Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2006 Feb;80(4):1922–1938. doi: 10.1128/JVI.80.4.1922-1938.2006

Insights into Gene Expression Changes Impacting B-Cell Transformation: Cross-Species Microarray Analysis of Bovine Leukemia Virus Tax-Responsive Genes in Ovine B Cells

Pavel Klener 1,2,, Maud Szynal 1,, Yvette Cleuter 1, Makram Merimi 1, Hugues Duvillier 1, Françoise Lallemand 1, Claude Bagnis 3, Philip Griebel 4, Christos Sotiriou 1, Arsène Burny 1, Philippe Martiat 1, Anne Van den Broeke 1,*
PMCID: PMC1367148  PMID: 16439548

Abstract

Large-animal models for leukemia have the potential to aid in the understanding of networks that contribute to oncogenesis. Infection of cattle and sheep with bovine leukemia virus (BLV), a complex retrovirus related to human T-cell leukemia virus type 1 (HTLV-1), is associated with the development of B-cell leukemia. Whereas the natural disease in cattle is characterized by a low tumor incidence, experimental infection of sheep leads to overt leukemia in the majority of infected animals, providing a model for studying the pathogenesis associated with BLV and HTLV-1. TaxBLV, the major oncoprotein, initiates a cascade of events leading toward malignancy, although the basis of transformation is not fully understood. We have taken a cross-species ovine-to-human microarray approach to identify TaxBLV-responsive transcriptional changes in two sets of cultured ovine B cells following retroviral vector-mediated delivery of TaxBLV. Using cDNA-spotted microarrays comprising 10,336 human genes/expressed sequence tags, we identified a cohort of differentially expressed genes, including genes related to apoptosis, DNA transcription, and repair; proto-oncogenes; cell cycle regulators; transcription factors; small Rho GTPases/GTPase-binding proteins; and previously reported TaxHTLV-1-responsive genes. Interestingly, genes known to be associated with human neoplasia, especially B-cell malignancies, were extensively represented. Others were novel or unexpected. The results suggest that TaxBLV deregulates a broad network of interrelated pathways rather than a single B-lineage-specific regulatory process. Although cross-species approaches do not permit a comprehensive analysis of gene expression patterns, they can provide initial clues for the functional roles of genes that participate in B-cell transformation and pinpoint molecular targets not identified using other methods in animal models.


DNA microarray technology has facilitated the identification of a large number of genes involved in the complex deregulation of cell homeostasis taking place in cancer (25, 59). There exists, however, a significant limitation in the variety of organisms for which microarrays have been developed because of a lack of genomic sequence data. Although species-specific small-scale application-targeted arrays are useful for monitoring specific networks of genes (9, 66), they do not address the broad spectrum of genes involved in the complex deregulations taking place in cancer. Larger-scale microarrays for domestic species are currently under investigation, but these emerging tools suffer from a lack of annotated genes. A solution to this limitation is to use microarrays designed for one species to analyze RNA samples from closely related species. The assumption is that the conservation of gene sequences between species will be sufficient to generate a reasonable amount of good-quality data. While there have been relatively few previously published reports that described the use of microarrays for cross-species hybridization (8, 24, 26, 31, 47), this technique is potentially a powerful tool for understanding molecular mechanisms associated with cancer in model organisms such as sheep.

The sheep has been of particular interest as a large-animal model for studying aspects of immunology and offers a number of experimental opportunities that are not available in murine systems. Furthermore, sheep develop B-cell leukemia following experimental transmission of bovine leukemia virus (BLV), a complex retrovirus that is structurally and functionally related to human T-cell leukemia virus type 1 (HTLV-1) (6, 42, 78). This virus-associated leukemia model in sheep has been extensively studied as an in vivo approach to understand the molecular basis of human leukemogenic processes.

Transactivating oncoretroviruses (BLV and HTLV-1) induce tumors after long latency by using poorly understood mechanisms that involve Tax (6, 12, 45, 75). Both TaxHTLV-1 and TaxBLV were originally identified as transcriptional transactivators of viral expression through the indirect binding to Tax-responsive elements located in the viral long terminal repeat (4, 10, 76). Both proteins mediate the transformation of rat embryonic fibroblasts in cooperation with Ha-ras, and injection of these cells induces tumors in nude mice (57, 77). In addition, TaxHTLV-1 immortalizes human T lymphocytes (17), while TaxBLV was recently shown to disrupt the homeostatic control of ovine B cells (65). Altogether, Tax proteins are thought to be the major viral contributors to the leukemogenic processes leading to either T-cell leukemia (HTLV-1) or B-cell malignancy (BLV). Because Tax expression is not required to maintain the transformed phenotype (69, 71), it is believed to act at early stages in the multistep process leading to full malignancy. TaxHTLV-1 has been extensively studied and was found to affect a variety of cellular functions in T cells essentially through its ability to transcriptionally regulate cellular gene expression and functionally inactivate proteins involved in cell cycle progression and DNA repair (14, 36). Using a medium-scale microarray, genes related to apoptosis, the cell cycle, and DNA repair; signaling factors; immune modulators; cytokines; growth factors; and adhesion molecules were identified as TaxHTLV-1 responsive (50).

We have recently provided evidence to support the oncogenic potential of TaxBLV in ovine B cells, and we suggest an important role for NF-κB-dependent pathways in TaxBLV-associated B-cell leukemia (19, 65, 70). So far, however, little is known about the interactions of TaxBLV with cellular proteins, and there is no evidence for TaxBLV-mediated transcriptional changes associated with abnormal B-cell growth. Although there is compelling evidence that TaxBLV is an essential contributor in the initial steps of oncogenesis, it is not sufficient for transformation, and cumulative changes are necessary for the development of overt leukemia. In this study, we examined gene expression changes in response to TaxBLV in an attempt to identify genes that play a role in the molecular events leading to leukemia. We have taken a cross-species ovine-to-human gene-profiling approach using human cDNA microarrays to identify TaxBLV-associated transcriptional changes in two sets of ovine B-cell populations. The rationale behind this study based on cross-species hybridization was not to generate an exhaustive list of differentially expressed genes but rather to provide initial clues for the functional roles of genes that participate in B-cell transformation.

MATERIALS AND METHODS

Cell cultures.

Ovine peripheral blood mononuclear cells (PBMC) were isolated from blood using standard Ficoll-Hypaque separation and maintained in six-well plates (BD Labware) (5 × 106 cells/well) with γ-irradiated murine CD154 (mCD154) L cells (0.4 × 106 cells/well) (a kind gift from Troy Randall) in AIM-V medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 2 mM glutamine, nonessential amino acids, kanamycin (100 μg/ml) (Invitrogen), recombinant human interleukin-2 (IL-2) (20 U/ml), IL-4 (40 U/ml), IL-7 (20 U/ml), and IL-15 (20 U/ml) (Peprotech) (19). Clone2 and Clone2LTAXSN B-cell clones were established from ovine jejunal Peyer's patch (18) and maintained in similar conditions with 2% fetal bovine serum and IL-4 (20 U/ml). All cultures were transferred every 3 to 4 days to fresh medium, cytokines, and mCD154 L cells. The supernatant from PG13-derived retrovirus producer cell lines was used to transduce the SBL (sheep B-lymphocyte) cells as previously described (69). All cultures were incubated at 37°C in a 5% CO2 humidified atmosphere. Viable cell numbers were measured by trypan blue exclusion. Apoptotic cell death was assessed by a terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end-labeling assay according to the manufacturer's instructions (Roche), with the following modifications: cells were fixed in 2% paraformaldehyde and stored at −20°C in 70% ethanol before labeling (65).

RNA extraction and microarray probe preparation.

RNA was extracted using TriPure (Roche) according to the manufacturer's instructions. Quality was assessed using the Agilent 2100 Bioanalyzer (Agilent Technology). Total RNA was linearly amplified according to a method described previously by Eberwine (11), with minor modifications. Briefly, RNA was reverse transcribed using a 63-nucleotide synthetic primer containing the T7 RNA polymerase binding site 5′-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(T)24-3′. Second-strand cDNA synthesis was obtained with RNase H, Escherichia coli DNA polymerase I, and E. coli DNA ligase (Invitrogen). cDNA was blunt ended with T4 DNA polymerase (Invitrogen). Double-stranded cDNA was transcribed using T7 polymerase (Ambion), yielding amplified antisense RNA which was purified using RNeasy Mini-Columns (QIAGEN). Total RNA from the Universal Human Reference (Stratagene) was amplified and used as a reference for microarray analysis. The cDNA microarray chips consisted of 10,336 total features and were manufactured at the Bordet Institute microarray facility using IMAGE clones. Three micrograms of RNA was reverse transcribed and labeled using cyanine 5-conjugated- or cyanine 3-conjugated dUTP. Hybridization was performed in 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and 25% formamide for 14 to 16 h at 42°C. Slides were washed, dried, and scanned using an Axon 4000a laser scanner. A detailed protocol for RNA amplification, cDNA probe labeling, and hybridization is available at http://nciarray.nci.nih.gov/reference/index.shtml. Genepix software (Axon Instruments) was used to analyze the raw data, which were then uploaded to a relational database maintained by the Bordet Institute.

Data analysis.

Images of scanned slides were inspected for artifacts, and aberrant spots and slide regions were flagged for exclusion from analysis. Log ratios for each spot were calculated as follows. In each channel, the signal was calculated as foreground median minus background median. If the signal was less than 300 in any single channel, the signal value in that channel was set to 300. If the signal was less than 300 in both channels, the spot was flagged as unreliable and not used in any further analysis. For all nonflagged spots, a log ratio was calculated as log2 [(red signal)/(green signal)]. The log ratios were then normalized within each array by subtracting from each array the median log ratio value across the spots on the array. The criteria for identifying genes with different levels of expression among the samples were based on the variance of their normalized log ratios across all experiments. The variance of the log ratio of each gene was compared with the median of all the variance, where the median is taken over all genes. A chi-squared statistic was computed in which the theoretical variance of the log ratios under true repetition was estimated by the median of the computed variances, and all genes with significance levels at a P value of >0.01 were filtered out.

Northern blot analysis.

Ten micrograms of total RNA was incubated for 10 min in a solution containing 6 M deionized glyoxal, 50% dimethyl sulfoxide, and 0.1 M phosphate buffer (pH 7.0) on ice followed by 3 min at 55°C. RNA was separated by electrophoresis through a 1% agarose gel containing 10 mM phosphate buffer, transferred onto nylon membranes (Amersham), and UV cross-linked. Hybridization was performed in a solution containing 50% deionized formamide and 5× SSC containing a 32P-labeled TAXBLV or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) probe as previously described (69). Human cDNA probes (LENG5, FOSL2, CART1, methionine aminopeptidase 2 [METAP2], and butyrate response factor 2 [BRF2]) were obtained by T3/T7 PCR amplification of IMAGE clones (Invitrogen) selected according to GenBank accession number from the Invitrogen dbEST clone database. Signals were quantified by densitometric analysis using the Bio-Profil Bio-1D program, Windows Application V99.03.

Quantitative RT-PCR.

cDNA was synthesized by reverse transcription (RT) of total RNA from ovine B cells for 45 min at 42°C using Moloney murine leukemia virus reverse transcriptase (Promega). Real-time quantitative PCR was performed using SYBR green dye (SYBR green PCR master mix; Applied Biosystems) and either ovine (Mcl-1) or bovine (PTK2 and c-FOS) sequence-specific primers (Mcl-1 forward, ACGGCTTTCCAAGGCATG; Mcl-1 reverse, CCATCACTCGAGACAAAGACTTGA; PTK2 forward, CCAAATGGAGCCAGTGAACCT; PTK2 reverse, AAGCACGTGGCCTGCTATG; c-FOS forward, TCAATGACCCTGAGCCCAAG; c-FOS reverse, TCAGCCTTCAGCTCCATGCT). The amplification was performed in an ABI prism 7900 sequence detector system (Applied Biosystems) using 40 cycles of a two-step PCR (15 s at 95°C and 60 s at 60°C) after an initial activation step (95°C for 10 min). Melting curves from 60°C to 99°C were assessed to evaluate specificity. Serial dilutions of purified amplicons served to generate standard melting curves. Amplification of ovine β-actin mRNA as an endogenous control was used to standardize the amount of sample added to the reactions (β-actin forward, CCATCCTGCGTCTGGACCT; β-actin reverse, CCACGTTCCGTGAGGATCTT).

RESULTS

Identification of cellular genes that undergo changes in response to TaxBLV: evaluation of an ovine-to-human microarray approach using a clonal B-cell population.

TaxBLV plays a critical role in the early steps of the leukemogenic process, but so far, there is little information regarding cellular genes that may contribute to the deregulation of B-cell homeostasis. To identify TaxBLV-responsive genes, we used a cross-species microarray approach and well-characterized systems for the culture of primary ovine B cells. We have previously shown that B cells isolated from a variety of sheep lymphoid tissues including Peyer's patches and peripheral blood are permissive to BLV infection (19, 70). These culture systems, dependent on the costimulation with mCD154 and γ chain (γc)-common cytokines, provide an excellent in vitro model for investigating cellular processes resulting from TaxBLV expression. It was deemed appropriate to first use a homogeneous B-cell population for designing optimal experimental conditions and evaluating the feasibility of the ovine-to-human microarray approach. We previously demonstrated the clear supportive role of TaxBLV on the growth of Clone2, a surface immunoglobulin M (IgM) (sIgM)-positive (sIgM+) jejunal Peyer's patch-derived B-cell clone dependent on mCD154 and IL-4 (18, 65). Clone2LTAXSN was derived following retroviral vector-mediated delivery of TaxBLV into Clone2. Both Clone2LTAXSN, which contains detectable TaxBLV protein, and the control parental Clone2 were further used for gene expression profiling.

In the present study, we hybridized cDNA from ovine B-cell cultures to human cDNA-spotted high-density microarrays comprising 10,336 genes/expressed sequence tags (ESTs). Total RNA was extracted from Clone2LTAXSN and Clone2 cells at three time points posttransduction (days 125, 153, and 182) and treated as described in Materials and Methods. Amplified RNA was reverse transcribed and labeled with either cyanine 5-conjugated (Clone2LTAXSN) or cyanine 3-conjugated (Clone2) dUTP. Our experimental design thus included three replicate hybridizations with three independent RNA extractions referred to as hybridizations A, B, and C. The data were first processed as described in detail in Materials and Methods. Only the features that hybridized in at least two out of the three microarray experiments were processed for further analysis.

Ovine cDNA from the B-cell clones hybridized to 6,484 (62.54%) of the human gene targets on a microarray containing 10,336 targets (Table 1). We considered genes that were up- or down-regulated by more than 1.5-fold to be differentially expressed. This cutoff was defined relatively arbitrarily, but as described below, it was independently validated using alternative techniques for measuring relative gene expression. Finally, across all experiments, we identified 263 genes that fulfilled the criterion of differential expression. A total of 211 genes (2.05%) were significantly up-regulated (median, >1.5), and 52 genes (0.50%) were down-regulated (median, <0.66) in Clone2LTAXSN compared to Clone2 cells, respectively. In the gene list presented here, we restricted the data set to a selection of 103 up-regulated (Table 2) and 23 down-regulated (Table 3) genes, according to existing ideas about how altered gene expression may have a functional contribution to the complex processes involved in leukemogenesis. However, to keep the benefits of an unbiased approach, it is important to provide access to the complete lists of altered genes. As our knowledge progresses, we or others might be able to make more sense of the comprehensive expression patterns, ultimately aiding in the understanding of networks that contribute to cancer. The complete microarray data set is available at http://www.bordet.be/servmed/martiat/avdb/data.htm. In Tables 2 and 3, genes are arranged according to the arithmetic means of the relative expression ratios of three independent experiments, experiments A, B, and C. We identified expression changes in genes from distinct groups, including proto-oncogenes; genes regulating apoptosis, DNA transcription, and repair; transcription factors; cell cycle regulators; kinases; phosphatases; and small Rho GTPases/GTPase-binding proteins. It is interesting that genes associated with various human malignancies, especially B-cell tumors, were largely represented among the differentially expressed genes. Other genes were novel or unexpected or had no established role in tumor development. We refer the reader to Discussion (see below) for further details regarding a selection of genes from these lists.

TABLE 1.

Basic evaluation of hybridization and altered gene expression in Tax-positive ovine B-cells using a microarray comprising 10,336 human genes/ESTsa

B-cell line No. (%) of hybridized genes
Overall Expression ratio medians >1.5 Expression ratio medians <0.66 Intersect gene median (>1.5-fold) Intersect gene median (<0.66-fold)
Clone2LTaxSN/Clone2 6,484 (62.5) 211 (2) 52 (0.5) 65 (0.6) 15 (0.15)
SBLTCE/SBLiE 6,360 (61.3) 292 (2.8) 149 (1.4)
a

Numbers of genes detected or scored as differentially expressed are shown.

TABLE 2.

Selected list of genes up-regulated in Clone2LTAXSN compared to Clone2a

GenBank accession no. Gene description Symbol Relative expression ratio (fold) (median >1.5) for hybridization:
Mean
A B C
AA425489 Cartilage paired class homeoprotein 1 CART1 12.099 10.355 5.032 9.162
NM_006682 Fibrinogen like 2 FGL2 6.825 4.976 2.977 4.926
BG527737 Breast carcinoma amplified sequence 2 BCAS2 NA 3.945 1.833 2.889
NM_002398 Meis1, myeloid ecotropic viral integration site 1 homolog (mouse) MEIS1 3.261 NA 2.478 2.870
AA219620 Branched-chain aminotransferase 1, cytosolic BCAT1 3.226 3.134 2.116 2.825
AL536030 Protein phosphatase 2, regulatory subunit B (PR 52), beta isoform PPP2R2B 2.487 3.437 1.997 2.640
U61167 Intersectin 2 ITSN2 3.027 2.620 1.909 2.519
NM_014751 Metastasis suppressor 1 MTSS1 2.804 2.799 1.911 2.505
BE349175 Tumor necrosis factor (ligand) superfamily, member 4 (Tax transcriptionally activated glycoprotein 1; 34 kDa) TNFSF4 2.836 2.378 2.125 2.446
NM_000922 Phosphodiesterase 3B, cyclic GMP inhibited PDE38 2.516 2.645 1.983 2.381
NM_001706 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 2.457 3.057 1.416 2.310
AI432936 Protein phosphatase 1, regulatory (inhibitor) subunit 16B PPP1R16B 2.701 2.235 1.964 2.300
AA731112 Hypothetical protein similar to actin related protein 2/3 complex, subunit 5 MGC3038 2.966 2.146 1.787 2.300
AJ006412 Translation initiation factor IF2 IF2 2.114 3.018 1.757 2.296
AL157608 Ring finger protein 103 RNF103 2.505 2.597 1.778 2.293
AI635077 Structure specific recognition protein 1 SSRP1 1.875 2.928 1.978 2.260
AI954940 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 2.263 2.599 1.870 2.244
AW074517 Protein phosphatase 1B, magnesium dependent, beta isoform PPM1B 2.348 2.786 1.500 2.211
BG400371 Phosphoserine aminotransferase 1 PSAT1 2.291 2.317 2.005 2.204
AL572879 Claudin 4 CLDN4 2.540 2.339 1.717 2.199
AW418782 Butyrate response factor 2 BRF2 2.159 2.631 1.680 2.157
AA737229 Small nuclear ribonucleoprotein polypeptide F SNRPF 2.279 1.914 2.265 2.153
U61276 Jagged 1 (Alagille syndrome) JAG1 2.400 2.161 1.894 2.152
AF139463 Early growth response 2 (Krox-20 homolog; Drosophila) EGR2 3.141 1.778 1.419 2.113
BF339929 Sterol-regulatory element-binding transcription factor 2 SREBF2 2.283 2.303 1.733 2.106
AA481883 ADP-ribosylation-like factor 6-interacting protein 2 ARL6IP2 2.398 2.056 1.857 2.104
NM_002928 Regulator of G-protein signalling 16 RGS16 2.577 1.808 1.788 2.058
NM_001946 Dual-specificity phosphatase 6 DUSP6 2.107 2.051 1.965 2.041
BC002827 Tropomyosin 4 TPM4 2.096 NA 1.952 2.024
AA043151 Ras homolog gene family, member Q ARHQ 2.159 2.001 1.880 2.013
AK026767 Histone deacetylase 7A HDAC7A 1.716 2.453 1.859 2.009
AI088306 FOS-like antigen 2 FOSL2 2.291 1.818 1.884 1.997
NM_014755 Transcriptional regulator interacting with the PHS bromodomain 2 TRIP-Br2 1.995 2.103 1.893 1.997
AL523759 Ras homolog gene family, member B ARHB 2.510 2.228 1.230 1.989
NM_006152 Lymphoid-restricted membrane protein LRMP 2.112 1.874 1.893 1.960
NM_002835 Protein tyrosine phosphatase, nonreceptor type 12 PTPN12 2.013 2.000 1.863 1.959
AA075945 Chaperonin containing TCP1, subunit 7 (eta) CCT7 1.715 2.479 1.663 1.953
AL119232 PTK2 protein tyrosine kinase 2 PTK2 2.026 2.110 1.667 1.934
AA936434 Transcription factor 4 TCF4 2.240 1.564 1.999 1.934
BF529230 Bridging integrator 1 BIN1 2.220 2.169 1.405 1.931
BE327043 Microtubule-associated protein 2 MAP2 2.012 1.815 1.937 1.921
AL541088 Epithelial membrane protein 3 EMP3 1.522 2.885 1.272 1.893
NM_002167 Inhibitor of DNA binding 3, dominant-negative helix-loop-helix protein ID3 1.727 2.098 1.839 1.888
AV747778 v-Fos FBJ murine osteosarcoma viral oncogene homolog FOS 2.368 1.549 1.722 1.880
NM_000660 Transforming growth factor beta 1 (Camurati-Engelmann disease) TGFB1 1.743 2.240 1.649 1.877
NM_003286 Topoisomerase (DNA) I TOP1 2.023 2.032 1.549 1.868
AU120178 Eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67 kDa EIF3S7 1.733 2.025 1.844 1.867
AA910081 Early B-cell factor EBF 1.995 2.063 1.543 1.867
AV714317 TGFB inducible early growth response TIEG 1.613 2.045 1.935 1.865
NM_014735 PHD finger protein 16 PHF16 1.812 2.290 1.485 1.862
AI992326 Protein phosphatase 1G, magnesium dependent, gamma isoform PPM1G 1.825 1.567 2.130 1.841
NM_006769 LIM domain only 4 LMO4 1.745 1.883 1.881 1.836
AA682502 BCL2-like 11 (apoptosis facilitator) BCL2L11 1.530 2.586 1.364 1.827
AU124605 Chaperonin containing TCP1, subunit 4 (delta) CCT4 1.662 2.285 1.502 1.816
AL560086 ADP-ribosylation factor like 1 ARL1 1.929 2.073 1.423 1.808
AA861789 Leukocyte receptor cluster member 5 LENG5 1.708 2.157 1.503 1.789
AU120518 Proliferation-associated 2G4, 38 kDa PA2G4 1.848 1.950 1.565 1.788
NM_003620 p53-induced protein phosphatase 1 PPM1D 2.101 1.430 1.803 1.778
X72889 SWI/SNF-related regulator of chromatin, subfamily A, member 2 SMARCA2 1.518 2.219 1.582 1.773
NM_001675 Activating transcription factor 4 (Tax-responsive enhancer element B67) ATF4 1.554 2.248 1.464 1.755
NM_005738 ADP-ribosylation factor like 4 ARL4 1.836 1.542 1.876 1.751
BF311786 Hexokinase 1 HK1 1.610 1.677 1.940 1.743
BF035921 Lymphocyte cytosolic protein 1 (l-plastin) LCP1 1.712 1.809 1.662 1.727
NM_014367 Growth and transformation-dependent protein E2IG5 1.505 1.729 1.937 1.724
BE408610 Myeloid cell leukemia sequence 1 (BCL2 related) MCL1 2.059 1.707 1.400 1.722
AI394426 Mitogen-activated protein kinase 11 MAPK11 1.726 1.920 1.517 1.721
NM_000177 Gelsolin (amyloidosis, Finnish type) GSN 1.743 1.867 1.510 1.707
BE674356 Chromodomain helicase DNA-binding protein 6 CHD6 1.541 1.626 1.925 1.698
M96954 TIA1 cytotoxic granule-associated RNA-binding protein like 1 TIAL1 1.519 2.004 1.538 1.687
AV742224 60S ribosomal protein L7a (surfeit locus protein 3) (PLA-X polypeptide) L7a 1.649 2.223 1.150 1.674
AU142452 Lactate dehydrogenase A LDHA 1.575 1.938 1.446 1.653
AI348005 B-cell translocation gene 1, antiproliferative BTG1 1.718 1.701 1.524 1.648
NM_002738 Protein kinase C, beta 1 PRKCB1 1.587 1.372 1.959 1.639
AV707380 Repressor of estrogen receptor activity (B-cell-associated protein) REA 1.956 1.440 1.518 1.638
AI075912 Ribosomal protein S26 RPS26 1.636 1.655 1.614 1.635
AW968506 Breast cancer anti-estrogen resistance 3 BCAR3 1.574 NA 1.689 1.632
U33199 Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) MDM2 1.798 1.358 1.721 1.626
BF432072 ATPase, Ca2+ transporting; plasma membrane 1 ATP2B1 1.509 2.071 1.292 1.624
BF978545 Capping protein (actin filament); gelsolin like CAPG 1.687 1.902 1.274 1.621
NM_005886 Katanin p80 (WD repeat-containing) subunit B1 KATNB1 1.620 1.549 1.624 1.598
NM_006094 Deleted in liver cancer 1 DLC1 1.640 1.453 1.694 1.596
AF119836 RAB6A, member of RAS oncogene family RAB6A 1.560 1.575 1.625 1.587
NM_005366 Melanoma antigen family A 11 MAGEA11 1.728 1.561 1.449 1.579
BG428020 Telomeric repeat binding factor 2, interacting protein TERF2IP 1.788 1.664 1.263 1.571
NM_005730 Conserved gene amplified in osteosarcoma OS4 1.849 1.669 1.192 1.570
BG109201 Chromodomain helicase DNA-binding protein 4 CHD4 1.623 2.059 1.021 1.568
AI184621 Methionyl aminopeptidase 2 METAP2 1.382 1.706 1.593 1.561
AI142574 Protein kinase NYD-SP15 NYD-SP15 1.725 1.640 1.300 1.555
AV762663 Small nuclear ribonucleoprotein polypeptide G SNRPG 1.530 1.385 1.736 1.551
BG340581 Sterol-regulatory element-binding transcription factor 2 SREBF2 1.720 1.738 1.175 1.544
AA167701 G-protein pathway suppressor 2 GPS2 1.636 1.780 1.173 1.530
AW028055 Dishevelled-associated activator of morphogenesis 2 DAAM2 1.809 1.583 1.179 1.523
NM_001429 E1A-binding protein p300 EP300 1.305 1.545 1.712 1.521
R46716 Rac GTPase-activating protein 1 RACGAP1 1.637 1.087 1.807 1.510
AA452724 Programmed cell death 5 PDCD5 1.553 1.618 1.328 1.500
BF436055 Polymerase (RNA) II (DNA-directed) polypeptide A; 220 kDa POLR2A 1.670 1.619 1.184 1.491
AI679237 Chromodomain helicase DNA-binding protein 2 CHD2 1.158 1.743 1.525 1.475
M54894 Interleukin 6 (interferon; beta 2) IL6 1.559 1.629 1.232 1.473
BF978116 Cell division cycle associated 8 CDCA8 1.615 1.698 1.069 1.461
AW172382 Serine/threonine kinase 17b (apoptosis inducing) STK17B 1.744 1.562 1.072 1.459
NM_002286 Lymphocyte activation gene 3 LAG3 1.624 1.566 1.153 1.448
NM_000107 Damage-specific DNA-binding protein 2, 48 kDa DDB2 1.506 1.719 1.031 1.418
BG256659 CDC20 cell division cycle 20 homolog (Saccharomyces cerevisiae) CDC20 1.582 1.109 1.530 1.407
a

The numbers in columns A, B, and C represent the relative expression ratios from three replicate hybridizations (A, B, and C) with three independent RNA extractions. The median expression ratio can be read directly. “Mean” shows the arithmetic means of the relative expression ratios of experiments (A, B, and C) and provides additional statistical information. Note that genes are arranged according to the arithmetic means. NA, not analyzed. Complete lists of >1.5-fold and <0.66-fold differentially expressed genes can be found at http://www.bordet.be/servmed/martiat/avdb/data.htm.

TABLE 3.

Selected list of genes down-regulated in Clone2LTAXSN compared to Clone2a

GenBank accession no. Gene description Symbol Relative expression ratio (fold) (median, 0.66) for hybridization:
Mean
A B C
BG026179 Poliovirus receptor related 3 PVRL3 0.161 0.248 0.182 0.197
AL575997 Stathmin 1/oncoprotein 18 STMN1 0.514 0.432 0.570 0.505
U96114 Nedd-4-like ubiquitin-protein ligase WWP2 0.556 0.591 0.606 0.584
NM_000104 Cytochrome P450, family 1, subfamily B, polypeptide 1 CYP1B1 0.626 0.472 0.671 0.590
BG257364 Ras homolog gene family, member H ARHH 0.549 0.602 0.630 0.594
NM_002188 Interleukin-13 IL13 0.537 0.647 0.607 0.597
BF969633 Melanoma antigen, family D, 2 MAGED2 0.529 0.658 0.612 0.600
AA514530 Claudin 18 CLDN18 0.633 0.650 0.579 0.621
BG327949 Tumor rejection antigen (gp96) 1 TRA1 1.000 0.639 0.622 0.631
NM_001315 Mitogen-activated protein kinase 14 MAPK14 0.616 0.630 0.648 0.631
AU151619 Myosin X MYO10 0.511 0.565 0.836 0.637
N67270 Lipoma HMGIC fusion partner LHFP 0.634 0.654 0.627 0.639
BC001746 Protein tyrosine phosphatase, non-receptor type 7 PTPN7 0.635 0.659 0.627 0.640
BE907412 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 0.609 0.546 0.772 0.642
NM_002592 Proliferating cell nuclear antigen PCNA 0.512 0.594 0.832 0.646
X52174 Acid phosphatase, prostate ACPP 0.516 0.616 0.830 0.654
AL520387 Eukaryotic translation initiation factor 4E-binding protein 1 EIF4EBP1 0.590 0.659 0.742 0.664
BE793964 Insulinoma associated 1 INSM1 0.778 0.590 0.633 0.667
BF978554 Accessory protein BAP31 BCAP31 0.634 0.644 0.724 0.668
AF131754 SH3 domain-binding glutamic acid-rich protein like 2 SH3BGRL2 0.544 0.556 0.933 0.678
N71526 Inhibitor of kappa light gene enhancer in B cells, kinase beta IKBKB 0.541 0.599 0.929 0.690
NM_004540 Neural cell adhesion molecule 2 NCAM2 0.572 0.564 0.997 0.711
BG178769 Histone acetyltransferase 1 HAT1 0.613 0.638 0.921 0.724
a

The numbers in columns A, B, and C represent the relative expression ratios from three replicate hybridizations (A, B, and C) with three independent RNA extractions. The median expression ratio can be read directly. “Mean” shows the arithmetic means of the relative expression ratios of experiments (A, B, and C) and provides additional statistical information. Note that genes are arranged according to the arithmetic means. Complete lists of >1.5-fold and <0.66-fold differentially expressed genes can be found at http://www.bordet.be/servmed/martiat/avdb/data.htm.

Important criteria for evaluating any microarray system include the reproducibility of the data, the specificity of detection, and the validity of the results that identify differences in gene expression. Reproducibility was evident when the distributions of data from one replicate to another were compared, as indicated by scatter plots of data generated from replicate hybridizations with independent ovine RNA extractions (data not shown). Furthermore, cDNA from ovine B-cell clones consistently hybridized to human targets known to be expressed in B cells (Ig or Ig-related genes CD79, CD83, REA, BTG1, and early B-cell factor [EBF]) as well as to previously well-documented TaxHTLV-1-responsive genes (activating transcription factor 4 [ATF4], FOS, FOSL2, tumor necrosis factor superfamily member 4 [TNFSF4], and BRF2), thereby demonstrating the specificity of the system. To obtain independent confirmation of the microarray results, both Northern blot analysis and quantitative RT-PCR (qRT-PCR) were performed. Transcription levels of five putative differentially expressed genes (BRF2, LENG5, METAP2, FOSL2, and CART1) with relative expression ratios of >1.5 were examined by Northern blot with human cDNA probes. Analysis of Clone2LTAXSN and Clone2 RNA used for microarray hybridizations A and B confirmed the predicted gene expression patterns (Fig. 1, lanes A and B). Sequence-specific primers were designed for c-FOS, Mcl-1, and PTK2, three overexpressed genes for which the ovine or bovine sequences are known. Using qRT-PCR with these species-specific primers, overexpression was confirmed for all three of the genes examined and ranged between a mean of 1.59- and 1.90-fold (Table 4). In conclusion, there was a good agreement between the microarray and both the Northern blot and qRT-PCR data, thereby validating the microarray results.

FIG. 1.

FIG. 1.

Northern blot confirmation of microarray gene expression patterns. Northern blot analysis of five putative differentially expressed genes confirms their transcriptional up-regulation in TaxBLV-expressing B cells (+) compared to control B cells (−). A and B correspond to RNA extracted from B-cell clones (Clone2LTAXSN/Clone2 cells) used in two independent microarray hybridizations, hybridizations A and B (Table 2), respectively; K stands for RNA extracted from PBMC-derived B cells (SBLTCE/SBLiE) used in microarray hybridization K (Table 4). RNA extracted from ovine B cells was analyzed using the 32P-labeled human cDNA probes BRF2, LENG5, METAP2, FOSL2, CART1, and TAXBLV, described in Materials and Methods. G3PDH was used as a control. The numbers below each pair of signals indicate the relative expression ratios quantitated by densitometry analysis. The numbers in parentheses show the ratios from the corresponding microarray data.

TABLE 4.

qRT-PCR analysis of mRNA levels in ovine B cellsa

Primer Mean relative expression level (fold)
Clone2LTaxSN/Clone2
SBLTCE/SBLiE
qRT-PCR Microarray qRT-PCR Microarray
PTK2 1.90 1.93 4.88 1.95
FOS 1.89 1.88 4.15 1.53
Mcl-1 1.59 1.72 2.62 1.82
a

cDNA was prepared from three independent B-cell cultures and used in qRT-PCR experiments using the SYBR green method and specific primers for ovine (Mcl-1) or bovine (PTK2 and c-FOS) sequences. qRT-PCR levels of RNA for a given gene were normalized against the housekeeping gene β-actin, and levels in Tax+ samples (Clone2LTaxSN or SBLTCE) expressed relative to the expression level in the corresponding Tax sample (Clone2 or SBLiE). Mean relative expression levels of duplicate experiments using three independent RNA samples are shown. The mean expression ratios from the corresponding microarray data are also indicated.

Identification of TaxBLV-responsive genes in peripheral blood-derived ovine B cells.

Gene expression profiling of Clone2LTAXSN B cells using ovine-to-human cross-species microarrays revealed genes that were regulated as a result of TaxBLV expression. However, although the parental Clone2 B cells were initially derived using mCD154 and IL-2, IL-4, IL-7, and IL-15, these cells developed a relative cytokine independence over time (IL-2, IL-7, and IL-15) and increased resistance to cell death with a requirement for only IL-4. This probably reflects the selection of one specific B cell during the cloning process and suggests that physiological changes have occurred in these cells. Thus, although microarray analysis of this B-cell clone was of interest for validating the cross-species hybridization approach, the analysis of Clone2 runs the risk of identifying differences in expression that are not connected to the gene of interest but occur independently of oncogenic processes. To reduce the number of changes that could account for clonal selection, we examined ovine B cells isolated from blood. These B cells were derived from PBMC cultured in the presence of mCD154 and γc-common cytokines IL-2, IL-4, IL-7, and IL-15 as described in detail in Materials and Methods. After a 2-week costimulation period, the cultures consisted exclusively of sIgM+ B cells, as indicated by flow cytometry phenotypic analysis (data not shown), and were referred to as SBL (sheep B lymphocytes). The Clone2 and polyclonal SBL populations probably share many biological similarities in terms of B-cell development stage. The continued expression of sIgM in both populations suggests that their development may be arrested prior to the memory B-cell stage. The SBL, however, represent a more heterogenous sIgM+ B-cell population that has retained its dependence on both mCD154 (T-cell-dependent development) and the γc-common cytokines for continued growth. Thus, the major difference is that SBL cells require a broader range of cytokines, which may reflect the diversity of this B-cell population.

For the transfer of tax cDNA into SBL cells, we designed a vector derived from pSFβ (3), referred to as pSFTaxCMVGFP. In this vector, the BLV tax cDNA is under the control of a hybrid spleen focus-forming virus/murine embryonic stem cell virus promoter demonstrated to be active in a wide range of hematopoietic cells at different stages of differentiation. The enhanced version of the green fluorescent protein (GFP) is under the control of the cytomegalovirus promoter. The pSFiECMVGFP control vector lacks tax. In contrast to the pLTaxSN/pNUNL vectors used for the transduction of Clone2 (65), this type of vector offers the possibility of selecting GFP-positive (GFP+) cells by flow cytometry and monitoring GFP+ cells over time in mixed cultures consisting of both transduced and untransduced cells. The vectors were first evaluated in Clone2 cells, given that TaxBLV expression is known to enhance their viability. Transfer of pSFTaxCMVGFP, but not pSFiECMVGFP, confers a growth advantage to Clone2 cells, confirming that TaxBLV and not the vector itself is involved in the altered phenotype (Fig. 2). The BLV tax cDNA was then delivered into SBL cells using supernatant-mediated retroviral vector transduction, and these cultures were further maintained for 7 days in the presence of mCD154 and IL-2, IL-4, IL-7, and IL-15. The pSFTaxCMVGFP- and pSFiECMVGFP-transduced B cells, referred to as SBLTCE and SBLiE, respectively, were then examined for GFP expression by flow cytometry. The GFP+ cells, representing approximately 5% of the total cell population, were sorted (Fig. 3a), and TaxBLV expression was evaluated by Northern analysis of RNA extracted from the purified B-cell populations (Fig. 3b). We then examined the growth characteristics of these cells and found that the levels of apoptotic cell death were decreased in SBLTCE compared to SBLiE under normal costimulated culture conditions (Fig. 4a) as well as in the absence of γc-common cytokines both with and without mCD154, an essential factor required to support the continuous growth of B cells (Fig. 4b). In addition, we found that SBLTCE cells displayed increased viable cell numbers (Fig. 4c), providing clear evidence that TaxBLV alters the growth of peripheral blood-derived B cells.

FIG. 2.

FIG. 2.

TaxBLV provides a growth advantage to ovine B-cell clones. Clone2 cells were transduced with either pSFTaxCMVGFP or control pSFiECMVGFP retroviral vectors and cultured in the presence of mCD154 and γc-common cytokines. The resulting B-cell populations comprising transduced (+) and untransduced (−) cells, referred to as Clone2iE+/− (a) and Clone2TCE+/− (b), were examined over time for GFP fluorescence using flow cytometry. Percentages of GFP+ cells are shown. Data presented are from one representative example of three independent experiments.

FIG. 3.

FIG. 3.

Flow cytometry sorting of retroviral vector-mediated transduced SBL cells results in highly purified B-cell populations that express TaxBLV. (a) SBL were derived from ovine PBMC cultured in the presence of mCD154 and γc-common cytokines for 14 days. The resulting sIgM+ B cells were transduced with either the pSFTaxCMVGFP retroviral vector encoding both Tax and GFP or the control pSFiECMVGFP retroviral vector for the transfer of GFP alone and further cultured in the presence of mCD154 and γc-common cytokines for 7 days before sorting of the GFP+ cell populations. The resulting GFP+ B-cell populations are referred to as SBLTCE and SBLiE, respectively. (b) Both the SBLTCE and SBLiE populations were examined for Tax expression by Northern analysis using a TAX probe. G3PDH was used as a control of RNA load.

FIG. 4.

FIG. 4.

TaxBLV protects PBMC-derived ovine SBL cells from apoptotic cell death and enhances viable B-cell numbers. SBL cells were cultured in the presence of mCD154 and γc-common cytokines IL-2, IL-4, IL-7, and IL-15. Apoptotic cell death in both SBLTCE and SBLiE cells was examined by a terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end-labeling assay of normal costimulated cultures collected 72 and 96 h after cell passage (a) or after a 24-h culture period in the absence of γc-common cytokines (−cyt) in either the presence or the absence of mCD154 (+CD154/−CD154) (b). Data presented in a and b are means ± standard deviations of values of three independent cultures. Viable SBL cell numbers were determined by trypan blue exclusion at each passage throughout a 40-day culture period (c). Data presented in c are from one representative assay of three independent experiments.

Total RNA was extracted from both the SBLTCE and SBLiE cells at three time points posttransduction (days 128, 157, and 185) and used in ovine-to-human microarrays. The experimental design was similar to that utilized for Clone2 cells. The three replicate hybridizations with three independent RNA extractions are referred hereafter as K, L, and M. Raw data and preliminary results were processed as described above in detail for Clone2LTAXSN/Clone2. From a total of 10,336 spotted genes/ESTs, 6,360 (61.34%) hybridized in at least two out of the three microarray experiments (Table 1). From these, 292 genes (2.82%) were significantly up-regulated (relative expression ratio median, >1.5) and 149 genes (1.44%) were down-regulated (relative expression ratio median, <0.66) in SBLTCE cells compared to SBLiE cells, respectively. In the gene lists shown here, we restricted the displayed data set to a cohort of 107 and 38 genes that were significantly up- or down-regulated, respectively, in the SBLTCE cells compared to the SBLiE cells (Tables 5 and 6). These genes were selected similarly to Clone2LTAXSN/Clone2-associated genes, according to the current knowledge regarding the potential role they might play in the disruption of B-cell homeostasis. The complete microarray data set is also available at http://www.bordet.be/servmed/martiat/avdb/data.htm. Similarly to our observations with Clone2, we found differentially expressed genes in distinct functional categories, suggesting that many aspects of cell physiology are altered in response to TaxBLV. Details related to these genes are provided in Discussion (see below). The ovine-to-human microarray approach was validated in PBMC-derived B cells using the criteria described above for Clone2. We found that data from replicate hybridizations were equally distributed and thus highly reproducible. In addition, targets expected to be expressed in B cells were consistently detected, while known TaxHTLV-1-responsive genes were found to be differentially expressed, suggesting the specificity of detection of the method. Finally, overexpression was independently confirmed both by Northern blot analysis using human cDNA probes for BRF2, LENG5, METAP2, FOSL2, and CART1 (Fig. 1, lane K) and by qRT-PCR with ovine or bovine sequence-specific primers for c-FOS, Mcl-1, and PTK2 (Table 4). The qRT-PCR severalfold changes were consistently higher than the microarray ratios, but given that species-specific primers were used, they should be a better reflection of the relative gene expression levels. Altogether, these results validate the gene expression data and provide a rationale for the microarray cutoffs. Our observations suggest that gene expression profiling of PBMC-derived ovine B cells may provide insights into the mechanisms by which complex retroviruses induce malignancy.

TABLE 5.

Selected list of genes up-regulated in SBLTCE compared to SBLiE

GenBank accession no. Gene description Symbol Relative expression level (fold) (median, >1.5) for hybridization:
Mean
K L M
NM_000138 Fibrillin 1 (Marfan syndrome) FBN1 7.054 4.372 4.579 5.335
AA425489 Cartilage paired-class homeoprotein 1 CART1 3.238 3.985 4.498 3.907
AL541088 Epithelial membrane protein 3 EMP3 2.474 3.517 3.537 3.176
BC002827 Tropomyosin 4 TPM4 1.000 3.679 2.146 2.913
BF432072 ATPase, Ca2+ transporting, plasma membrane 1 ATP2B1 3.718 2.368 2.359 2.815
BE856759 Scaffold attachment factor B2 SAFB2 1.000 2.973 2.608 2.791
AW418782 Butyrate response factor 2 BRF2 2.381 3.207 2.601 2.730
BE502910 Nebulette NEBL 2.841 1.986 3.151 2.659
AL536030 Protein phosphatase 2, regulatory subunit B (PR 52), beta isoform PPP2R2B 2.754 2.221 2.850 2.608
BG163850 Caldesmon 1 CALD1 1.954 2.791 3.040 2.595
AU142452 Lactate dehydrogenase A LDHA 2.401 2.571 2.542 2.505
AA477295 Activated RNA polymerase II transcription cofactor 4 PC4 2.278 3.096 2.104 2.493
AA682502 BCL2 like 11 (apoptosis facilitator) BCL2L11 2.205 2.174 2.532 2.304
BF311786 Hexokinase 1 HK1 2.128 2.368 2.368 2.288
BF978116 Cell division cycle associated 8 CDCA8 2.785 1.920 2.080 2.261
AL527028 Solute carrier family 25 (mitochondrial carrier), member 6 SLC25A6 2.547 2.018 2.148 2.238
AA283746 Tropomyosin 2 (beta) TPM2 2.540 2.178 1.925 2.214
BE502193 Glioblastoma amplified sequence GBAS 2.575 2.026 1.975 2.192
NM_014767 Sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 SPOCK2 2.400 1.881 2.069 2.117
W25414 Tubulin, gamma complex-associated protein 2 TUBGCP2 1.989 2.253 2.075 2.105
AA075945 Chaperonin containing TCP1, subunit 7 (eta) CCT7 2.749 1.679 1.804 2.078
NM_015185 Cdc42 guanine nucleotide exchange factor 9 ARHGEF9 2.174 1.920 2.080 2.058
NM_002129 High-mobility group box 2 HMGB2 2.371 1.841 1.917 2.043
NM_000019 Acetyl coenzyme A acetyltransferase 1 (acetoacetyl coenzyme A thiolase) ACAT1 2.500 1.915 1.664 2.026
AL555167 Signal peptidase complex (18 kDa) SPC18 2.594 1.827 1.631 2.017
BE740909 ADP-ribosyltransferase [NAD+; poly(ADP-ribose) polymerase] ADPRT 2.686 1.665 1.684 2.012
NM_003670 Basic helix-loop-helix domain containing, class B, 2 BHLHB2 2.470 1.624 1.932 2.009
NM_002835 Protein tyrosine phosphatase, non-receptor type 12 PTPN12 2.440 1.902 1.668 2.004
NM_001675 Activating transcription factor 4 (Tax-responsive enhancer element B67) ATF4 2.127 1.939 1.908 1.991
BG032173 Heat shock protein 60 (P60 lymphocyte protein) HSPD1 2.719 1.653 1.600 1.991
AA910081 Early B-cell factor EBF 2.135 2.127 1.682 1.981
BF239180 SMC4 structural maintenance of chromosome 4-like 1 (yeast) SMC4L1 2.420 1.751 1.696 1.956
AL119232 PTK2 protein tyrosine kinase 2 PTK2 2.296 1.757 1.811 1.955
AL556879 RNA-binding motif protein 5 RBM5 2.435 1.789 1.576 1.933
BE252062 Coronin, actin-binding protein, 1A CORO1A 1.821 2.063 1.875 1.920
BE880168 Integrin, beta 1 (fibronectin receptor, beta polypeptide) ITGB1 2.347 1.868 1.542 1.919
AA737229 Small nuclear ribonucleoprotein polypeptide F SNRPF 2.752 1.320 1.681 1.918
AA313584 Eukaryotic translation initiation factor 3, subunit 3 gamma, 40 kDa EIF3S3 2.136 1.881 1.729 1.915
AU120178 Eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67 kDa EIF3S7 2.102 1.938 1.702 1.914
BG527737 Breast carcinoma amplified sequence 2 BCAS2 2.445 1.583 1.684 1.904
AK025306 CDC-like kinase 1 CLK1 2.235 1.999 1.461 1.898
BG399003 ADP-ribosylation factor-like 6-interacting protein ARL6IP 2.506 1.670 1.485 1.887
AI889521 Ras homolog enriched in brain 2 RHEB2 1.701 2.032 1.926 1.887
AA452724 Programmed cell death 5 PDCD5 2.586 1.375 1.691 1.884
AU124605 Chaperonin-containing TCP1, subunit 4 (delta) CCT4 2.475 1.578 1.567 1.873
NM_005886 Katanin p80 (WD repeat-containing) subunit B1 KATNB1 2.432 1.346 1.826 1.868
NM_015640 PAI-1 mRNA-binding protein PAI-RBP1 2.109 1.900 1.562 1.857
AU120518 Proliferation-associated 2G4, 38 kDa PA2G4 2.241 1.611 1.679 1.844
AL530970 Nonmetastatic cells 1, protein (NM23A) expressed in NME1 2.160 1.919 1.444 1.841
BE535239 Heterogeneous nuclear ribonucleoprotein A0 HNRPA0 2.300 1.652 1.562 1.838
BE408610 Myeloid cell leukemia sequence 1 (BCL2 related) MCL1 1.982 1.435 2.046 1.821
BC000196 Cyclin G1 CCNG1 2.311 1.525 1.593 1.810
NM_000922 Phosphodiesterase 3B, cyclic GMP inhibited PDE3B 1.819 1.774 1.820 1.804
AA861789 Leukocyte receptor cluster member 5 LENG5 2.006 1.742 1.634 1.794
AU135444 CDC10 cell division cycle 10 homolog (S. cerevisiae) CDC10 2.072 1.800 1.509 1.794
NM_003286 Topoisomerase (DNA) I TOP1 1.933 1.776 1.664 1.791
NM_003601 SWI/SNF-related regulator of chromatin, subfamily a, member 5 SMARCA5 2.398 1.435 1.530 1.788
NM_004703 Rabaptin-5 RAB5EP 2.318 1.664 1.364 1.782
AB020723 Protein associated with Myc PAM 1.871 1.904 1.495 1.757
BG029685 CUG triplet repeat, RNA-binding protein 1 CUGBP1 1.961 1.689 1.607 1.752
BG473688 AHNAK nucleoprotein (desmoyokin) AHNAK 2.098 1.512 1.632 1.748
M20642 Myosin, light polypeptide 1, alkali; skeletal, fast MYL1 1.795 1.593 1.854 1.747
NM_003156 Stromal interaction molecule 1 STIM1 2.157 1.572 1.508 1.745
BE268036 Polymerase (RNA) II (DNA-directed) polypeptide B, 140 kDa POLR2B 2.132 1.530 1.567 1.743
AW241775 RNA-binding motif protein 15 RBM15 2.019 1.402 1.800 1.740
AW189528 LIM and SH3 protein 1 LASP1 2.211 1.786 1.170 1.722
BF305705 Histone deacetylase 5 HDAC5 1.674 1.965 1.522 1.721
X72889 SWI/SNF-related regulator of chromatin, subfamily a, member 2 SMARCA2 2.095 1.531 1.528 1.718
BF439104 DNA (cytosine-5)-methyltransferase 1 DNMT1 1.658 1.945 1.547 1.717
D86550 Dual-specificity tyrosine (Y) phosphorylation-regulated kinase 1A DYRK1A 1.725 1.855 1.530 1.703
AI827301 Vascular endothelial growth factor VEGF 1.723 1.916 1.455 1.698
AA312869 Vaccinia-related kinase 1 VRK1 1.734 1.633 1.724 1.697
AJ006412 Translation initiation factor IF2 IF2 2.024 1.575 1.414 1.671
BG032225 Integrin cytoplasmic domain-associated protein 1 ICAP-1A 1.568 1.730 1.699 1.665
AI184621 Methionyl aminopeptidase 2 METAP2 1.742 1.459 1.775 1.659
AV714317 TGFB inducible early growth response TIEG 1.494 1.904 1.574 1.657
NM_003600 Serine/threonine kinase 6 STK6 2.038 1.722 1.211 1.657
NM_014751 Metastasis suppressor 1 MTSS1 1.551 1.762 1.000 1.656
BE467537 Cyclin-dependent kinase 8 CDK8 1.557 1.802 1.579 1.646
BG178769 Histone acetyltransferase 1 HAT1 1.826 1.806 1.296 1.643
NM_005253 FOS-like antigen 2 FOSL2 1.865 1.647 1.389 1.634
AL549027 Fusion, derived from t(12;16) malignant liposarcoma FUS 2.083 1.290 1.524 1.633
AI394426 Mitogen-activated protein kinase 11 MAPK11 1.941 1.318 1.610 1.623
AU125722 Phosphoprotein regulated by mitogenic pathways C8FW 1.979 1.508 1.354 1.613
AI636054 Bcl-2-associated transcription factor BTF 1.880 1.523 1.362 1.588
AW955286 Mago-Nashi homolog, proliferation associated (Drosophila) MAGOH 1.651 1.584 1.516 1.584
AW275000 Translocated promoter region (to activated MET oncogene) TPR 1.707 1.672 1.369 1.583
AL544297 Interferon-induced protein with tetratricopeptide repeats 4 IFIT4 1.556 1.714 1.470 1.580
BG256659 CDC20 cell division cycle 20 homolog (S. cerevisiae) CDC20 1.910 1.221 1.595 1.575
AI992326 Protein phosphatase 1G, magnesium dependent, gamma isoform PPM1G 1.829 1.661 1.230 1.573
AU146354 Cell division cycle 42 (GTP-binding protein; 25 kDa) CDC42 1.676 1.802 1.224 1.567
AU118099 TAF15 RNA polymerase II, TATA box-binding protein-associated factor TAF15 1.929 1.194 1.572 1.565
BG036342 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70-interacting protein) ST13 1.824 1.314 1.527 1.555
NM_001706 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 1.000 1.549 1.552 1.550
BC001149 Serologically defined colon cancer antigen 16 SDCCAG16 1.502 1.602 1.532 1.546
AV742224 60S ribosomal protein L7a (Surfeit locus protein 3) (PLA-X polypeptide) L7a 1.424 1.504 1.707 1.545
BG532217 Rab geranylgeranyltransferase, beta subunit RABGGTB 1.632 1.496 1.501 1.543
AI207650 APEX nuclease (multifunctional DNA repair enzyme) 1 APEX1 1.277 1.809 1.507 1.531
AV747778 v-Fos FBJ murine osteosarcoma viral oncogene homolog FOS 1.512 1.797 1.283 1.531
AW020536 Bromodomain containing 8 BRD8 1.542 1.543 1.449 1.511
AI884571 Splicing factor (45 kDa) SPF45 1.208 1.732 1.579 1.506
AL524788 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) RAD51 1.618 1.557 1.344 1.506
D87461 BCL2 like 2 BCL2L2 1.365 1.585 1.559 1.503
NM_006769 LIM domain only 4 LMO4 1.541 1.338 1.550 1.476
BG475196 E1A-binding protein p400 EP400 1.510 1.595 1.316 1.474
AA167701 G-protein pathway suppressor 2 GPS2 1.713 1.150 1.509 1.458
a

The numbers in columns K, L, and M represent the relative expression ratios from three replicate hybridizations (K, L, and M) with three independent RNA extractions. The median expression ratio can be read directly. “Mean” shows the arithmetic means of the relative expression ratios of experiments (K, L, and M) and provides additional statistical information. Note that genes are arranged according to the arithmetic means. Complete lists of >1.5-fold and <0.66-fold differentially expressed genes can be found at http://www.bordet.be/servmed/martiat/avdb/data.htm.

TABLE 6.

Selected list of genes down regulated in SBLTCE compared to SBLiEa

GenBank accession no. Gene description Symbol Relative expression ratio (fold) (median, <0.66) for hybridization:
Mean
K L M
NM_014890 Downregulated in ovarian cancer 1 DOC1 0.345 0.470 NA 0.407
NM_023111 Fibroblast growth factor receptor 1 (Pfeiffer syndrome) FGFR1 0.419 0.425 0.452 0.432
AL043206 Heat shock 70-kDa protein 5 (glucose-regulated protein; 78 kDa) HSPA5 0.565 0.450 0.378 0.464
NM_016952 Cell adhesion molecule related/down-regulated by oncogenes CDON 0.458 0.521 NA 0.489
NM_002844 Protein tyrosine phosphatase, receptor type, K PTPRK 0.403 0.605 0.470 0.493
BF446905 Kruppel-like factor 4 (gut) KLF4 0.559 0.441 0.497 0.499
N67270 Lipoma HMGIC fusion partner LHFP 0.482 0.444 0.586 0.504
NM_004540 Neural cell adhesion molecule 2 NCAM2 0.452 0.536 0.546 0.511
AF131754 SH3 domain-binding glutamic acid-rich protein like 2 SH3BGRL2 0.508 0.568 0.514 0.530
U37546 Baculoviral IAP repeat-containing 3 BIRC3 0.671 0.554 0.483 0.569
BE907412 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 0.579 0.542 0.596 0.572
AV708790 Protein phosphatase 2, regulatory subunit B (B56), beta isoform PPP2R5B 0.551 0.623 NA 0.587
AU159482 PRKR-interacting protein 1 (IL-11 inducible) PRKRIP1 0.576 0.576 0.613 0.588
AW963298 Runt-related transcription factor 1 (acute myeloid leukemia 1; AM/1 oncogene) RUNX1 0.535 0.618 0.646 0.600
BE907932 CD63 antigen (melanoma 1 antigen) CD63 0.623 0.645 0.536 0.601
M78435 Myeloid/lymphoid or mixed-lineage leukemia 2 MLL2 0.637 0.566 NA 0.602
NM_003504 CDC45 cell division cycle 45 like (S. cerevisiae) CDC45L 0.559 0.671 0.595 0.608
NM_004554 Nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4 NFATC4 0.542 0.571 0.712 0.608
BG327949 Tumor rejection antigen (gp96) 1 TRA1 0.915 0.536 0.444 0.632
BG257364 Ras homolog gene family, member H ARHH 0.652 0.609 0.638 0.633
AA034116 GRB2-associated binding protein 3 GAB3 0.595 0.553 0.771 0.639
AB015653 Caspase 9, apoptosis-related cysteine protease CASP9 0.718 0.598 0.628 0.648
NM_006143 G-protein-coupled receptor 19 GPR19 0.640 0.592 0.724 0.652
AB007924 Plasticity-related gene 1 PRG1 0.787 0.603 0.586 0.659
NM_004658 RAS protein activator like 1 (GAP1 like) RASAL1 0.617 0.601 0.778 0.666
M11568 Insulin-like growth factor 1 (somatomedin C) IGF1 0.624 0.496 0.924 0.681
NM_005245 FAT tumor suppressor homolog 1 (Drosophila) FAT 0.644 0.842 0.566 0.684
NM_002868 RAB5B, member of RAS oncogene family RAB5B 0.511 0.643 0.911 0.689
NM_002921 Retinal G-protein-coupled receptor RGR 0.639 0.577 0.881 0.699
AI870850 RAD1 homolog (Schizosaccharomyces pombe) RAD1 0.652 0.655 0.837 0.715
a

The numbers in columns K, L, and M represent the relative expression ratios from three replicate hybridizations (K, L, and M) with three independent RNA extractions. The median expression ratio can be read directly. “Mean” shows the arithmetic means of the relative expression ratios of experiments (K, L, and M) and provides additional statistical information. Note that genes are arranged according to the arithmetic means. NA, not analyzed. Complete lists of >1.5-fold and <0.66-fold differentially expressed genes can be found at http://www.bordet.be/servmed/martiat/avdb/data.htm.

Intersect of TaxBLV-responsive differentially expressed genes between Peyer's patch B-cell clones and PBMC-derived B cells.

We compared the data sets derived from Clone2LTAXSN/Clone2 cells with those from SBLTCE/SBLiE cells to identify genes differentially expressed in both systems. We detected 80 genes with significant altered expression in both Clone2LTAXSN and SBLTCE cells, emphasizing their putative role in TaxBLV-associated deregulation. Sixty-five genes were commonly up-regulated, while only 15 genes were scored as down-regulated. Tables 7 and 8 display a list of 59 up-regulated and 11 down-regulated genes, respectively. Thus, overlapping yet distinct gene expression patterns are associated with TaxBLV-mediated phenotypic changes in Peyer's patch- and PBMC-derived ovine B cells (Fig. 5). We then compared the distribution of data from one cell type to the other and found that TaxBLV induced similar changes of overall expression profiles in both ovine B-cell populations (Fig. 6). In sharp contrast, we identified only one single gene (HAT1 [histone acetyltransferase 1]) that was significantly up-regulated in one B-cell population (SBL) while it was down-regulated in the other (Clone2). Genes found to be differentially expressed in both B-cell populations likely play significant roles in signaling networks in which Tax participates. In this group (Tables 7 and 8), we once more identified genes from various functional categories expected to play a role in leukemogenesis, genes previously found to have altered expression in well-documented human cancers, as well as the TaxHTLV-1-responsive genes ATF4, FOS, and BRF2.

TABLE 7.

Genes up-regulated in both Clone2LTAXSN and SBLTCE compared to the controlsa

GenBank accession no. Gene description Symbol Relative expression ratio (fold) (median, >1.5) for hybridization of:
Clone2LTAXSN
SBLTCE
A B C Mean K L M Mean
AA425489 Cartilage paired-class homeoprotein 1 CART1 12.090 10.350 5.032 9.162 3.238 3.985 4.498 3.907
BG527737 Breast carcinoma amplified sequence 2 BCAS2 1.000 3.945 1.833 2.889 2.445 1.583 1.684 1.904
AL536030 Protein phosphatase 2, regulatory subunit B (PR 52), beta isoform PPP2R2B 2.487 3.437 1.997 2.640 2.754 2.221 2.850 2.608
NM_014751 Metastasis suppressor 1 MTSS1 2.804 2.799 1.911 2.505 1.551 1.762 1.000 1.656
NM_000922 Phosphodiesterase 3B, cyclic GMP inhibited PDE3B 2.516 2.645 1.983 2.381 1.819 1.774 1.820 1.804
AB033066 KIAA1240 protein KIAA1240 2.397 2.732 1.970 2.366 2.123 1.803 1.247 1.724
NM_001706 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 2.457 3.057 1.416 2.310 1.000 1.549 1.552 1.550
AJ006412 Translation initiation factor IF2 IF2 2.114 3.018 1.757 2.296 2.024 1.575 1.414 1.671
AL157608 Ring finger protein 103 RNF103 2.505 2.597 1.778 2.293 1.351 1.922 1.621 1.631
AW418782 Butyrate response factor 2 BRF2 2.159 2.631 1.680 2.157 2.381 3.207 2.601 2.730
AA737229 Small nuclear ribonucleoprotein polypeptide F SNRPF 2.279 1.914 2.265 2.153 2.752 1.320 1.681 1.918
BC002827 Tropomyosin 4 TPM4 2.096 1.000 1.952 2.024 1.000 3.679 2.146 2.913
NM_002835 Protein tyrosine phosphatase, non-receptor type 12 PTPN12 2.013 2.000 1.863 1.959 2.440 1.902 1.668 2.004
AA075945 Chaperonin containing TCP1, subunit 7 (eta) CCT7 1.715 2.479 1.663 1.953 2.749 1.679 1.804 2.078
AL119232 PTK2 protein tyrosine kinase 2 PTK2 2.026 2.110 1.667 1.934 2.296 1.757 1.811 1.955
AL541088 Epithelial membrane protein 3 EMP3 1.522 2.885 1.272 1.893 2.474 3.517 3.537 3.176
AV747778 v-Fos FBJ murine osteosarcoma viral oncogene homolog FOS 2.368 1.549 1.722 1.880 1.512 1.797 1.283 1.531
NM_003286 Topoisomerase (DNA) I TOP1 2.023 2.032 1.549 1.868 1.933 1.776 1.664 1.791
AU120178 Eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67 kDa EIF3S7 1.733 2.025 1.844 1.867 2.102 1.938 1.702 1.914
AA910081 Early B-cell factor EBF 1.995 2.063 1.543 1.867 2.135 2.127 1.682 1.981
AV714317 TGFB inducible early growth response TIEG 1.613 2.045 1.935 1.865 1.494 1.904 1.574 1.657
NM_014735 PHD finger protein 16 PHF16 1.812 2.290 1.485 1.862 1.459 1.957 1.569 1.662
AI992326 Protein phosphatase 1G, magnesium dependent, gamma isoform PPM1G 1.825 1.567 2.130 1.841 1.829 1.661 1.230 1.573
BG176768 Major histocompatibility complex class II, DO beta HLA-DOB 1.719 2.158 1.633 1.836 1.732 1.658 1.392 1.594
NM_006769 LIM domain only 4 LMO4 1.745 1.883 1.881 1.836 1.541 1.338 1.550 1.476
AA682502 BCL2 like 11 (apoptosis facilitator) BCL2L11 1.530 2.586 1.364 1.827 2.205 2.174 2.532 2.304
AU124605 Chaperonin containing TCP1, subunit 4 (delta) CCT4 1.662 2.285 1.502 1.816 2.475 1.578 1.567 1.873
BE168491 Major histocompatibility complex class IC HLA-C 1.628 1.970 1.830 1.809 1.152 1.838 1.579 1.523
AA861789 Leukocyte receptor cluster member 5 LENG5 1.708 2.157 1.503 1.789 2.006 1.742 1.634 1.794
AU120518 Proliferation-associated 2G4, 38 kDa PA2G4 1.848 1.950 1.565 1.788 2.241 1.611 1.679 1.844
NM_000019 Acetyl coenzyme A acetyltransferase 1 (acetoacetyl coenzyme A thiolase) ACAT1 1.707 1.885 1.751 1.781 2.500 1.915 1.664 2.026
X72889 SWI/SNF-related regulator of chromatin, subfamily a, member 2 SMARCA2 1.518 2.219 1.582 1.773 2.095 1.531 1.528 1.718
AB014512 Benzodiazapine receptor (peripheral)-associated protein 1 BZRAP1 2.363 1.595 1.322 1.760 1.542 1.343 1.550 1.478
NM_001675 Activating transcription factor 4 (Tax-responsive enhancer element B67) ATF4 1.554 2.248 1.464 1.755 2.127 1.939 1.908 1.991
BF311786 Hexokinase 1 HK1 1.610 1.677 1.940 1.743 2.128 2.368 2.368 2.288
BE408610 Myeloid cell leukemia sequence 1 (BCL2 related) MCL1 2.059 1.707 1.400 1.722 1.982 1.435 2.046 1.821
AI394426 Mitogen-activated protein kinase 11 MAPK11 1.726 1.920 1.517 1.721 1.941 1.318 1.610 1.623
D87446 Likely ortholog of mouse Rw1 RW1 1.564 2.068 1.492 1.708 1.597 1.393 1.514 1.501
M96954 TIA1 cytotoxic granule-associated RNA-binding protein like 1 TIAL1 1.519 2.004 1.538 1.687 1.704 1.354 1.702 1.587
AV742224 60S ribosomal protein L7a (Surfeit locus protein 3) (PLA-X polypeptide) L7a 1.649 2.223 1.150 1.674 1.424 1.504 1.707 1.545
BF206100 Solute carrier family 1 (neutral amino acid transporter), member 5 SLC1A5 1.647 1.919 1.434 1.667 1.754 1.620 1.311 1.561
AW117731 3-Hydroxy-3-methylglutaryl-coenzyme A synthase 1 (soluble) HMGCS1 1.414 1.942 1.632 1.663 1.639 1.517 1.920 1.692
AU142452 Lactate dehydrogenase A LDHA 1.575 1.938 1.446 1.653 2.401 2.571 2.542 2.505
AI075912 Ribosomal protein S26 RPS26 1.636 1.655 1.614 1.635 1.714 1.181 1.538 1.478
BF432072 ATPase; Ca2+ transporting; plasma membrane 1 ATP2B1 1.509 2.071 1.292 1.624 3.718 2.368 2.359 2.815
AL527028 Solute carrier family 25 (mitochondrial carrier), member 6 SLC25A6 1.583 1.757 1.461 1.600 2.547 2.018 2.148 2.238
NM_005886 Katanin p80 (WD repeat-containing) subunit B1 KATNB1 1.620 1.549 1.624 1.598 2.432 1.346 1.826 1.868
AI923541 Proteasome (prosome; macropain) subunit, beta type, 9 PSMB9 1.774 1.813 1.186 1.591 1.686 1.392 1.615 1.564
BE742483 Heat shock 70-kDa protein 4 HSPA4 1.613 1.826 1.270 1.570 1.808 1.100 1.509 1.472
AI184621 Methionyl aminopeptidase 2 METAP2 1.382 1.706 1.593 1.561 1.742 1.459 1.775 1.659
AI142574 Protein kinase NYD-SP15 NYD-SP15 1.725 1.640 1.300 1.555 1.728 1.799 1.847 1.791
NM_000928 Phospholipase A2, group IB (pancreas) PLA2G1B 1.724 1.644 1.234 1.534 2.054 1.685 1.540 1.760
AA167701 G-protein pathway suppressor 2 GPS2 1.636 1.780 1.173 1.530 1.713 1.150 1.509 1.458
AA452724 Programmed cell death 5 PDCD5 1.553 1.618 1.328 1.500 2.586 1.375 1.691 1.884
BF978116 Cell division cycle associated 8 CDCA8 1.615 1.698 1.069 1.461 2.785 1.920 2.080 2.261
AV658656 N-Acetyltransferase 2 (arylamine N-acetyltransferase) NAT2 1.524 1.522 1.325 1.457 1.869 1.381 1.545 1.599
BG032173 Heat shock protein 60 (P60 lymphocyte protein) HSPD1 1.510 1.787 1.008 1.435 2.719 1.653 1.600 1.991
BG256659 CDC20 cell division cycle 20 homolog (S. cerevisiae) CDC20 1.582 1.109 1.530 1.407 1.910 1.221 1.595 1.575
AL050081 Hypothetical protein FLJ31657 FLJ31657 1.579 1.608 1.025 1.404 1.775 1.505 1.326 1.535
a

The numbers in columns A, B, and C and K, L, and M represent the relative expression ratios from replicate hybridizations for Clone2LTAXSN (A, B, and C) and SBLTCE (K, L, and M), respectively, performed using three independent RNA extractions for each cell type. The median expression ratio can be read directly. “Mean” shows the arithmetic means of the relative expression ratios of experiments (A, B, and C and K, L, and M, respectively) and provides additional statistical information. Note that genes are arranged according to the arithmetic means. Table 7 represents a comprehensive list of genes with relative expression ratio medians changed >1.5-fold across all six microarray experiments; 10 features that could not be properly analyzed according to the GenBank database were excluded.

TABLE 8.

Genes down-regulated in both Clone2LTAXSN and SBLTCE compared to the controlsa

GenBank accession no. Gene description Symbol Relative expression ratio (fold) (median, <0.66) for hybridization with:
Clone2LTAXSN
SBLTCE
A B C Mean K L M Mean
BG257364 Ras homolog gene family, member H ARHH 0.549 0.602 0.630 0.594 0.652 0.609 0.638 0.633
BF306695 Cholinergic receptor, nicotinic, delta polypeptide CHRND 0.552 0.454 0.838 0.615 0.541 0.618 1.000 0.580
BG327949 Tumor rejection antigen (gp96) 1 TRA1 1.000 0.639 0.622 0.631 0.915 0.536 0.444 0.632
AU151619 Myosin X MYO10 0.511 0.565 0.836 0.637 0.620 0.832 0.649 0.701
N67270 Lipoma HMGIC fusion partner LHFP 0.634 0.654 0.627 0.639 0.482 0.444 0.586 0.504
BE907412 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 0.609 0.546 0.772 0.642 0.579 0.542 0.596 0.572
BF244629 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6; 17 kDa NDUFB6 0.582 0.566 0.852 0.667 0.391 0.624 0.793 0.603
AF131754 SH3 domain-binding glutamic acid-rich protein like 2 SH3BGRL2 0.544 0.556 0.933 0.678 0.508 0.568 0.514 0.530
N71526 Inhibitor of kappa light polypeptide gene enhancer in B cells, kinase beta IKBKB 0.541 0.599 0.929 0.690 0.512 0.691 0.633 0.612
NM_004540 Neural cell adhesion molecule 2 NCAM2 0.572 0.564 0.997 0.711 0.452 0.536 0.546 0.511
AW977525 KIAA1332 protein KIAA1332 0.580 0.598 0.987 0.722 0.462 0.497 0.665 0.541
a

The numbers in columns A, B, and C and K, L, and M represent the relative expression ratios from replicate hybridizations for Clone2LTAXSN (A, B, and C) and SBLTCE (K, L, and M), respectively, performed using three independent RNA extractions for each cell type. The median expression ratio can be read directly. “Mean” shows the arithmetic means of the relative expression ratios of experiments (A, B, and C and K, L, and M, respectively) and provides additional statistical information. Note that genes are arranged according to the arithmetic means. Table 8 represents a comprehensive list of genes with relative expression ratio medians changed <0.66-fold across all six microarray experiments; 10 features that could not be properly analyzed according to the GenBank database were excluded.

FIG. 5.

FIG. 5.

Distribution of TaxBLV-associated differentially expressed genes between two distinct ovine B-cell populations, Clone2LTAXSN and SBLTCE. Eighty genes differentially expressed in both B-cell clones and PBMC-derived B cells were visualized as the intersect of two rectangles, each representing the overall number of significantly altered genes (median, >1.5 or <0.66) as a result of TaxBLV expression in three microarray experiments for each B-cell population. Taking relative expression ratio median values, 211 genes were >1.5 and 52 genes were <0.66 (263) in hybridizations A, B, and C (Clone2LTAXSN/Clone2), and 292 genes were >1.5 and 149 genes were <0.66 (441) in hybridizations K, L, and M (SBLTCE/SBLiE). Sixty-five genes were >1.5 and 15 genes were <0.66 (80) in both A, B, and C and K, L, and M hybridizations (overlap).

FIG. 6.

FIG. 6.

Similar changes in overall gene transcription patterns as a result of TaxBLV expression in two different ovine B-cell populations. (a) Comparison of overall gene expression profiles generated from Clone2LTAXSN/Clone2 and SBLTCE/SBLiE populations. Log ratio medians were computed from three corresponding microarray experiments, hybridizations A, B, and C (Clone2LTAXSN/Clone2 cells) and K, L, and M (SBLTCE/SBLiE cells), respectively. b is similar to a except that median values were replaced by means. Dots above the upper oblique lines represent genes overexpressed by >2-fold, and dots below the lower oblique lines represent genes underexpressed by >2-fold.

DISCUSSION

Large-animal models for cancer have the potential to contribute to the understanding of molecular pathways involved in oncogenesis. BLV-associated B-cell leukemia in sheep provides a unique model for investigating the molecular basis of human leukemogenic processes including HTLV-1-associated T-cell malignancies. TaxBLV likely has a multitude of functions. The ability of this viral transactivator to both transcriptionally regulate cellular gene expression and directly interact with cellular proteins provides the basis for leukemogenesis. Chromosomal aberrations, genome instability, and the control of protein activity by TaxBLV definitely play a major role in the development and progression of these multistep tumors. However, although the regulation of host cell mRNA levels is only one aspect of the biological control by TaxBLV, the mechanisms by which TaxBLV modulates host cell transcription are of considerable interest. In this study, we examined TaxBLV-mediated gene expression changes in ovine B cells, the targets of BLV, in an attempt to identify genes that play a role in the cascade of events leading to B-cell leukemia. We have taken a cross-species ovine-to-human gene-profiling approach using human cDNA microarrays to identify transcriptional changes in ovine B cells that express TaxBLV. We first examined hybridization characteristics and data variability from sheep-to-human microarrays using Clone2LTAXSN, a TaxBLV-positive clonal B-cell population characterized by abnormal growth (65). Using human cDNA microarrays (10,336 genes/ESTs), more than 62% of human probes were effective at ovine transcript detection. Approximately 2% (211 genes) were significantly up-regulated, and 0.5% (52 genes) were down-regulated. Besides genes with high levels of differential expression, those showing low differences were of particular interest, given that small changes in gene expression are expected to be sufficient to disrupt cell homeostasis. Moreover, there is no universal standard to accurately measure genes expressed at a low level or genes with low severalfold changes. In our study, we considered expression ratios of >1.5 and <0.66 to be significant. This arbitrary cutoff was independently validated using two alternative methods for measuring gene expression. Low ratios, however, still make it challenging to separate causal from coincidental changes in gene expression, especially in cross-species techniques, and this requires a thorough validation of data for each individual gene under investigation.

Using these microarrays, we evaluated gene expression profiles of previously described B-cell clones (Clone2LTAXSN/Clone2) as well as PBMC-derived SBL cells. Both Clone2 and SBL are characterized by the surface expression of IgM, a consistent finding in leukemic B cells isolated from BLV-infected sheep. Those B-cell populations probably represent a stage in T-cell-dependent B-cell development that may occur within germinal centers, but the continued expression of sIgM would indicate that they are not centroblasts and are probably not memory B cells, since there is no evidence for isotype switching. The Clone2 and polyclonal SBL populations thus share many biological similarities in terms of B-cell development stage, but Clone2 developed a relative cytokine independence over time, probably reflecting the selection of one specific B cell during the cloning process. However, these B cells remain dependent upon both mCD154 stimulation and the presence of IL-4 to proliferate and remain viable, since removal of these stimuli results in apoptosis. Thus, these are not transformed B cells. The SBL represent a more heterogenous sIgM-positive B-cell population that has retained its dependence on both CD154 (T-cell-dependent development) and the spectrum of γc-common cytokines (IL-2, IL-4, IL-7, and IL-15) for continued growth. Thus, the major difference is that SBL cells require a broader range of cytokines, which may reflect the diversity of this B-cell population and may be associated with a decreased risk of identifying changes attributable to an individual cell type. Data are presented from SBL cells isolated from the blood of only one sheep because we observed very little variation between microarray data sets for separate blood B-cell cultures from different sheep (data not shown). This suggests that animal-to-animal variation has little impact on baseline gene expression patterns in B-cell populations generated by costimulation with CD154 and cytokines. These stimuli appear to impose a strong selection on the surviving B cells. Ultimately, to avoid the limitations of the present system for exploring genes involved in oncogenesis, it will be important to analyze Tax-induced gene expression changes in B cells directly ex vivo, but this will require vectors that are capable of delivering a transgene into resting cells. The biological relevance of these two B-cell populations for studying human B-cell malignancies is that they both represent T-cell-activated B-cell populations and may be most comparable to human follicular B cells. Thus, these sheep B-cell lines may be most relevant for understanding human follicular lymphomas.

We have previously shown that TaxBLV has a clear supportive role in the growth of these B cells, with an impact on B-cell proliferation, survival, and cell cycle phase distribution (65). In both B-cell populations, we identified a significant number of genes that underwent changes in response to TaxBLV (263 genes in Clone2LTAXSN and 441 genes in SBLTCE), with an intersect of approximately 25%. Although the samples for comparison were as closely matched as possible, analysis of gene expression data generated long gene lists, suggesting that TaxBLV expression in cultured B cells leads to direct or indirect changes in mRNA levels of hundreds of genes. Faced with this mass of data, the temptation was to search for genes that conform to existing ideas about how B cells acquire abnormal phenotypes. A selection of those genes is displayed in Tables 2, 3, and 5 to 8, but only a limited number are discussed here. The benefits of an unbiased approach, however, is lost if exploration is limited to our current framework of understanding. Therefore, in this study, although we do not provide clues as to which of these changes may be important, we provide the complete data set of differentially expressed genes. It is thus important to underline that we do not exclude a critical functional role for some of the genes that are not displayed in the shortened lists.

The first striking observation was the strong agreement between our results and those for genes previously reported as being TaxHTLV-1 responsive or TaxHTLV-1 interacting in HTLV-1-infected T-cell cultures and human T-cell lines that express TaxHTLV-1 (ATF4, FOS, FOSL2, TNFSF4, and BRF2), confirming the specificity of our approach. We identified two members of the bZip transcription factors (FOS and FOSL2), ATF4, that forms dimers with bZip proteins including Fos (22), and TNFSF4 or TaxHTLV1 transcriptionally activated glycoprotein 1. Furthermore, given that TaxHTLV1 is capable of modulating the expression of BRF1 through a cis-acting replication element (38), it is tempting to speculate that BRF2, scored as up-regulated in ovine B cells, may have a similar function.

There was a good agreement between the microarray results and both the Northern blot and qRT-PCR experiments, two methods designed to validate our data. Human cDNAs were used for probing the Northern blots, while ovine and bovine sequence-specific primers were utilized in qRT-PCR assays. In many cases, the exact severalfold changes were higher than the microarray ratios. This is commonly observed, and it is now widely accepted that those methods are a better reflection of the gene expression levels in each sample. Northern blot and qRT-PCR data thus provide a rationale for the 1.5-fold cutoff used in the microarray analysis.

Interestingly, we identified several genes differentially expressed in both the B-cell clone and the PBMC-derived B cells, emphasizing their contribution to the TaxBLV-associated abnormal B-cell growth. The observation, however, that a significant proportion of altered genes do not overlap between Clone2LTAXSN and SBLTCE may appear surprising. One possible explanation is that differences in expression patterns found in B-cell clones are partly linked to changes that occur downstream from the early TaxBLV-associated events. Furthermore, given the greater diversity of SBL cells, the finding that genes are differentially expressed in SBL cells while they are not in B-cell clones does not exclude a functional role of these genes in leukemogenic processes. We thus considered that the genes differentially expressed in both B-cell populations as well as those identified in a single B-cell population were of interest.

In the vast majority of genes, increases in expression levels did not exceed two- to threefold, with the exception of CART1 (ninefold), fibrinogen-like protein 2 (FGL-2) (fivefold), and fibrillin 1 (FBN-1) (fivefold). CART1 encodes a paired-like DNA-binding homeoprotein with transactivating transcriptional activity, but its target gene remains unknown (13). p300/CREB binding protein (CBP) acts as a coactivator to CART1 through direct interaction and lysine acetylation, enhancing its transactivation capacity (29). Given that genes encoding proteins with HAT activity, including p300/CBP, were up-regulated in our study (discussed below), it is tempting to speculate that CART1 overexpression is a secondary event and not a direct consequence of TaxBLV expression. Both FGL-2, a prothrombinase, and FBN-1, involved in the structure of connective tissue, were found to be overexpressed by fivefold. To our knowledge, aberrant expression of neither of these genes has been correlated with pathways known to be associated with deregulated cell growth. Keeping in mind that the interpretation of data is complicated by changes that may occur either downstream from or independently of the stimulus under consideration, our results do not allow primary and secondary changes in gene expression to be distinguished, and further investigation is necessary to draw conclusions from these data.

In examining the expression profiles, several alterations were found in genes involved in DNA transcription/repair and genes encoding or interacting with proteins possessing HAT activity (p300, p400, GPS2, EBF, CART1, and ATF4). Gps2 modulates bovine papillomavirus type 1 E2 expression through recruiting p300 and directly interacts with TaxHTLV1 (54), known to target p300/CBP, leading to transcriptional deregulation of several cellular genes (16). EBF activates transcription factors through p300/CBP (83), and PA2G4, a transcriptional repressor, acts via recruiting histone deacetylases (82). CART1, increased by ninefold and discussed above, recruits p300/CBP to a CART-specific subnuclear compartment, thereby modulating transcription from different promoters. Furthermore, we identified transcriptional alterations of members of the chromodomain helicase DNA-binding protein (CHD) and SWI/SNF chromatin-remodeling complex gene families (CHD2, CHD4, CHD6, SWI/SWF-related regulator of chromatin 2 [SMARCA2], and SMARCA5), genes encoding DNA-binding proteins (TCF4, SREBF2, TRIP-BR2, PC4, and BHLHB2), and genes involved in DNA damage/repair (DDB2, TOP1, APEX1, and RAD51). Suppression of DNA repair likely increases the incidence of genomic mutations and may contribute to B-cell transformation. A striking example supporting the impact of DNA damage/repair imbalance in TaxBLV-mediated leukemogenesis is the up-regulation of topoisomerase 1 (TOP1) in both B-cell populations. TOP1 is involved in multiple DNA transactions, including DNA relaxation (56), and is the fusion partner of the nucleoporin gene NUP98 in acute myeloid leukemia-associated rearrangements. NUP98-TOP1 blocks differentiation of hematopoietic precursors and induces a lethal leukemia related to the DNA-binding properties and the capacity to induce DNA lesions mediated by excess TOP1. TOP1 is the target of novel anticancer drugs, the camptothecins (21).

Among the cohort of genes with altered expression, we identified genes associated with NF-κB activation and p53 suppression, including MDM2 (20), SSRP1 (81), Trip-Br2 (28), and many others. Interestingly, PPM1D overexpression abrogates the p53 suppressor activity through the inactivation of p38-mitogen-activated protein kinase (MAPK), a product of MAPK14, down-regulated in our study (5). Translocated in liposarcoma (FUS/TLS) interacts with NF-κB-p65, and its fusion to different transcription factors is associated with various malignancies, including acute myeloid leukemia (44, 67). Our observations thus support previous findings that suggested that NF-κB activation and p53 inhibition contribute to the oncogenic effects of TaxHTLV1/TaxBLV (14, 65, 80). We also observed altered expression of numerous small Rho GTPases/GTPase-binding proteins. These small G proteins contribute to various regulatory processes and play a critical role in mechanisms associated with cancer, including cell survival, invasion, and angiogenesis (23, 39, 60). Members of this family were shown to interact with TaxHTLV1 (79). We identified Ras homolog gene family members Q, B, and H (ARHQ, ARHB, and ARHH), members 1 and 4 of the ARF family of GTP-binding proteins (ARL1 and ARL4), members of Ras oncogene family (RAB6A and RAB5B), GTP-binding protein cell division cycle 42 (CDC42), and other GTPase-binding proteins (ARL6IP, SEC61B, RACGAP1, BCAR3, RAB5EP, DAAM2, C8FW, RASAL1, RGR, DOCK2, and CHN1). Our findings thus suggest that TaxBLV may exert its largely pleiotropic effects partly through the deregulation of a broad spectrum of small Rho GTPase/cytoskeleton-related genes. Furthermore, a large number of well-known oncogenes and diverse genes known to be associated with human malignancies were deregulated, including EMP3, PDE3B, LRMP, LASP1, L7a, PTK2, MEIS1, BCAS2, LMO4, OS4, and VEGF. Although the majority were found in hematological disorders, especially B-cell malignancies (PDE3B [35, 37, 48], LRMP [1], LASP1 [7, 63], MEIS1 [15, 43, 55], and VEGF [61, 74]), others were identified in hepatocarcinoma, breast cancer, and colorectal and prostate cancers (EMP3 [41], BCAS2 [40, 72], L7a [34, 68, 73, 85], OS4 [64], and PTK2 [51]).

Interestingly, transcription patterns of antiapoptotic genes were changed. MCL1 is overexpressed in various B-cell malignancies and is found to be associated with drug resistance in B-lineage acute lymphoblastic leukemia, leading to poor response to treatment (27, 33, 53, 58). MCL1-transgenic mice develop chronic clonal B-cell lymphoma closely matching BLV-induced leukemia (84). High levels of METAP2 were detected in B-cell lymphoma subtypes derived from germinal center B cells, and METAP2 expression correlated with that of BCL6, a contributor to B-cell lymphomagenesis (2, 32, 46) up-regulated in response to TaxBLV. Furthermore, METAP2 represents a validated target for inhibition of neovascularization, suggesting that it may play a complex role in tumor progression. Finally, decreases as well as increases in cellular gene expression are important regulatory events. We have identified 52 and 149 down-regulated genes in Clone2LTAXSN and SBLTCE cells, respectively (Table 1), but only 15 genes were commonly repressed. Interestingly, among these genes, we identified the proto-oncogene ARHH, the inactivation of which promotes transformation in germinal center-derived diffuse large B-cell lymphomas (52). Also striking was the down-regulation of STMN1 in Clone2LTAXSN and DOC1 in SBLTCE. STMN1, a gene regulating cell division, is decreased in hepatoblastomas and neuroblastomas (30, 49), while DOC1 is critical for allowing cells to bypass senescence (62).

Altogether, our results identify for the first time a cohort of TaxBLV-associated transcriptionally regulated genes. The good agreement between our findings and previous observations in both human B-cell tumors and HTLV-1-associated T-cell malignancies validates cross-species chip approaches for further elucidation of molecular pathways associated with oncogenesis. The genes identified as either up- or down-regulated likely play important roles in the signaling network in which TaxBLV participates. Analysis of these genes, in terms of known function, allows several important conclusions. There is no single regulatory process that is solely targeted by TaxBLV. Rather, a network of interrelated pathways is deregulated, leading to the disruption of growth control and favoring B-cell survival. Interestingly, given that we identified changes previously associated with HTLV-1, a T-cell-tropic oncoretrovirus, as well as genes linked to non-virus-associated human B-cell malignancies, our results suggest the implication of broad mechanisms that are independent of both lineage and etiology. The power of microarray analysis is that it reveals the complexity of biological events. Cell transformation is a process that affects many different aspects of cell physiology. The complexity of cell signaling may make it difficult to identify the critical or limiting events that occur during transformation. TaxBLV-responsive genes might not be unique contributors to the malignant phenotype, and additional events are required for progression to full-blown leukemia. Analysis directed towards gene expression profiling of B-cell tumors isolated from leukemic animals will permit the elucidation of molecular pathways that promote leukemia progression. Although cross-species approaches do not permit a comprehensive analysis of gene expression patterns, we provide insights into cellular events impacting B-cell transformation and pinpoint molecular targets not identified using other methods in animal models.

Acknowledgments

This work was supported by the Medic Foundation, the Fonds National de la Recherche Scientifique, TELEVIE, the International Brachet Foundation, and the Fondation Bekales. P.K. has fellowships from the Lady Tata Memorial Trust and NATO, and M.S. and M.M. are supported by TELEVIE. A.V. is “Collaborateur Scientifique F.N.R.S.-Televie.”

We thank L. Vanderweerden for website development and Troy Randall for the generous gift of mCD154 L cells.

REFERENCES

  • 1.Akasaka, T., I. S. Lossos, and R. Levy. 2003. BCL6 gene translocation in follicular lymphoma: a harbinger of eventual transformation to diffuse aggressive lymphoma. Blood 102:1443-1448. [DOI] [PubMed] [Google Scholar]
  • 2.Albagli-Curiel, O. 2003. Ambivalent role of BCL6 in cell survival and transformation. Oncogene 22:507-516. [DOI] [PubMed] [Google Scholar]
  • 3.Baum, C., S. Hegewisch-Becker, H. G. Eckert, C. Stocking, and W. Ostertag. 1995. Novel retroviral vectors for efficient expression of the multidrug resistance (mdr-1) gene in early hematopoietic cells. J. Virol. 69:7541-7547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Brady, J., K. T. Jeang, J. Duvall, and G. Khoury. 1987. Identification of p40x-responsive regulatory sequences within the human T-cell leukemia virus type I long terminal repeat. J. Virol. 61:2175-2181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bulavin, D. V., O. N. Demidov, S. Saito, P. Kauraniemi, C. Phillips, S. A. Amundson, C. Ambrosino, G. Sauter, A. R. Nebreda, C. W. Anderson, A. Kallioniemi, A. J. Fornace, Jr., and E. Appella. 2002. Amplification of PPM1D in human tumors abrogates p53 tumor-suppressor activity. Nat. Genet. 31:210-215. [DOI] [PubMed] [Google Scholar]
  • 6.Burny, A., L. Willems, I. Callebaut, E. Adam, I. Cludts, I. F. Dequiedt, L. Droogmans, C. Grimonpont, P. Kerkhofs, M. Mammerickx, D. Portetelle, A. Van den Broeke, and R. Kettman. 1994. Bovine leukemia virus: biology and mode of transformation, p. 313-334. In A. C. Minson, J. C. Neil, and M. A. McRae (ed.), Viruses and cancer. Cambridge University Press, Cambridge, United Kingdom.
  • 7.Butt, E., S. Gambaryan, N. Gottfert, A. Galler, K. Marcus, and H. E. Meyer. 2003. Actin binding of human LIM and SH3 protein is regulated by cGMP- and cAMP-dependent protein kinase phosphorylation on serine 146. J. Biol. Chem. 278:15601-15607. [DOI] [PubMed] [Google Scholar]
  • 8.Chismar, J. D., T. Mondala, H. S. Fox, E. Roberts, D. Langford, E. Masliah, D. R. Salomon, and S. R. Head. 2002. Analysis of result variability from high-density oligonucleotide arrays comparing same-species and cross-species hybridizations. BioTechniques 33:516-518, 520, 522. [DOI] [PubMed] [Google Scholar]
  • 9.Coussens, P. M., and W. Nobis. 2002. Bioinformatics and high throughput approach to create genomic resources for the study of bovine immunobiology. Vet. Immunol. Immunopathol. 86:229-244. [DOI] [PubMed] [Google Scholar]
  • 10.Derse, D. 1987. Bovine leukemia virus transcription is controlled by a virus-encoded trans-acting factor and by cis-acting response elements. J. Virol. 61:2462-2471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Eberwine, J. 1996. Amplification of mRNA populations using aRNA generated from immobilized oligo(dT)-T7 primed cDNA. BioTechniques 20:584-591. [DOI] [PubMed] [Google Scholar]
  • 12.Franchini, G. 1995. Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86:3619-3639. [PubMed] [Google Scholar]
  • 13.Furukawa, K., T. Iioka, M. Morishita, A. Yamaguchi, H. Shindo, H. Namba, S. Yamashita, and T. Tsukazaki. 2002. Functional domains of paired-like homeoprotein Cart1 and the relationship between dimerization and transcription activity. Genes Cells 7:1135-1147. [DOI] [PubMed] [Google Scholar]
  • 14.Gatza, M. L., J. C. Watt, and S. J. Marriott. 2003. Cellular transformation by the HTLV-I Tax protein, a jack-of-all-trades. Oncogene 22:5141-5149. [DOI] [PubMed] [Google Scholar]
  • 15.Geerts, D., N. Schilderink, G. Jorritsma, and R. Versteeg. 2003. The role of the MEIS homeobox genes in neuroblastoma. Cancer Lett. 197:87-92. [DOI] [PubMed] [Google Scholar]
  • 16.Goodman, R. H., and S. Smolik. 2000. CBP/p300 in cell growth, transformation, and development. Genes Dev. 14:1553-1577. [PubMed] [Google Scholar]
  • 17.Grassmann, R., S. Berchtold, I. Radant, M. Alt, B. Fleckenstein, J. G. Sodroski, W. A. Haseltine, and U. Ramstedt. 1992. Role of human T-cell leukemia virus type 1 X region proteins in immortalization of primary human lymphocytes in culture. J. Virol. 66:4570-4575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Griebel, P., T. Beskorwayne, D. L. Godson, Y. Popowych, and W. Hein. 2000. Cloning non-transformed sheep B cells. J. Immunol. Methods 237:19-28. [DOI] [PubMed] [Google Scholar]
  • 19.Griebel, P., T. Beskorwayne, A. Van den Broeke, and G. Ferrari. 1999. CD40 signaling induces B cell responsiveness to multiple members of the gamma chain-common cytokine family. Int. Immunol. 11:1139-1147. [DOI] [PubMed] [Google Scholar]
  • 20.Gu, L., H. W. Findley, and M. Zhou. 2002. MDM2 induces NF-kappaB/p65 expression transcriptionally through Sp1-binding sites: a novel, p53-independent role of MDM2 in doxorubicin resistance in acute lymphoblastic leukemia. Blood 99:3367-3375. [DOI] [PubMed] [Google Scholar]
  • 21.Gurevich, R. M., P. D. Aplan, and R. K. Humphries. 2004. NUP98-topoisomerase I acute myeloid leukemia-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation. Blood 104:1127-1136. [DOI] [PubMed] [Google Scholar]
  • 22.Hai, T., and T. Curran. 1991. Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proc. Natl. Acad. Sci. USA 88:3720-3724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hakoshima, T., T. Shimizu, and R. Maesaki. 2003. Structural basis of the Rho GTPase signaling. J. Biochem. (Tokyo) 134:327-331. [DOI] [PubMed] [Google Scholar]
  • 24.Hawkins, R. D., S. Bashiardes, C. A. Helms, L. Hu, N. L. Saccone, M. E. Warchol, and M. Lovett. 2003. Gene expression differences in quiescent versus regenerating hair cells of avian sensory epithelia: implications for human hearing and balance disorders. Hum. Mol. Genet. 12:1261-1272. [DOI] [PubMed] [Google Scholar]
  • 25.Hermeking, H. 2003. Serial analysis of gene expression and cancer. Curr. Opin. Oncol. 15:44-49. [DOI] [PubMed] [Google Scholar]
  • 26.Higgins, M. A., B. R. Berridge, B. J. Mills, A. E. Schultze, H. Gao, G. H. Searfoss, T. K. Baker, and T. P. Ryan. 2003. Gene expression analysis of the acute phase response using a canine microarray. Toxicol. Sci. 74:470-484. [DOI] [PubMed] [Google Scholar]
  • 27.Holleman, A., M. H. Cheok, M. L. den Boer, W. Yang, A. J. Veerman, K. M. Kazemier, D. Pei, C. Cheng, C. H. Pui, M. V. Relling, G. E. Janka-Schaub, R. Pieters, and W. E. Evans. 2004. Gene-expression patterns in drug-resistant acute lymphoblastic leukemia cells and response to treatment. N. Engl. J. Med. 351:533-542. [DOI] [PubMed] [Google Scholar]
  • 28.Hsu, S. I., C. M. Yang, K. G. Sim, D. M. Hentschel, E. O'Leary, and J. V. Bonventre. 2001. TRIP-Br: a novel family of PHD zinc finger- and bromodomain-interacting proteins that regulate the transcriptional activity of E2F-1/DP-1. EMBO J. 20:2273-2285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Iioka, T., K. Furukawa, A. Yamaguchi, H. Shindo, S. Yamashita, and T. Tsukazaki. 2003. P300/CBP acts as a coactivator to cartilage homeoprotein-1 (Cart1), paired-like homeoprotein, through acetylation of the conserved lysine residue adjacent to the homeodomain. J. Bone Miner. Res. 18:1419-1429. [DOI] [PubMed] [Google Scholar]
  • 30.Janoueix-Lerosey, I., E. Novikov, M. Monteiro, N. Gruel, G. Schleiermacher, B. Loriod, C. Nguyen, and O. Delattre. 2004. Gene expression profiling of 1p35-36 genes in neuroblastoma. Oncogene 23:5912-5922. [DOI] [PubMed] [Google Scholar]
  • 31.Ji, W., W. Zhou, K. Gregg, N. Yu, S. Davis, and S. Davis. 2004. A method for cross-species gene expression analysis with high-density oligonucleotide arrays. Nucleic Acids Res. 32:e93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kanno, T., H. Endo, K. Takeuchi, Y. Morishita, M. Fukayama, and S. Mori. 2002. High expression of methionine aminopeptidase type 2 in germinal center B cells and their neoplastic counterparts. Lab. Investig. 82:893-901. [DOI] [PubMed] [Google Scholar]
  • 33.Khoury, J. D., L. J. Medeiros, G. Z. Rassidakis, T. J. McDonnell, L. V. Abruzzo, and R. Lai. 2003. Expression of Mcl-1 in mantle cell lymphoma is associated with high-grade morphology, a high proliferative state, and p53 overexpression. J. Pathol. 199:90-97. [DOI] [PubMed] [Google Scholar]
  • 34.Kroes, R. A., A. Jastrow, M. G. McLone, H. Yamamoto, P. Colley, D. S. Kersey, V. W. Yong, E. Mkrdichian, L. Cerullo, J. Leestma, and J. R. Moskal. 2000. The identification of novel therapeutic targets for the treatment of malignant brain tumors. Cancer Lett. 156:191-198. [DOI] [PubMed] [Google Scholar]
  • 35.Lawrence, B., A. Perez-Atayde, M. K. Hibbard, B. P. Rubin, P. Dal Cin, J. L. Pinkus, G. S. Pinkus, S. Xiao, E. S. Yi, C. D. Fletcher, and J. A. Fletcher. 2000. TPM3-ALK and TPM4-ALK oncogenes in inflammatory myofibroblastic tumors. Am. J. Pathol. 157:377-384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lemoine, F. J., D. R. Wycuff, and S. J. Marriott. 2001. Transcriptional activity of HTLV-I Tax influences the expression of marker genes associated with cellular transformation. Dis. Markers 17:129-137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lerner, A., D. H. Kim, and R. Lee. 2000. The cAMP signaling pathway as a therapeutic target in lymphoid malignancies. Leuk. Lymphoma 37:39-51. [DOI] [PubMed] [Google Scholar]
  • 38.Li, B., T. Fink, P. Ebbesen, X. D. Liu, and V. Zachar. 2003. Expression of butyrate response factor 1 in HTLV-1-transformed cells and its transactivation by Tax protein. Arch. Virol. 148:1787-1804. [DOI] [PubMed] [Google Scholar]
  • 39.Li, X., and B. Lim. 2003. RhoGTPases and their role in cancer. Oncol. Res. 13:323-331. [DOI] [PubMed] [Google Scholar]
  • 40.Maass, N., F. Rosel, C. Schem, J. Hitomi, W. Jonat, and K. Nagasaki. 2002. Amplification of the BCAS2 gene at chromosome 1p13.3-21 in human primary breast cancer. Cancer Lett. 185:219-223. [DOI] [PubMed] [Google Scholar]
  • 41.Mackay, A., C. Jones, T. Dexter, R. L. Silva, K. Bulmer, A. Jones, P. Simpson, R. A. Harris, P. S. Jat, A. M. Neville, L. F. Reis, S. R. Lakhani, and M. J. O'Hare. 2003. cDNA microarray analysis of genes associated with ERBB2 (HER2/neu) overexpression in human mammary luminal epithelial cells. Oncogene 22:2680-2688. [DOI] [PubMed] [Google Scholar]
  • 42.Mammerickx, M., R. Palm, D. Portetelle, and A. Burny. 1988. Experimental transmission of enzootic bovine leukosis to sheep: latency period of the tumoral disease. Leukemia 2:103-107. [PubMed] [Google Scholar]
  • 43.Martin, M. E., T. A. Milne, S. Bloyer, K. Galoian, W. Shen, D. Gibbs, H. W. Brock, R. Slany, and J. L. Hess. 2003. Dimerization of MLL fusion proteins immortalizes hematopoietic cells. Cancer Cell 4:197-207. [DOI] [PubMed] [Google Scholar]
  • 44.Martini, A., R. La Starza, H. Janssen, C. Bilhou-Nabera, A. Corveleyn, R. Somers, A. Aventin, R. Foa, A. Hagemeijer, C. Mecucci, and P. Marynen. 2002. Recurrent rearrangement of the Ewing's sarcoma gene, EWSR1, or its homologue, TAF15, with the transcription factor CIZ/NMP4 in acute leukemia. Cancer Res. 62:5408-5412. [PubMed] [Google Scholar]
  • 45.Matsuoka, M. 2003. Human T-cell leukemia virus type I and adult T-cell leukemia. Oncogene 22:5131-5140. [DOI] [PubMed] [Google Scholar]
  • 46.Michaud, J., H. S. Scott, and R. Escher. 2003. AML1 interconnected pathways of leukemogenesis. Cancer Investig. 21:105-136. [DOI] [PubMed] [Google Scholar]
  • 47.Moody, D. E., Z. Zou, and L. McIntyre. 2002. Cross-species hybridisation of pig RNA to human nylon microarrays. BMC Genomics 3:27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Moon, E., R. Lee, R. Near, L. Weintraub, S. Wolda, and A. Lerner. 2002. Inhibition of PDE3B augments PDE4 inhibitor-induced apoptosis in a subset of patients with chronic lymphocytic leukemia. Clin. Cancer Res. 8:589-595. [PubMed] [Google Scholar]
  • 49.Nagata, T., Y. Takahashi, Y. Ishii, S. Asai, Y. Nishida, A. Murata, T. Koshinaga, M. Fukuzawa, M. Hamazaki, K. Asami, E. Ito, H. Ikeda, H. Takamatsu, K. Koike, A. Kikuta, M. Kuroiwa, A. Watanabe, Y. Kosaka, H. Fujita, M. Miyake, and H. Mugishima. 2003. Transcriptional profiling in hepatoblastomas using high-density oligonucleotide DNA array. Cancer Genet. Cytogenet. 145:152-160. [DOI] [PubMed] [Google Scholar]
  • 50.Ng, P. W., H. Iha, Y. Iwanaga, M. Bittner, Y. Chen, Y. Jiang, G. Gooden, J. M. Trent, P. Meltzer, K. T. Jeang, and S. L. Zeichner. 2001. Genome-wide expression changes induced by HTLV-1 Tax: evidence for MLK-3 mixed lineage kinase involvement in Tax-mediated NF-kappaB activation. Oncogene 20:4484-4496. [DOI] [PubMed] [Google Scholar]
  • 51.Okamoto, H., K. Yasui, C. Zhao, S. Arii, and J. Inazawa. 2003. PTK2 and EIF3S3 genes may be amplification targets at 8q23-q24 and are associated with large hepatocellular carcinomas. Hepatology 38:1242-1249. [DOI] [PubMed] [Google Scholar]
  • 52.Pasqualucci, L., P. Neumeister, T. Goossens, G. Nanjangud, R. S. Chaganti, R. Kuppers, and R. Dalla-Favera. 2001. Hypermutation of multiple proto-oncogenes in B-cell diffuse large-cell lymphomas. Nature 412:341-346. [DOI] [PubMed] [Google Scholar]
  • 53.Pedersen, I. M., S. Kitada, L. M. Leoni, J. M. Zapata, J. G. Karras, N. Tsukada, T. J. Kipps, Y. S. Choi, F. Bennett, and J. C. Reed. 2002. Protection of CLL B cells by a follicular dendritic cell line is dependent on induction of Mcl-1. Blood 100:1795-1801. [PubMed] [Google Scholar]
  • 54.Peng, Y. C., D. E. Breiding, F. Sverdrup, J. Richard, and E. J. Androphy. 2000. AMF-1/Gps2 binds p300 and enhances its interaction with papillomavirus E2 proteins. J. Virol. 74:5872-5879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Poppe, B., J. Vandesompele, C. Schoch, C. Lindvall, K. Mrozek, C. D. Bloomfield, H. B. Beverloo, L. Michaux, N. Dastugue, C. Herens, N. Yigit, A. De Paepe, A. Hagemeijer, and F. Speleman. 2004. Expression analyses identify MLL as a prominent target of 11q23 amplification and support an etiologic role for MLL gain of function in myeloid malignancies. Blood 103:229-235. [DOI] [PubMed] [Google Scholar]
  • 56.Pourquier, P., and Y. Pommier. 2001. Topoisomerase I-mediated DNA damage. Adv. Cancer Res. 80:189-216. [DOI] [PubMed] [Google Scholar]
  • 57.Pozzatti, R., J. Vogel, and G. Jay. 1990. The human T-lymphotropic virus type I tax gene can cooperate with the ras oncogene to induce neoplastic transformation of cells. Mol. Cell. Biol. 10:413-417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Rassidakis, G. Z., R. Lai, T. J. McDonnell, F. Cabanillas, A. H. Sarris, and L. J. Medeiros. 2002. Overexpression of Mcl-1 in anaplastic large cell lymphoma cell lines and tumors. Am. J. Pathol. 160:2309-2310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Russo, G., C. Zegar, and A. Giordano. 2003. Advantages and limitations of microarray technology in human cancer. Oncogene 22:6497-6507. [DOI] [PubMed] [Google Scholar]
  • 60.Sahai, E., and C. J. Marshall. 2002. RHO-GTPases and cancer. Nat. Rev. Cancer 2:133-142. [DOI] [PubMed] [Google Scholar]
  • 61.Schuch, G., M. Machluf, G. Bartsch, Jr., M. Nomi, H. Richard, A. Atala, and S. Soker. 2002. In vivo administration of vascular endothelial growth factor (VEGF) and its antagonist, soluble neuropilin-1, predicts a role of VEGF in the progression of acute myeloid leukemia in vivo. Blood 100:4622-4628. [DOI] [PubMed] [Google Scholar]
  • 62.Schwarze, S. R., S. E. DePrimo, L. M. Grabert, V. X. Fu, J. D. Brooks, and D. F. Jarrard. 2002. Novel pathways associated with bypassing cellular senescence in human prostate epithelial cells. J. Biol. Chem. 277:14877-14883. [DOI] [PubMed] [Google Scholar]
  • 63.Strehl, S., A. Borkhardt, R. Slany, U. E. Fuchs, M. Konig, and O. A. Haas. 2003. The human LASP1 gene is fused to MLL in an acute myeloid leukemia with t(11;17)(q23;q21). Oncogene 22:157-160. [DOI] [PubMed] [Google Scholar]
  • 64.Su, Y. A., M. M. Lee, C. M. Hutter, and P. S. Meltzer. 1997. Characterization of a highly conserved gene (OS4) amplified with CDK4 in human sarcomas. Oncogene 15:1289-1294. [DOI] [PubMed] [Google Scholar]
  • 65.Szynal, M., Y. Cleuter, T. Beskorwayne, C. Bagnis, C. Van Lint, P. Kerkhofs, A. Burny, P. Martiat, P. Griebel, and A. Van den Broeke. 2003. Disruption of B-cell homeostatic control mediated by the BLV-Tax oncoprotein: association with the upregulation of Bcl-2 and signaling through NF-kappaB. Oncogene 22:4531-4542. [DOI] [PubMed] [Google Scholar]
  • 66.Tao, W., B. Mallard, N. Karrow, and B. Bridle. 2004. Construction and application of a bovine immune-endocrine cDNA microarray. Vet. Immunol. Immunopathol. 101:1-17. [DOI] [PubMed] [Google Scholar]
  • 67.Uranishi, H., T. Tetsuka, M. Yamashita, K. Asamitsu, M. Shimizu, M. Itoh, and T. Okamoto. 2001. Involvement of the pro-oncoprotein TLS (translocated in liposarcoma) in nuclear factor-kappa B p65-mediated transcription as a coactivator. J. Biol. Chem. 276:13395-13401. [DOI] [PubMed] [Google Scholar]
  • 68.Vaarala, M. H., K. S. Porvari, A. P. Kyllonen, M. V. Mustonen, O. Lukkarinen, and P. T. Vihko. 1998. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples. Int. J. Cancer 78:27-32. [DOI] [PubMed] [Google Scholar]
  • 69.Van den Broeke, A., C. Bagnis, M. Ciesiolka, Y. Cleuter, H. Gelderblom, P. Kerkhofs, P. Griebel, P. Mannoni, and A. Burny. 1999. In vivo rescue of a silent tax-deficient bovine leukemia virus from a tumor-derived ovine B-cell line by recombination with a retrovirally transduced wild-type tax gene. J. Virol. 73:1054-1065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Van den Broeke, A., Y. Cleuter, T. Beskorwayne, P. Kerkhofs, M. Szynal, C. Bagnis, A. Burny, and P. Griebel. 2001. CD154 costimulated ovine primary B cells, a cell culture system that supports productive infection by bovine leukemia virus. J. Virol. 75:1095-1103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Van den Broeke, A., Y. Cleuter, G. Chen, D. Portetelle, M. Mammerickx, D. Zagury, M. Fouchard, L. Coulombel, R. Kettmann, and A. Burny. 1989. Even transcriptionally competent proviruses are silent in bovine leukemia virus induced tumor cells. Proc. Natl. Acad. Sci. USA 85:9263-9267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Visvader, J. E., D. Venter, K. Hahm, M. Santamaria, E. Y. Sum, L. O'Reilly, D. White, R. Williams, J. Armes, and G. J. Lindeman. 2001. The LIM domain gene LMO4 inhibits differentiation of mammary epithelial cells in vitro and is overexpressed in breast cancer. Proc. Natl. Acad. Sci. USA 98:14452-14457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Wang, Y., D. Cheong, S. Chan, and S. C. Hooi. 2000. Ribosomal protein L7a gene is up-regulated but not fused to the tyrosine kinase receptor as chimeric trk oncogene in human colorectal carcinoma. Int. J. Oncol. 16:757-762. [DOI] [PubMed] [Google Scholar]
  • 74.Weber, P. J., C. P. Eckhard, S. Gonser, H. Otto, G. Folkers, and A. G. Beck-Sickinger. 1999. On the role of thymopoietins in cell proliferation. Immunochemical evidence for new members of the human thymopoietin family. Biol. Chem. 380:653-660. [DOI] [PubMed] [Google Scholar]
  • 75.Willems, L., A. Burny, D. Collete, O. Dangoisse, F. Dequiedt, J. S. Gatot, P. Kerkhofs, L. Lefebvre, C. Merezak, T. Peremans, D. Portetelle, J. C. Twizere, and R. Kettmann. 2000. Genetic determinants of bovine leukemia virus pathogenesis. AIDS Res. Hum. Retrovir. 16:1787-1795. [DOI] [PubMed] [Google Scholar]
  • 76.Willems, L., A. Gegonne, G. Chen, A. Burny, R. Kettmann, and J. Ghysdael. 1987. The bovine leukemia virus p34 is a transactivator protein. EMBO J. 6:3385-3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Willems, L., H. Heremans, G. Chen, D. Portetelle, A. Billiau, A. Burny, and R. Kettmann. 1990. Cooperation between bovine leukaemia virus transactivator protein and Ha-ras oncogene product in cellular transformation. EMBO J. 9:1577-1581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Willems, L., R. Kettmann, F. Dequiedt, D. Portetelle, V. Voneche, I. Cornil, P. Kerkhofs, A. Burny, and M. Mammerickx. 1993. In vivo infection of sheep by bovine leukemia virus mutants. J. Virol. 67:4078-4085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Wu, K., M. E. Bottazzi, C. de la Fuente, L. Deng, S. D. Gitlin, A. Maddukuri, S. Dadgar, H. Li, A. Vertes, A. Pumfery, and F. Kashanchi. 2004. Protein profile of tax-associated complexes. J. Biol. Chem. 279:495-508. [DOI] [PubMed] [Google Scholar]
  • 80.Yoshida, M. 2001. Multiple viral strategies of HTLV-1 for dysregulation of cell growth control. Annu. Rev. Immunol. 19:475-496. [DOI] [PubMed] [Google Scholar]
  • 81.Zeng, S. X., M. S. Dai, D. M. Keller, and H. Lu. 2002. SSRP1 functions as a co-activator of the transcriptional activator p63. EMBO J. 21:5487-5497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Zhang, Y., N. Woodford, X. Xia, and A. W. Hamburger. 2003. Repression of E2F1-mediated transcription by the ErbB3 binding protein Ebp1 involves histone deacetylases. Nucleic Acids Res. 31:2168-2177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Zhao, F., R. McCarrick-Walmsley, P. Akerblad, M. Sigvardsson, and T. Kadesch. 2003. Inhibition of p300/CBP by early B-cell factor. Mol. Cell. Biol. 23:3837-3846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Zhou, P., N. B. Levy, H. Xie, L. Qian, C. Y. Lee, R. D. Gascoyne, and R. W. Craig. 2001. MCL1 transgenic mice exhibit a high incidence of B-cell lymphoma manifested as a spectrum of histologic subtypes. Blood 97:3902-3909. [DOI] [PubMed] [Google Scholar]
  • 85.Zhu, Y., H. Lin, Z. Li, M. Wang, and J. Luo. 2001. Modulation of expression of ribosomal protein L7a (rpL7a) by ethanol in human breast cancer cells. Breast Cancer Res. Treat. 69:29-38. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES