeneration, although the specific molecular mechanisms remain incompletely understood. The aim of this study is to investigate whether low-frequency sinusoidal electromagnetic fields (LF-SEMF) can regulate the differentiation of bone marrow mesenchymal stem cells (BMSCs) into osteoblasts through YAP/β-catenin axis in vitro, and to evaluate the effect of LF-SEMF in assisting HA/Col I composite scaffold loaded with BMSCs in intervertebral fusion.

Methods

The impact of LF-SEMF on osteogenic differentiation and mineralization was studied using BMSCs through alkaline phosphatase (ALP) staining and Alizarin red staining. Techniques such as Western blot, immunofluorescence, and qRT-PCR were employed to detect the impact of LF-SEMF on the YAP/β-catenin signaling pathway and related osteogenic genes. Gene silencing was performed to validate the critical role of the YAP/β-catenin axis in the promotion of osteogenic differentiation by LF-SEMF. A rat intervertebral fusion model was established, and the effects of LF-SEMF on intervertebral fusion were evaluated using imaging techniques (X-ray, Micro-CT) and histological analysis (HE staining, Masson staining, and immunohistochemical staining).

Results

In vitro experiments demonstrated that exposure to LF-SEMF could facilitate the osteogenic differentiation of BMSCs, significantly upregulating the protein expression levels of YAP and β-catenin, and enhancing the expression of osteogenesis-related genes. Gene silencing experiments confirmed that the YAP/β-catenin axis played a critical role in the promotion of osteogenic differentiation by LF-SEMF. Additionally, animal studies showed that LF-SEMF could significantly promote new bone formation and increase bone strength in the fusion region of caudal vertebrae, while inhibition of YAP/β-catenin signaling pathway attenuated the fusion effect.

Conclusions

LF-SEMF promotes the differentiation of bone marrow mesenchymal stem cells into osteoblasts through YAP/β-catenin signaling pathway. The hydroxyapatite/collagen I composite scaffold loaded with bone marrow mesenchymal stem cells can effectively improve the fusion effect of caudal vertebral fusion by LF-SEMF.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s13287-026-05137-8.

Introduction

Lumbar Degenerative Disease (LDD) is a group of diseases characterized by the degeneration of the structure and function of the lumbar spine, which is common in middle-aged and elderly people and is one of the main causes of low back pain and dysfunction [1, 2]. With the aggravation of population aging and the change of lifestyle, the incidence of lumbar degenerative diseases is increasing year by year, which imposes a serious burden on the health care system and social economy [3]. Lumbar interbody fusion (LIF) is one of the best options for the treatment of LDD [4], which is generally performed via posterior or transforaminal approach. Interbody fusion cage (such as autogenous bone, allogeneic bone or artificial bone substitute material) is implanted between two adjacent vertebral bodies to promote interbody fusion so as to achieve the purpose of segmental stability, nerve decompression and deformity correction [5]. Although the traditional titanium alloy cage is widely used, its biocompatibility and osseointegration ability are limited, which may lead to pseudarthrosis formation and implant displacement [6]. Polyetheretherketone (PEEK) materials are widely used due to their good biocompatibility and imaging transparency, but their weak binding ability to bone may also lead to fusion failure [7]. To this end, researchers are exploring bioactive materials to improve the biofunctionalization of the fusion cage, thereby improving the instability of the fusion rate and related complications such as infection, implant loosening or rejection [8, 9]. As an emerging interdisciplinary field, Bone Tissue Engineering (BTE) provides new ideas for solving the above problems. BTE can simulate the microenvironment of natural bone tissue by combining seed cells, growth factors and scaffold materials, and promote bone regeneration and repair.

Scaffolds play a crucial role in BTE [10]. Biocompatible scaffolds significantly contribute by protecting and delivering seed cells effectively in the field of BTE [11]. Hydroxyapatite/collagen type I composite scaffold have been noted for their production and widespread application in BTE owing to its good biodegradability and outstanding mechanical characteristics [12, 13]. The application of electromagnetic field (EMF) in orthopedic treatment began in the 1970s. As a non-invasive treatment method, it has shown significant clinical efficacy in promoting bone nonunion and delayed fracture healing, so it has attracted wide attention in the field of orthopedic surgery. Bassett et al., in 1981, reported a cure rate of 87% with EMF therapy in 1007 nonunion patients worldwide [14]. Thereafter, Sharrard and Eyre et al., in a clinical double-blind trial, further validated this result and reached a similar conclusion [15]. At present, the US FDA has allowed the use of electromagnetic fields to treat nonunion of fracture in clinical practice, and the magnetic fields used for research and treatment mainly include static magnetic fields, pulsed electromagnetic fields, low-frequency alternating magnetic fields, etc [16–18]. The field strength and frequency range used by them all belong to low frequency and low field strength. A large number of studies have confirmed that the effects of high-frequency electromagnetic fields on the body or cells are mainly thermal effects or mostly damage effects, while low frequency or low field magnetic fields may have beneficial effects on the body. Low frequency alternating electromagnetic fields (LFEMFs) have become a potential adjuvant therapy in bone tissue engineering due to their remarkable efficacy and safety in bone regeneration. For critical size or large bone defects, EMF stimulation alone has limited effect on bone regeneration in the defect area, but when EMF is combined with scaffold materials loaded with stem cells, its ability to promote bone regeneration is significantly enhanced. Therefore, EMF, as a means capable of providing biophysical stimulation, can be regarded as a powerful complement to the classical three elements of cells, materials and biochemical factors in BTE [19]. However, the mechanism by which EMF promotes osteogenesis remains to be fully elucidated.

Studies have shown that EMF can promote the proliferation, migration and osteogenic differentiation of osteocytes through intracellular signal transduction pathways, thereby accelerating the regeneration and repair of bone tissue [20, 21]. Based on previous research results, we have confirmed that electromagnetic fields can activate the FAK/Rho GTPases signaling pathway [22], which is closely related to cell migration. Studies have shown that the activation of FAK/Rho GTPases signaling pathway can up-regulate the expression level of YAP (Yes-associated protein), and YAP, as a key effector protein, plays an important role in regulating the osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) [23]. Based on this mechanism, we hypothesized that YAP might mediate the effect of electromagnetic fields (EMF) on the osteogenic differentiation of BMSCs, which would be verified in our present experiments.

Materials and methods

EMF device

The electromagnetic field generating device is mainly used to generate sinusoidal alternating electromagnetic fields with adjustable intensity and frequency. It is designed and manufactured by the Naval University of Engineering (Wuhan, China) (Figure.1 A). The device can generate electromagnetic fields in the intensity and frequency range of 0–5 mT, 1–200 Hz respectively and the intensity and frequency of the electromagnetic fields can be controlled by adjusting the waveform generator and amplifier. The magnetic field generated by the Helmholtz coil was measured and calibrated using a Gaussiometer (GM55A; TinDun Industry, Shanghai, China), and the uniformity of the electromagnetic field was about 90% in a spherical region with a radius of 7 cm. The Helmholtz coil was placed in a cell incubator at 37℃ with 5% CO₂ to ensure cell growth in a suitable environment. Following our previous study, we used an electromagnetic field (1mT/50Hz) for subsequent experiments [22].

rBMSC isolation and stimulation

Four-week-old (male, 70–100 g) Sprague-Dawley rats were obtained from the Laboratory Animal Center of Tongji Hospital, Hubei Province, China. All experimental procedures were conducted in accordance with the international guidelines for the care and use of laboratory animals and were approved by the Institutional Animal Care and Use Committee of Huazhong University of Science and Technology (2023 IACUC Number: 3972). BMSCs were isolated according to our previous method [24]. In brief, BMSCs were obtained by flushing the bone marrow from rat femurs and tibias with complete medium, which included 10% fetal bovine serum (FBS; Gibco, NY, USA), 100 U/ml penicillin and 100 U/ml streptomycin (Sigma-Aldrich, A5955, USA). Cells were cultured at 37 °C in 5% CO₂ and non-adherent cells were removed during each passage. Passage 3 was used for subsequent experiments. Osteogenic medium (OM) was prepared by adding 10 mM β-glycerophosphate, 50 mg/ml ascorbic acid and 10 nM dexamethasone to complete medium. Then, cells were exposed to 50 Hz, 1 mT LFEMF 4 h per day for a week.

Alizarin red staining and ALP staining

BMSCs were seeded in 24-well plates at a density of 1 × 10⁴ cells/well. After 7 days of culture, the cells were fixed with 4% paraformaldehyde, rinsed with PBS buffer, and the alkaline phosphatase (ALP) in the cells was stained using BCIP/NBT alkaline phosphatase staining kit(Beyotime, Shanghai). The formation of calcium nodules was detected by alizarin red staining kit (Beyotime, Shanghai), after 14 days of cell culture. The stained images were analyzed using ImageJ software, and the stained positive area fraction was obtained by calculating the ratio of the area of the stained positive area to the total area for quantitative assessment of ALP expression and calcium nodule formation.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, Nanjing, China) was used to extract and purify total RNA. Subsequently, a microplate reader (BioTek, USA) was employed to assess the purity and concentration of the extracted RNA. Then, the purity and concentration of the extracted RNA were then assessed with a microplate reader (BioTek, USA). Subsequently, all RNA was converted into cDNA using the HiScript II cDNA Kit (Vazyme, Nanjing, China). Ultimately, the cDNA was amplified and measured with the RT-qPCR detection system, using GAPDH as an internal control across all experiments. Refer to Table 1 for the primer sequences.

Table 1.

Primer sequence used in the RT-qPCR experiment

Target name	Forward primer	Reverse primer
Rat-RUNX2	GGCCACTTACCACAGAGCTATTA	GTGTCTGCCTGGGATCTGTAATC
Rat-OCN	GAGGGCAGTAAGGTGGTGAATAG	GGGTCGAGTCCTGGAGAGTAG
Rat-BMP-2	ACCCGCTGTCTTCTAGTGTTG	AGCCTCAACTCAAACTCGCT
Rat-YAP	CAGCTACAGATGGAGAAGGAGAG	TTGCTGTGCTGGGATTGATATTC
Rat-β-catenin	GCCATCACCACGCTGCATAATCT	GGCAGTCTGTCGTAATAGCCAAGAA
Rat-GAPDH	GAAGGTCGGTGTGAACGGAT	CCCATTTGATGTTAGCGGGAT

Total and nuclear protein extraction and Western blot analysis (WB)

Total proteins were extracted from them using RIPA lysis buffer (Boster, Wuhan, China) containing broad spectrum protease inhibitors and broad spectrum phosphatase inhibitors(Boster, Wuhan, China). Using the Nuclear Cytoplasmic Extraction Kit (Solarbio, China), nuclear proteins were extracted from BMSCs. Western blot analysis was performed as described in the previous study [25]. GAPDH and histone 3 were used for normalization.

Immunofluorescence staining

The BMSCs grown on cell culture slides were fixed with 4% paraformaldehyde and treated with 0.5% Triton X-100 for 30 min. Then, the cells were blocked with 5% BSA at room temperature for 1 h. Subsequently, the cells were incubated with primary antibodies-RUNX2 (1:100 Cell Signaling Technology), YAP (1:100 Cell Signaling Technology), β-catenin(1:100 Cell Signaling Technology) and OCN (1:50 Santa Cruz Biotechnology) at 4 °C overnight. The binding primary antibody was then incubated with fluorescein-labeled secondary antibody (1:200) (Boster, Wuhan, China) for 1 h in the dark at room temperature. In addition, nuclei were counterstained with DAPI. Fluorescence microscopy (EVOS FL Auto Imaging System, Life technologies, Gaithersburg, MD) was used to visualize fluorescence and acquire images.

Generation of YAP-knockdown cells

Knockdown lentiviruses of Green fluorescent protein (GFP) and puromycin resistance marker YAP were purchased from Tsingke Biotechnology Co. Ltd. First, BMSCs were seeded in six-well plates at a density of 2 × 10⁵ cells per well and cultured for 24 h. According to the instructions for lentivirus transfection, different dilutions of virus were added to BMSCs, and polybrene containing 5 µg/ml was added, and the fresh culture medium was replaced. After 72 h of continuous culture, the fluorescence intensity was observed by fluorescence microscope, and the virus titer with the strongest fluorescence intensity was selected for subsequent experiments. Puromycin was added to screen for resistant cells. After 24 h, fresh medium was replaced to obtain stable YAP-knockdown BMSCs. The efficiency of YAP knockdown was evaluated by qRT-PCR and WB.

The preparation and characterization of hydroxyapatite/collagen type I scaffold (HAC)

According to our previous synthesis method [26], 2.5 g hydroxyapatite powder was dissolved in 0.525 mol/L hydrochloric acid. After ensuring complete dissolution, 3 g type I collagen monomers were added to the above solutions and mixed thoroughly to form a stable solution. Then, the pH and temperature were adjusted to promote the precipitation of HA/Col I complex. It was subsequently freeze-dried, recovered and stored. Scanning electron microscopy (SEM; TESCAN VEGA 3, Brno, Czech Republic) was used to observe the microstructure of the scaffolds and analyze the scaffolds. The porosity of the scaffolds was tested for compressive strength to evaluate their mechanical properties.

Cell proliferation and adhesion on HAC scaffold

To demonstrate cell adhesion to scaffolds, BMSCs were seeded at a density of 5 × 10⁵ cells/well in 24-well plates containing HAC scaffolds and cultured in DMEM/F12 complete medium containing 10% FBS. The cell-loaded HAC scaffolds were washed three times with PBS solution after 5, 7, and 9 days of culture. Next, 2.5% glutaraldehyde was added to cover the scaffold and fixed at 4 ℃ for 4 h. Subsequently, cells on the scaffolds were dehydrated through an ethanol gradient of 50% to 100% and dried under vacuum. After drying, the scaffolds were plated with gold using an ion sputter, and the morphology of BMSCs was observed by scanning electron microscopy(SEM; TESCAN VEGA 3, Brno, Czech Republic). To further evaluate the cell proliferation of HAC scaffolds exposed to EMF, BMSCs were seeded on HAC scaffolds at a density of 5 × 10⁵ cells/well, and these scaffolds were randomly divided into two groups: (1) Control-HAC group: no EMF intervention. (2) EMF-HAC group: treated with EMF. On days 1, 3, and 5, cell proliferation was measured using the CCK-8 kit(Beyotime, Shanghai). The cell proliferation was analyzed by absorbance at 450 nm using a microplate reader (BioTek, USA).

Construction of an interbody fusion model in rats

BMSCs were seeded into 24-well plates containing HAC scaffolds at a density of 2 × 10⁵ cells/well and subsequently cultured in osteogenic medium for selective EMF stimulation for 7 days according to the experimental protocol. According to the type of graft implanted into the intervertebral space, the rats were divided into six groups: (1) Blank group: no stent implanted into the intervertebral space; (2) HAC group: HAC scaffolds were implanted into the intervertebral space; (3) HAC-Cell group: cultured HAC scaffolds with osteogenic induction medium were implanted into the intervertebral space. (4) HAC-Cell-ShRNA group: HAC scaffolds containing transfected ShRNA cells cultured in osteogenic induction medium were implanted into the intervertebral space; (4) HAC-Cell-EMF group: cultured in osteogenic induction medium and stimulated by electromagnetic field, cell-loaded scaffolds were implanted into the intervertebral space. (4) HAC-Cell-ShYAP-EMF group: HAC scaffolds loaded with transfected ShYAP cells cultured in osteogenic induction medium and stimulated by electromagnetic field were implanted into the intervertebral space. For the in vivo study, 36 male SD rats were anesthetized with 1% pentobarbital at a dose of 50 mg/kg. The surgical procedures were performed according to our previous study [27]. Briefly, the rats were placed in the prone position after anesthesia and hair was removed from the surgical area and sterilized with iodophor. Then, tissues adjacent to the vertebral body in the surgical area were dissected to expose the vertebral body, followed by clipping of the spinous process. Afterwards, disc material and endplate cartilage were removed with curettes. Finally, different scaffolds were implanted into the intervertebral space according to the groupings. Customized screws and plates were used to fix the two adjacent vertebral bodies of the intervertebral space, followed by incision suture, and antibiotics injection to prevent infection.

Radiographic evaluation of interbody fusion

The interbody fusion was observed at 8 and 12 weeks after surgery using X-ray(voltage 42 kV, electric current 320 mA, exposure time 8 ms). At the 12th week, the rats were sacrificed using an over dose of sodium pentobarbital and the caudal vertebrae were fixed with 4% paraformaldehyde. The samples were scanned by micro-CT (vivaCT 40, Scanco 274 Medical, Switzerland), it was used to observe the microstructure of the repaired tissue, and three-dimensional reconstruction images were made. micro-CT image analysis and processing software was used to analyze the bone volume (BV), bone volume relative to total volume (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp), in the bone defect site to evaluate the fusion effect of the caudal vertebrae.

Histological methods to assess intervertebral fusion

After completing all the CT scans, the samples were placed in a 10% EDTA solution for decalcification. Subsequently, the decalcified samples underwent gradient alcohol dehydration and were embedded in paraffin to create tissue sections. Hematoxylin and eosin (HE) staining, Masson staining and Immunohistochemical staining were performed to analyze the new bone formation in the interbody space(n = 6).The work has been reported in line with the ARRIVE guidelines 2.0.

Statistical analysis

Each experiment was conducted at least three times. A Student’s t-test was used for comparing two groups, while a one-way ANOVA was used for assessing differences among several groups. Statistical significance is stated as (*,^#) P < 0.05, (**, ^##) P < 0.01, (***, ^###) P < 0.001 and (***, ^####) P < 0.0001.

Result

LF-SEMF can improve the osteogenic differentiation ability of BMSCs

After the exposure of LF-SEMF to BMSCs, we evaluated the osteogenic differentiation ability of BMSCs through Alizarin Red S (ARS) staining, alkaline phosphatase (ALP) staining, and the expression levels of osteogenic-related genes and proteins. BMSCs were seeded in 24-well plates. The Control group and EMF group were cultured with osteogenic induction medium, while the EMF group was stimulated with EMF (1mT, 50 Hz, 4 h/ day). After 7 days of intervention, we analyzed ALP activity using an alkaline phosphatase chromogenic kit. The results showed that ALP staining in the Control group was lighter than that in the EMF group (Fig. 1B). At the same time, there was a significant difference in the proportion of positive staining areas between the two groups. Alizarin red staining results after 14 days of intervention also indicated deeper staining in the EMF group (Fig. 1C), and the proportion of positive staining area was statistically different between the two groups. Both staining results preliminarily confirmed that EMF (1mT 50 Hz 4 h/ day) promoted osteogenic differentiation of BMSCs. According to the above grouping, we extracted RNA from BMSCs of the two groups after 5 days of intervention, and used qRT-PCR to evaluate the expression levels of related genes during osteogenic differentiation of BMSCs. The results showed that, compared with the Control group, the expression of Bone morphogenetic protein-2 (BMP-2), Collagen I (COL-1), Osteocalcin (OCN) and Runt-related transcription factor 2 (RUNX2) in the EMF group was significantly higher than that in the control group. (Fig. 1D–F). This result indicated that BMSCs stimulated by EMF exhibited a stronger tendency to osteogenic differentiation when cultured in osteogenic induction medium. To further verify this result, immunofluorescence staining was used to detect the expression of osteogenesis-related proteins in the two groups after 7 days of cell intervention (Fig. 1G). The results of immunofluorescence semi-quantitative analysis showed that the protein expression levels of OCN and RUNX2 in the EMF group were significantly higher than those in the Control group (Fig. 1H), which was basically consistent with the results of qRT-PCR.

Fig. 1.

LF-SEMF promoted osteogenic differentiation of BMSCs. A Sinusoidal electromagnetic fields generation system(Created with BioRender.com). B Alkaline phosphatase staining images and alizarin red staining of BMSCs after 7 and 14 days of intervention respectively. C The semi-quantitative analysis of staining results. D–F The Relative expression levels of BMP-2, OCN, and RUNX2 genes in BMSCs after 5 days of intervention. G Immunofluorescence images of OCN and RUNX2 in the two groups after 7 days of BMSCs intervention. H Immunofluorescence semi-quantitative results of OCN and RUNX2, n=3 **P < 0.01, ***P<0.001,****P<0.0001

LF-SEMF can increase the activity of YAP and β-catenin in BMSCs

YAP and β-catenin are two key molecules in the Hippo and Wnt signaling pathways, respectively. β-catenin molecule can affect the differentiation of stem cells into osteoblasts, adipocytes and other lineages, and it plays an important role in the process of osteogenesis and angiogenesis. YAP is an important downstream effector of Hippo signaling pathway, which regulates cell differentiation and osteogenic differentiation. Therefore, we investigated the expression levels of key factors in these signaling pathways after intervention with LF-SEMF in BMSCs. qRT-PCR results showed that YAP and β-catenin gene expression levels were significantly increased in BMSCs after LF-SEMF stimulation compared with the Control group(Fig. 2C). In addition, both YAP and β-catenin exert regulatory functions by entering the nucleus and activating downstream target genes. Therefore, through immunofluorescence staining of the Control group and the EMF group, we found that LF-SEMF increased the protein expression levels of YAP and β-catenin and their nuclear co-localization (Fig. 2A, B).

Fig. 2.

Effect of LF-SEMF stimulation on YAP and β-catenin in BMSCs. A, B Immunofluorescence staining images of YAP and β-catenin in BMSCs of the two groups after 7 days of intervention. C The Relative expression levels of YAP and β-catenin genes in BMSCs after 5 days of intervention. (n = 3 *P < 0.05, ****P<0.0001)

LF-SEMF promote the osteogenic differentiation of BMSCs through YAP/β-catenin axis

To further elucidate the signaling pathways involved, YAP shRNA was used to block its signaling in BMSCs under EMF stimulation. Compared with non-specific shRNA, fluorescence images showed that the lentivirus was successfully transfected into BMSCs (Fig.S1A), and WB and qRT-PCR results showed that YAP expression was significantly reduced after YAP shRNA transfection (Fig.S1B). Next, we investigated the role of YAP in the process of osteogenic differentiation of BMSCs stimulated by LF-SEMF. Firstly, we divided them into the following five groups according to the different conditions of the intervention: (1) OM group: only osteogenic medium was added. (2) E-OM group: osteogenic medium was added and stimulated with LF-SEMF. (3) OM-ShRNA group: BMSCs were transfected with osteogenic medium and non-specific shRNA. (4) OM-ShYAP group: osteogenic medium was added and the BMSCs were transfected with YAP shRNA. (5) E-OM-ShYAP group: BMSCs transfected with YAP shRNA were stimulated with LF-SEMF after adding osteogenic medium. The total proteins of these five groups were extracted, and the expression of related proteins was analyzed by WB. WB results showed that there was no significant difference in osteogenic differentiation-related proteins in BMSCs between OM group and OM-ShYAP group, which indicated that non-specific shRNA transfection into BMSCs did not affect the expression of related proteins. However, the expression of osteoblast-related proteins in OM-ShYAP group was significantly lower than that in OM group, indicating that the knockdown of YAP significantly inhibited the osteogenic differentiation of BMSCs. The expression of osteogenesis-related proteins in E-OM-ShYAP group was significantly lower than that in E-OM group. This indicated that YAP knockdown inhibited the osteogenic differentiation of BMSCs promoted by LF-SEMF (Fig. 3A, B). Subsequently, we evaluated the osteogenic differentiation ability of BMSCs by ARS and ALP staining, and these results also supported the above conclusion (Fig. 3C). To verify the downstream pathways of YAP, we found that LF-SEMF not only increased the expression of YAP and β-catenin, but also promoted their translocation to the nucleus (Fig. 3D–F). Interestingly, EMF-induced β-catenin nuclear translocation was almost abolished by YAP knockdown (Fig. 3F, G). Taken together, we can conclude that LF-SEMF activates YAP/β-catenin signaling pathway in BMSCs, which upregulates various osteogenic factors and promotes osteogenic differentiation.

Fig. 3.

LF-SEMF promoted osteogenic differentiation of BMSCs through YAP/β-catenin axis. A, B Western blot analysis of RUNX2 and ALP as well as corresponding semi-quantification of protein expression levels of Runx2 and ALP (Compared with OM group, ns: indicates no statistically significant difference, **P < 0.01, ****P<0.0001;Compared with the E-OM group, ^##P < 0.01, ^###P < 0.001). C Representative pictures of ALP and ARS staining results in each group. D–F Western blot analysis of YAP and β-catenin proteins in BMSCs. G Representative immunofluorescence staining images of the effect of LF-SEMF on YAP/β-catenin signaling pathway.(n = 3 ns: indicates no statistically significant difference, *P < 0.05, **P < 0.01, ****P<0.0001)

Characterization of HAC scaffold

The HAC scaffold we prepared was generally in the shape of a cylinder with a diameter of 3 mm and a height of 2 mm (Fig. 4A). The images presented by scanning electron microscopy showed that the pores inside the HAC scaffold were evenly distributed (Fig. 4B). The average porosity was calculated to be 82.15 ± 9.50%, and the compressive modulus was 14.28 ± 0.86 MPa (Fig. 4C, D).

Fig. 4.

The characterization and biocompatibility of HAC scaffold. A Gross view of the HAC scaffold. B Scanning electron microscopy (SEM) images of HAC scaffold. C, D Mean porosity and compressive modulus of HAC scaffold. E Morphology of BMSCs on HAC scaffolds at 5, 7, and 9 days of culture under SEM. F CCK-8 reagent was used to detect the proliferation of BMSCs on HAC scaffolds

The HAC scaffold showed a good biocompatibility

After BMSCs were inoculated on HAC, the morphology of BMSCs on HAC scaffolds was analyzed and evaluated by scanning electron microscopy. The scanning electron microscopy results showed that cells could diffuse and proliferate within the porous HAC scaffolds (Fig. 3E). After 9 days of culture, the cells almost completely covered the surface of the porous HAC. The above results indicated that the HAC porous scaffolds had good biocompatibility and mechanical properties, and were suitable for BMSCs adhesion and proliferation. Therefore, HAC porous scaffolds could be used as cell scaffolds in bone tissue engineering. The results of the CCK-8 kit showed that cells seeded on scaffolds were healthy regardless of LF-SEMF stimulation(Fig. 3F).

Knockdown of YAP attenuated the influence of LF-SEMF on interbody fusion

We first used X-rays to detect the fusion of the caudal vertebrae in each group of rats from 8 weeks to 12 weeks after surgery. X-ray results showed that the surgical area of each group showed a certain degree of fusion at 12 weeks. Among them, compared with the other five groups, the HUC-cell-EMF group had the best intervertebral fusion effect, and the Blank group had the worst intervertebral fusion effect. Compared with the HAC-Cell-ShYAP-EMF group, the HAC-Cell-ShYAP-EMF group had a worse intervertebral fusion effect. Interestingly, the two groups treated with EMF (HAC-Cell-ShYAP-EMF group and HAC-Cell-EMF group) showed some bone fusion at week 8, while the other groups did not (Fig. 5A). To further analyze and evaluate the effectiveness of interbody fusion between the groups, We used Micro-CT to detect BV、BV/TV、Th、Tb.N、Tb.Sp and the 3D image between the two vertebral bodies in the reconstruction surgery area. The results of the 3D reconstructed images were largely consistent with those observed under X-ray imaging (Fig. 5B). Further analysis of bone formation-related indicators revealed that both the HAC-Cell-ShYAP-EMF group and the HAC-Cell-EMF group exhibited greater amounts of new bone formation compared to the other four groups, with the HAC-Cell-EMF group showing the highest level of new bone (Fig. 5B). No significant differences in any measured parameters were observed between the HAC-Cell-ShRNA group and the HAC-Cell group; however, the new bone mass in the HAC-Cell-EMF group was significantly higher than that in the HAC-Cell-ShRNA group. Notably, although new bone formation was significantly reduced in the HAC-Cell-ShYAP-EMF group compared to the HAC-Cell-EMF group, it remained higher than that in the HAC-Cell group. Additionally, trabecular bone-related indices indicated that the HAC-Cell-ShYAP-EMF group and the HAC-Cell-EMF group had superior new bone strength compared to the other four groups, with the HAC-Cell-EMF group demonstrating the greatest bone strength (Fig. 5C–F).

Fig. 5.

Radiographic evaluation of interbody fusion. (A) X-ray images of intervertebral fusion area at 8 and 12 weeks after operation (Blank group, HAC group, HAC-Cell group, HAC-Cell-ShRNA group, HAC-Cell-EMF group, HAC-Cell-ShYAP-EMF group). (B) 3D reconstruction of the intervertebral fusion area. The fusion of the surgical area was observed from the sagittal plane, coronal plane and transverse plane, respectively. (C-F) Quantification analysis of Bone volume (BV), Bone volume relative to total volume (BV/TV), Trabecular thickness (BV/TV), Bone volume relative to total volume (BV/TV) Th), Trabecular number (Tb.N) and Trabecular Separation (Tb.Sp). (n=6 ns: no statistically significant difference *P < 0.05, **P < 0.01, ***P < 0.001)

The effect of intervertebral fusion was evaluated by histological examination

Subsequently, we performed histological experiments to verify the results. First, we observed collagen and new bone formation in all groups by HE staining and Masson staining. The results showed that there were different degrees of collagen and new bone formation in all groups. In particular, there were more new bone in the HAC-Cell-ShYAP-EMF group and HAC-Cell-EMF group, while the HAC-Cell-EMF group basically achieved interbody fusion. There was no significant difference in collagen formation and new bone formation between the HAC-Cell-ShRNA group and the HAC-Cell group, while the HAC-Cell-ShYAP-EMF group had more new bone formation than the HAC-Cell-ShYAP-EMF group (Fig. 6A, B). Further immunohistochemical and semi-quantitative results of OCN and OPN showed that there were more OCN and OPN positive areas in HAC-Cell-ShYAP-EMF group and HAC-Cell-EMF group, indicating corresponding increased osteogenesis and better intervertebral fusion process (Fig. 6C–F). These imaging and histological findings demonstrated that LF-SEMF stimulation of HAC scaffold loaded with BMSCs effectively promoted new bone formation in intervertebral space, thereby accelerating the process of intervertebral fusion in vivo, while knockdown of YAP in BMSCs attenuated this effect.

Fig. 6.

The effect of intervertebral fusion was evaluated by histological examination. A, B HE and Masson staining images. C, D Immunohistochemical staining and corresponding semi-quantitative analysis of the osteogenic markers OCN (E) and OPN (F). (n = 6 ns: no statistically significant difference *P < 0.05, **P < 0.01, ****P < 0.0001)

Disscution

BMSCs exhibit extensive application potential in the field of bone tissue engineering. As pluripotent stem cells, BMSCs are capable of differentiating into multiple cell lineages, including osteoblasts, making them a crucial cell source for bone tissue regeneration [28]. In recent years, researchers have extensively investigated the osteogenic differentiation capacity and underlying mechanisms of BMSCs under various experimental conditions. For instance, externally applied mechanical forces can activate the PI3K/AKT and cAMP/PKA signaling pathways, which subsequently inhibit GSK3β activity and promote the nuclear translocation of β-catenin—an essential process for bone regeneration [29]. Moreover, BMSCs can enhance bone repair by secreting paracrine factors such as transforming growth factor-β1 (TGF-β1), which modulates the biological activity of osteoblasts [30]. In practical applications, BMSCs can be integrated with various scaffold materials to improve the efficacy of bone regeneration. For example, RGD peptide-conjugated violet crosslinked chitosan scaffolds have been shown to enhance BMSC adhesion and osteogenic differentiation, thereby improving the overall outcome of bone tissue engineering [31]. Additionally, the combination of BMSCs with β-tricalcium phosphate (β-TCP)/collagen type I (COL-I) composite scaffolds significantly upregulates the expression of osteogenic marker genes and proteins, promoting new bone formation [32]. Beyond biomaterial integration, BMSCs can also be co-cultured with other cell types to further enhance their osteogenic potential. Studies have demonstrated that co-culturing BMSCs with periosteum-derived stem cells significantly improves their osteogenic differentiation and angiogenic capabilities [33]. Collectively, these findings highlight the promising prospects of BMSCs in bone tissue engineering and suggest that their clinical efficacy can be further enhanced through optimization of culture conditions and biomaterial combinations.

The roles of two protein molecules, YAP and β-catenin, in the osteogenic differentiation of BMSCs have been extensively studied, highlighting their key roles in the process of bone formation and regeneration [34–36]. In this study, we found that LF-SEMF promoted the osteogenic differentiation of BMSCs by activating the YAP/β-catenin signaling axis. Our results demonstrated that the gene expression levels of YAP and β-catenin were significantly upregulated following LF-SEMF intervention. Moreover, the nuclear translocation of both YAP and β-catenin was enhanced, suggesting a potential synergistic interaction within the nucleus to regulate the transcription of downstream target genes. As a mechanosensitive molecule, YAP is capable of sensing extracellular physical stimuli and converting them into intracellular signaling events [37]. Our findings indicate that LF-SEMF promotes osteogenic differentiation of mesenchymal stem cells (MSCs) through the activation of YAP, which aligns with its known role in bone formation. β-catenin, a central effector molecule in the Wnt signaling pathway, has been extensively studied for its involvement in osteogenic differentiation [38]. Our data revealed that LF-SEMF enhances osteogenic differentiation of BMSCs by increasing both the transcriptional activity and nuclear translocation of β-catenin, thereby activating downstream osteogenesis-related genes such as RUNX2 and ALP. Furthermore, YAP knockdown significantly attenuated the effects of LF-SEMF on osteogenic differentiation and β-catenin nuclear translocation. This study elucidated the key regulatory role of the YAP/β-catenin axis in the response to LF-SEMF, demonstrating that LF-SEMF promoted osteogenic differentiation of BMSCs in vitro via the YAP/β-catenin pathway, with YAP facilitating β-catenin nuclear translocation to synergistically regulate osteogenic differentiation.

Traditional materials for interbody fusion, such as titanium alloy and PEEK, have been widely used, but these materials have certain limitations in biocompatibility and osseointegration ability. The selection of biomaterials is an important aspect in the design of interbody fusion cage. Studies have shown that 3D printed porous titanium alloys have become a promising material for interbody fusion due to their excellent biocompatibility and ability to promote bone growth [39]. The application of tissue engineering technology provides a new idea for the design of interbody fusion cage. For example, Wang et al. showed good bone regeneration ability in vivo experiments using fusion cages prepared from MSCs and bioceramic materials [40]. The combination of biomaterials and tissue engineering technology also provides the possibility of personalized design of interbody fusion cage. Through 3D printing technology, the fusion cage can be customized according to the specific anatomical structure of the patient, so as to improve the accuracy and effect of surgery [41]. The application of bone tissue engineering in interbody fusion cage provides a new solution for spinal fusion surgery. Through the selection of appropriate biological materials, the application of tissue engineering technology and the optimization of structure design, the performance of interbody fusion cage can be significantly improved, which can promote bone fusion and patient rehabilitation. In this study, we used low-frequency alternating electromagnetic fields to promote the osteogenic differentiation of BMSCS in HAC scaffold in vitro, thereby improving the bone regeneration ability of the materials and accelerating intervertebral fusion. The application of electromagnetic field assisted bone tissue engineering in interbody fusion cage provides a new solution for spinal fusion surgery.

Conclusion

The core finding of this study is that LF-SEMF promote the osteogenic differentiation of BMSCs by activating the YAP/β-catenin signaling axis. In the in vivo study, we used LF-SEMF to intervene the HAC scaffold loaded with BMSCs as an interbody fusion cage for interbody fusion in rats, which significantly accelerated the fusion process. This finding is consistent with previous studies reporting positive effects of LF-SEMF in bone tissue repair and regeneration. LF-SEMF provide a suitable microenvironment for interbody fusion by regulating the osteogenic differentiation of BMSCs, which further verifies its potential application value in bone tissue engineering. However, this study also has the following limitations: (1) Although we have preliminarily revealed the role of YAP/β-catenin axis, the specific regulatory network of YAP/β-catenin axis still needs to be further studied. For example, whether YAP and β-catenin synergetically regulate osteogenic differentiation through other signaling pathways remains to be explored. (2) The rat tail fusion model used in this study cannot fully simulate the microenvironment of interbody fusion, and the tail vertebra structure is not load-bearing, so it cannot simulate the biomechanical environment of interbody fusion. Large animal interbody fusion model can be used in the follow-up study. (3) The upstream regulators and downstream target genes of YAP/β-catenin under LF-SEMF were not thoroughly investigated.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

ARS

Alizarin red S staining

ALP

Alkaline phosphatase

BV

Bone volume

BMP-2

Bone morphogenetic protein-2

CT

Computed tomography

COL-1

Collagen I

EMF

Electromagnetic field

FBS

Fetal bovine serum

HE

Hematoxylin-eosin staining

HAC

Hydroxyapatite collagen type I scaffold

LF-SEMF

Low frequency sinusoidal electromagnetic field

LDD

Lumbar degenerative disease

OCN

Osteocalcin

OPN

Osteopontin

RUNX2

Runt-related transcription factor 2

Tb.Th

Trabecular thickness

Tb.N

Trabecular number

Tb.Sp

Trabecular Separation

WB

Western blotting

Author contributions

Guangzi Chen, Chunpin A and Tao Xu were responsible of conceptualization, original draft preparation, experiments and data analysis. WeiGang Li and Li Huang performed the data curation and visualization. Delu Zeng, Gaohong Sheng and Hongqi Zhao performed review editing and supervision. Jian Li and Xuan Fang did the animal experiment. ChaoXu Liu was responsible of project administration and funding acquisition.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Ethical approval was obtained from the Experimental Animal Ethics Committee of Huazhong University of Science and Technology prior to the commencement of the study. Title of the approved project: The mechanism of Low frequency electromagnetic field assisted bone tissue engineering on Intervertebral Fusion and Mechanism Research. Approval Number: [2023] IACUC(3972). Date of approval: 15th January,2023.

Consent for publication

All authors agree to submission of the manuscript and agree to publication.

Competing interests

The authors declare no competing interests.