Abstract
Legionella pneumophila possesses a variety of secreted and cell-associated hydrolytic activities that could be involved in pathogenesis. The activities include phospholipase A, lysophospholipase A, glycerophospholipid:cholesterol acyltransferase, lipase, protease, phosphatase, RNase, and p-nitrophenylphosphorylcholine (p-NPPC) hydrolase. Up to now, there have been no data available on the regulation of the enzymes in L. pneumophila and no data at all concerning the regulation of bacterial phospholipases A. Therefore, we used L. pneumophila mutants in the genes coding for the global regulatory proteins RpoS and LetA to investigate the dependency of hydrolytic activities on a global regulatory network proposed to control important virulence traits in L. pneumophila. Our results show that both L. pneumophila rpoS and letA mutants exhibit on the one hand a dramatic reduction of secreted phospholipase A and glycerophospholipid:cholesterol acyltransferase activities, while on the other hand secreted lysophospholipase A and lipase activities were significantly increased during late logarithmic growth phase. The cell-associated phospholipase A, lysophospholipase A, and p-NPPC hydrolase activities, as well as the secreted protease, phosphatase, and p-NPPC hydrolase activities were significantly decreased in both of the mutant strains. Only cell-associated phosphatase activity was slightly increased. In contrast, RNase activity was not affected. The expression of plaC, coding for a secreted acyltransferase, phospholipase A, and lysophospholipase A, was found to be regulated by LetA and RpoS. In conclusion, our results show that RpoS and LetA affect phospholipase A, lysophospholipase A, acyltransferase, and other hydrolytic activities of L. pneumophila in a similar way, thereby corroborating the existence of the LetA/RpoS regulation cascade.
Legionella pneumophila is an intracellular bacterial pathogen which infects protozoa, such as amoebae, present in fresh water sources. When inhaled by susceptible humans, the bacteria infect and multiply in human lung macrophages and cause the potentially fatal pneumonia Legionnaires' disease (20). When nutrients become rare after replication in a modified phagosome (1), L. pneumophila exits the spent host cell by disruption of the eukaryotic phagosomal and cell membranes and infects a new host (49, 67). Accordingly, the life cycle of L. pneumophila can be differentiated into two phases where the bacterium needs to adapt to specific conditions: intracellular replication within the host cell and host cell exit and transmission to a new host (50). Furthermore, it was shown that L. pneumophila develops a mature infectious form that is different from in vitro grown stationary phase cells with regard to infectivity and resistance to antibiotics (30).
Adaptation between replicative and transmissive phases in L. pneumophila is strictly regulated on the genetic level. Virulence properties such as motility (8, 14, 36, 37), cytotoxicity (2, 14, 33), and resistance to stress such as nutrient limitation (6, 8, 32, 44) that are needed for host cell exit, invasion of a new host, and establishment of the replicative vacuole, are only expressed in the transmissive form. Conversely, those factors are repressed in the replicative form (see reference 50 and references therein). However, some L. pneumophila strains have been shown to be infectious even in the mid-logarithmic growth phase (61).
Various regulators have been identified to control the phenotypic changes within the life cycle of L. pneumophila, including the two-component system LetA/S (29, 33, 44) and the alternative sigma factor RpoS (6, 32). For example in enteric bacteria, such as Escherichia coli, RpoS is central to the regulation of stationary-phase growth and stress response (for a recent review see reference 35). In pathogenic Vibrio species, RpoS is involved in the regulation of stress response and additionally in the expression of secreted virulence factors in both the stationary and exponential growth phases (17, 39, 53, 65). Borrelia burgdorferi RpoS also plays a role in the regulation of virulence traits, for example the outer surface proteins OspA and OspC (15, 38), and is expressed during mid-logarithmic growth phase (15). The findings of rpoS expression before stationary phase in Vibrio spp. and B. burgdorferi are in contrast to the function of RpoS as a master regulator of adaptation to stationary phase and of global environmental stress response in E. coli and related bacteria (35).
Likewise, L. pneumophila RpoS seems not to be the central regulator of stationary phase growth, as a knockout mutation in rpoS does not affect resistance to oxidative, osmotic, and acidic stresses (6, 32). On the other hand, RpoS was shown tobe necessary for intracellular infection and replication of thebacterium in amoebae and expression of virulence traits present in the transmissive growth phase (6, 8, 32, 33). The infectivity and replication behavior of an L. pneumophila JR32 rpoS mutant in HL60-derived macrophages remained unchanged; however strain Lp02 (12) needs rpoS for efficient replication in bone marrow-derived macrophage cells (6). Furthermore, it was described that rpoS mRNA is predominantly present in the exponential growth phase (8, 44), while the RpoS protein is abundant during the postexponential growth phase (32).
The phosphorelay response regulator GacA (global activator), a protein homologous to LetA of L. pneumophila, is involved in the regulation of virulence genes in various gram-negative bacteria, including Pseudomonas and Vibrio species (reviewed in reference 34). In the opportunistic lung pathogen Pseudomonas aeruginosa, GacA regulates quorum sensing and various secreted virulence factors (57). Furthermore, GacA influences the accumulation of RpoS in Pseudomonas fluorescens (68) and is involved in the regulation of exoenzymes in the phytopathogen Erwinia carotovora (16).
In L. pneumophila, LetA is another protagonist of the regulation cascade. It forms a two-component signaling system with the sensor kinase LetS and the transcription enhancer LetE (7, 8, 29, 33, 42, 44). LetA furthermore affects the expression of different genes belonging to the icm/dot virulence region (29, 44, 63). This genetic region is important for L. pneumophila intracellular replication (12, 46) and cytotoxicity (64). In L. pneumophila JR32, LetA was shown to regulate the transcription of rpoS and to be essential for efficient infection of amoebae (44). However, letA mutants still multiply efficiently in macrophage host cells (29, 33). Furthermore, the virulence traits of the transmissive phase, such as motility, cytotoxicity, and resistance to stresses, are dependent on the LetA/S system (33, 44, 51). Combined, these results show that a mutation in letA produces a phenotype that is arrested in the exponential growth phase, preventing the expression of cytotoxicity and motility.
Since secreted lipase and protease activities in other bacteria are regulated by GacA (LetA) and RpoS, and since secreted hydrolytic activities of L. pneumophila are expressed at peak levels during late logarithmic growth phase and entry into stationary phase (24), it is possible that the L. pneumophila enzymes are regulated in a similar manner. L. pneumophila possesses a range of secreted and cell-associated hydrolytic activities: phospholipase A (PLA), lysophospholipase A (LPLA), glycerophospholipid:cholesterol acyltransferase (GCAT), lipase/esterase, protease, phosphatase, p-nitrophenylphosphorylcholine (p-NPPC) hydrolase, and RNase. Several proteins have been characterized for L. pneumophila that are associated with these activities and are listed in Table 1.
TABLE 1.
Proteins corresponding to hydrolytic activities of Legionella pneumophila
| Activity | Localization | Type II secreted | Corresponding enzyme (reference) |
|---|---|---|---|
| Phospholipase A | Secreted | Yes | Major activity unidentified; PlaC (10) |
| Cell associated | PlaB (27) | ||
| Lysophospholipase A | Secreted | Yes | PlaA (26), PlaC (10) |
| Cell associated | PlaB (27) | ||
| Acyltransferase | Secreted | Yes | PlaC (10) |
| Lipase | Secreted | Yes | LipA, LipB (5), PlaA (26), PlaC (10) |
| Protease | Secreted | Yes | ProA (31) |
| Phosphatase | Secreted | Yes | MapA (3) |
| Cell associated | Pho (41) | ||
| p-NPPC hydrolase | Secreted | Yes | PlcA (5), another unidentified activity |
| RNase | Secreted | Yes | Unidentified |
With respect to transmission phase cytotoxicity, host cell membrane degrading and affecting activities such as PLA, acyltransferase, and protease may be upregulated when the bacterium prepares itself for cell exit. Furthermore, phospholipases have been shown to be important virulence factors of other bacteria, such as P. aeruginosa (11, 21, 52, 54, 62) and Listeria monocytogenes (43, 47). It is also interesting that L. pneumophila type II secretion system, rpoS, and letA mutants show similar phenotypes with respect to the defect in bacterial infection of amoebae, which implies furthermore a regulation effect on secreted activities. Due to the fact that there are no data available on the regulation of bacterial phospholipase A or acyltransferase activities and L. pneumophila hydrolytic activities, we elucidated the impact of LetA and RpoS on the regulation of L. pneumophila hydrolytic enzymes. Here we provide data that LetA and RpoS are indeed important regulators of phospholipases A and other hydrolytic activities of L. pneumophila.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
L. pneumophila sg1 JR32 (60) (kindly provided by H. Shuman, Columbia University, New York) served as a wild-type control. Isogenic L. pneumophila JR32 rpoS mutants (32) (kindly provided by H. Shuman) and JR32 letA mutants (44) contained a gentamicin or kanamycin resistance cassette insertion, respectively, in their chromosomal genes. For complementation studies of the JR32 rpoS mutant, vector pLM845 (32) (kindly provided by H. Shuman), containing the complete rpoS gene, was electroporated into the mutant strain. For complementation studies of the L. pneumophila JR32 letA mutant, strain K44, containing the complete letA in trans, was used (44).
For RNase activity studies, L. pneumophila strain 130b (American Type Culture Collection strain BAA-74, also known as Wadsworth or AA100) and its direct derivative NU258, containing an insertion mutation in the Legionella lspDE genes (58) (kindly provided by N. Cianciotto, Northwestern University Medical School, Chicago), were used as a control.
L. pneumophila was routinely grown on buffered charcoal yeast extract (BCYE) agar for 2 to 3 days at 37°C (19). For detection of RNase activity, a modified growth agar was used which was designated buffered starch yeast extract (BSYE) and in which charcoal was replaced by the same amount of starch (VWR, Germany) and 1% (wt/vol) RNA type VI from Torula yeast (Sigma-Aldrich, Taufkirchen, Germany) was added. For extracellular growth in laboratory growth medium, L. pneumophila was cultured in buffered yeast extract (BYE) broth at 37°C with shaking at 300 to 320 rpm. Bacterial growth was checked by determining the optical density of the culture at 660 nm (OD660, spectrophotometer DU520, Beckman Coulter, Unterschleissheim, Germany). Cultures were inoculated with bacteria grown on BCYE agar plates for 2 days at an OD660 of 0.2 to 0.3. When needed, media were supplemented with antibiotics at final concentrations as follows: kanamycin, 25 μg/ml; chloramphenicol, 6 μg/ml; and gentamicin, 5 μg/ml.
Preparation of culture supernatants and cell lysates.
L. pneumophila culture supernatants for assessment of hydrolytic activities were obtained at mid-logarithmic growth phase (OD660 of 1.0) and late logarithmic growth phase (OD660 of 2.0) by centrifugation for 5 min at 5,000 × g. Cell lysates were produced by adding lysozyme and Triton X-100 as described previously (10, 26) and were resuspended in the original culture volume in 40 mM Tris-HCl, pH 7.5 (25°C). Cell lysates were diluted for the enzymatic assay of lipolytic activities at 1:5 and 1:20 with 40 mM Tris-HCl, pH 7.5 (25°C), for the mid-logarithmic growth phase and late logarithmic growth phase, respectively, and at 1:2 for both the phosphatase activity assay and the p-NPPC hydrolase activity assay. Cell culture supernatants and cell lysates were stored at 4°C overnight before being used in the activity assays.
Enzymatic assay for lipolytic activities.
Enzymatic activities were detected as described previously (26, 27). In short, different lipids were incubated with the same volume of bacterial culture supernatant or cell lysate in a mixture containing 6.7 mM substrate [1,2-dipalmitoylphosphatidylcholine (DPPC), 1,2-dipalmitoylphosphatidylglycerol (DPPG), 1-monopalmitoyllysophoshatidylcholine (MPLPC), 1-monopalmitoyllysophosphatidylglycerol (MPLPG), and 1-monopalmitoylglycerol (1-MPG)], 3 mM NaN3, 0.5% (vol/vol) Triton X-100, and 40 mM Tris-HCl pH 7.5 (25°C). Incubation with bacterial cell culture supernatants or cell lysates was performed at 37°C with continuous shaking at 170 rpm for 5 h. Free fatty acids as a marker of lipolytic activity were determined by means of a Nefa-C-kit (WAKO Chemicals, Neuss, Germany) according to the instructions of the manufacturer. BYE broth or 40 mM Tris-HCl, pH 7.5 (25°C), was incubated, treated like the cultures, and subsequently used as a negative control.
For measuring the glycerophospholipid:cholesterol acyltransferase (GCAT) activity of cell culture supernatants, 50 μl cholesterol in ethanol (10 mg/ml) was added to 1 ml of DPPG mixture prior to sonication (26). All lipids, including standards for thin-layer chromatography (TLC), were obtained from Sigma-Aldrich (Taufkirchen, Germany) or Avanti Polar Lipids Inc. (Alabaster, Ala.). Prior to incubation, the lipid substrates were vortexed for 15 min at 37°C and then exposed to ultrasonication using a probe (Sonoplus, Bandelin, Berlin, Germany) three times for 15 s each at cycle 4 and 10% and power set to 65% (27). After the incubation period, the samples were processed by lipid extraction and analyzed by thin-layer chromatography.
Lipid extraction and thin-layer chromatography.
For the detection of distinct apolar lipids, including cholesterol esters, reaction mixtures of lipids and cholesterol with culture supernatant and BYE broth as a negative control were subjected to a lipid extraction (13). The chloroform phase was used for separation of lipids by thin-layer chromatography. For detection of cholesterol esters, silica gel plates (Merck, Darmstadt, Germany) were developed in tanks containing solvent 1, petroleum ether-diethylether-glacial acetic acid in a ratio of 90:10:1 (vol/vol/vol), For the separation of the uncharacterized cholesterol-independent substance, we used solvent 2, n-hexane-diethylether-glacial acetic acid in a ratio of 70:30:4 (vol/vol/vol) (45). Finally, silica gel plates were stained with 0.2% naphthol blue black (Sigma-Aldrich, Taufkirchen, Germany) (26, 55).
Assay for detection of p-nitrophenylphosphorylcholine hydrolase activity.
For the determination of p-NPPC hydrolase, 100 μl L. pneumophila culture supernatant or lysate (diluted at 1:2 with 40 mM Tris-HCl, pH 7.5, 25°C) were incubated with the same volume of substrate mixture containing 10 mM p-NPPC (Sigma-Aldrich, Taufkirchen, Germany), 6 mM NaN3, 1% (vol/vol) Triton X-100, and 10 mM MnCl2 in 40 mM Tris-HCl (pH 7.5, 25°C) at 37°C and with continuous agitation at 100 to 170 rpm for 20 to 50 h. Subsequently the release of p-nitrophenol (p-NP) was measured optically at a wavelength of 405 nm and compared to p-NP (Sigma-Aldrich, Taufkirchen, Germany) standard solutions (9, 22). BYE broth and 40 mM Tris-HCl, pH 7.5 (25°C), were used as negative controls. When precipitation occurred, samples were centrifuged at 350 × g for 10 min and sample supernatants were used for p-NP readings.
Assay for the detection of phosphatase activity.
For the determination of phosphatase activity, 50 μl L. pneumophila culture supernatant or cell lysate (diluted at 1:2 with 40 mM Tris-HCl (pH 7.5, 25°C) was incubated with the same volume of substrate mixture, containing 10 mM p-nitrophenylphosphate (p-NPP) (Sigma-Aldrich, Taufkirchen, Germany), 6 mM NaN3, 1% (vol/vol) Triton X-100 in 40 mM Tris-HCl at 37°C and with continuous agitation at 170 rpm for 1 h as previously described (24). Subsequently the release of p-NP was measured optically at a wavelength of 405 nm and compared to p-NP (Sigma-Aldrich, Taufkirchen, Germany) standard solutions. BYE broth and 40 mM Tris-HCl, pH 7.5 (25°C), were used as negative controls.
Assay for detection of protease activity.
For the detection of protease activity, 50 μl L. pneumophila culture supernatant was incubated with the double volume of substrate mixture, containing 1.33% (wt/vol) azocasein (Sigma-Aldrich, Taufkirchen, Germany) in 40 mM Tris-HCl, pH 7.5 (25°C) at 37°C and with continuous agitation at 170 rpm for 1 h as previously described (24). After treatment as described by Prestidge (56), samples were measured at a wavelength of 420 nm and compared to a reaction product of a protease standard solution (Bacillus polymyxa protease, Sigma-Aldrich, Taufkirchen, Germany; concentrations used in experiment: 0.1, 0.25, and 0.5 U/mg). BYE broth was used as a negative control.
Assay for detection of RNase activity.
For the detection of RNase activity, L. pneumophila strains were grown on BCYE agar plates for 2 to 3 days. Bacterial cells were resuspended in phosphate-buffered saline (137 mM NaCl; 2.7 mM KCl; 4.3 mM Na2HPO4; 1.5 mM KH2PO4) and adjusted to an OD660 of 0.3; 15 μl of this suspension was spotted on an RNA-containing BSYE agar plate and bacteria were grown for 1 to 2 days at 37°C. After the bacterial film was visible, approximately 15 ml of 10% (wt/vol) trichloroacetic acid (4°C) was applied to the agar plate. After 3 to 5 min, clear zones around the bacteria indicated RNA hydrolysis (28).
Investigation of plaC expression.
For preparation of mRNA, obtained from L. pneumophila JR32 wild-type, letA mutant, rpoS mutant, and complemented strains, bacteria were grown in BYE broth to an OD660 of 2.0 and diluted to an OD660 of 0.3 with BYE broth in order to adjust comparable bacterial numbers. An aliquot of 700 μl was mixed with 1,300 μl RNAprotect bacteria reagent (QIAGEN, Germany) and incubated for 5 min at room temperature. Then bacteria were pelleted by centrifugation for 10 min at 5,000 × g and pellets were stored at −80°C until RNA isolation. RNA was isolated using the RNeasy minikit (QIAGEN, Germany) according to the manufacturer's instructions.
Possible DNA contamination was removed with RQ1 RNase-Free DNase (Promega, Germany). Briefly, RNA (0,5 to 2 μg) was mixed with 1 μl 10× DNase buffer, 1 μl RQ1 DNase, and 1 μl RNaseOUT RNase inhibitor (Invitrogen, Germany) and incubated overnight at 37°C. Subsequently, 1 μl DNase STOP buffer was added to the mixture and incubated for 15 min at 65°C to inactivate DNase. reverse transcription (RT) PCR was performed by means of the QIAGEN OneStep RT-PCR kit. Control reactions to check for DNA contamination and for the presence of RNA were performed with specific primers which amplified a part of gyr, the gene coding for the constitutively expressed gyrase subunit B of L. pneumophila. Gene-specific primer pairs are based on the sequence found in the L. pneumophila Philadelphia-1 genome project (http://genome3.cpmc.columbia.edu/∼legion) and are listed in Table 2.
TABLE 2.
Primer pairs used for RT-PCR
| Primer | Sequence 5′-3′ | Product length (bp) |
|---|---|---|
| plaC_s2_f | TGGATTGAGTATTTGGCAGAA | 462 |
| plaC_s2_r | CACGTCACGATCAGTAGTTT | |
| RTgyr_a1f | CACATATGGCCGGCTTTAGAG | 470 |
| RTgyr_b1r | TCGCGCTTGTTTTGCTGAG |
RESULTS
Lipolytic activities of L. pneumophila JR32 letA and rpoS mutants.
L. pneumophila possesses several secreted and cell-associated lipolytic activities: PLA, LPLA, GCAT, and lipase activity (4, 5, 10, 22, 24, 26, 27) (Table 1). In order to examine the role of the global regulator proteins RpoS and LetA with regard to the lipolytic activities, we tested late logarithmic (OD660 of 2.0) and mid-logarithmic (OD660 of 1.0) culture supernatants and cell lysates of the L. pneumophila JR32 wild-type strain and its isogenic rpoS and letA mutants with different substrates for lipolytic activities. Specifically, for detection of PLA activities, bacterial samples were incubated with diacylphospholipids (DPPG and DPPC), for LPLA activities with lysophospholipids (MPLPG and MPLPC), and for lipase activities with a nonphospholipid (1-MPG).
Late-logarithmic-phase culture supernatants of letA and rpoS mutants showed significantly reduced PLA activities in comparison to the wild-type strain (16 and 7% for DPPG, respectively, and 37 and 30% for DPPC, respectively, compared to 100% for JR32) (Fig. 1A). In contrast to the findings for PLA, the LPLA activity of letA and rpoS mutants was significantly higher in late-logarithmic-phase culture supernatants compared to the wild-type strain (167 and 156% for MPLPG, respectively; 175 and 178% for MPLPC, respectively, compared to 100% for JR32) (Fig. 1A). Lipase activity was also increased to 137 and 117% in the letA and the rpoS mutant, respectively (Fig. 1A). The rpoS and letA mutant lipolytic phenotypes could be complemented by introduction of the wild-type genes into the mutant strains (Fig. 1A).
FIG. 1.
Lipolytic activities of L. pneumophila JR32 wild-type and ΔletA and ΔrpoS mutant, complemented ΔletA, and complemented ΔrpoS strains. Late-logarithmic (A) culture supernatants as well as late-logarithmic (B) cell lysates were incubated with DPPC, DPPG, MPLPG, MPLPC, and 1-MPG for 5 h at 37°C. The release of free fatty acids was quantified. Data are expressed as differences between the amount of free fatty acids released by culture samples and the amount released by BYE broth for supernatant samples and 40 mM Tris-HCl (pH 7.5, 25°C) for cell lysates. The results represent the means and standard deviations of duplicate cultures and four reactions and are representative of three independent experiments. For all substrates, ΔletA and ΔrpoS mutants were significantly different from the wild type (P < 0.01; Student's t test, n = 4), except for 1-MPG hydrolysis by cell lysates. (C) TLC analysis of GCAT activity of L. pneumophila JR32 wild-type, ΔletA and ΔrpoS mutant, and complemented ΔletA and ΔrpoS culture supernatants. Culture supernatants were incubated with a mixture of DPPG and cholesterol for 23 h at 37°C, and then lipids were extracted and applied to TLC. A mixture of BYE and the lipids was also incubated and served as a negative control (BYE). An apolar solvent mixture (solvent 1) was employed for the separation of the apolar lipids, in particular for cholesterol ester. For the qualitative identification of the lipid spots, lanes containing lipid standards are marked St. The results are representative of three independent experiments. (D) TLC analysis of an uncharacterized cholesterol-independent reaction product appearing in the acyltransferase assay with L. pneumophila JR32 wild-type, ΔletA and ΔrpoS mutant, and complemented ΔletA and ΔrpoS cell lysates. Cell lysates of the strains were incubated with a mixture of DPPG and cholesterol for 23 h at 37°C, and then lipids were extracted and applied to TLC. An apolar solvent mixture (solvent 2) was employed for the separation of the apolar lipids. The results are representative of three independent experiments. Abbreviations: CholE, cholesterolester; TPG, tripalmitoylglycerol; FFA, free fatty acids; Chol, cholesterol; JR32, L. pneumophila JR32; letA, L. pneumophila JR32 ΔletA; rpoS, L. pneumophila JR32 ΔrpoS; letA C, complemented L. pneumophila JR32 ΔletA; rpoS C, complemented L. pneumophila JR32 ΔrpoS.
The dramatic reduction of secreted PLA activity, as observed in the rpoS and letA mutants, is caused by either the direct or indirect influence of the regulator proteins LetA and RpoS on transcription of genes coding for PLAs or on posttranscriptional events controlling PLA activities. The enzyme that is responsible for the major secreted PLA activity in L. pneumophila could not be identified until now. Nevertheless, there is one candidate gene known to contribute to the secreted PLA activity, as recently Banerji et al. characterized the secreted L. pneumophila enzyme PlaC, which possesses PLA, LPLA, GCAT, and lipase activities (10).
The secreted LPLA activity of L. pneumophila in late-logarithmic-phase cultures was shown to depend >90% on the major secreted LPLA PlaA (26). It is likely that the expression or the activity of this enzyme is regulated negatively by LetA and RpoS in a direct or indirect manner. Furthermore, the slight increase of lipase activity could be due to the influence of the regulator proteins on plaA and plaC transcription, because the PlaA and PlaC enzymes additionally show lipase activity towards 1-MPG (10, 26).
Next, we tested whether L. pneumophila cell-associated lipolytic activities depend on RpoS and LetA. Late-logarithmic-phase cell lysates of L. pneumophila letA and rpoS mutant strains both showed a significant reduction of PLA and of LPLA activities in comparison to the wild-type strain (76 and 63% for DPPG, respectively; 60 and 47% for DPPC, respectively; 70 and 59% for MPLPG, respectively; 64 and 51% for MPLPC, respectively, compared to 100% for JR32) (Fig. 1B). The reductions were restored by complementation of the mutant strains with the wild-type genes.
Since the cell-associated PLA and LPLA activities of L. pneumophila are mainly dependent on the PLA/LPLA PlaB (27), we conclude that LetA and RpoS are involved in the regulation of this enzyme in a positive way. Cell-associated lipase activity is not affected by RpoS and LetA (Fig. 1B). This suggests that the existence of a cell-associated lipase distinct from PlaB is possible for L. pneumophila.
Samples of L. pneumophila letA and rpoS mutants harvested in the mid-logarithmic growth phase (OD660 of 1.0) showed a similar reduction trend in secreted PLA and both cell-associated PLA and LPLA activities, but to a smaller extent (data not shown).
L. pneumophila possesses a major secreted GCAT activity that is coded by plaC (10, 26). This activity is predominantly expressed in the late logarithmic growth phase, but only at a low level in the mid-logarithmic growth phase (Banerji et al., unpublished data). In order to elucidate whether mutations in letA or rpoS affect GCAT activity, culture supernatants of L. pneumophila wild-type and mutant strains were incubated with DPPG and cholesterol and analysis of the GCAT reaction product cholesterol ester was performed by TLC. Indeed, for both of the mutant strains a quantitatively reduced spot of cholesterol ester appeared on the TLC plate in comparison to the wild-type strain JR32, showing that GCAT activity is positively regulated by LetA and RpoS (Fig. 1C). An as yet uncharacterized cholesterol-dependent product of this reaction (10) also disappeared in letA and rpoS reaction samples (Fig. 1C).
L. pneumophila cell lysates did not exhibit a detectable GCAT activity. However, another uncharacterized spot appeared in the wild-type strain, but not in the rpoS and letA mutant strains (Fig. 1D). In contrast to the first uncharacterized cholesterol-dependent product, this spot was not dependent on cholesterol in the acyltransferase reaction assay (data not shown). The generation of the cholesterol-independent product was found to be positively regulated by LetA and RpoS.
The reduction in GCAT activity, the disappearance of the uncharacterized cholesterol-dependent, and the cholesterol-independent substances could be restored by complementation of the mutant strains with the wild-type genes (Fig. 1C and D). As a result, LetA and RpoS are involved in the positive regulation of the secreted GCAT activity of L. pneumophila which is dependent on PlaC (10) and of two yet unknown activities generating two uncharacterized reaction products.
Taken together, LetA and RpoS play a role in the regulation of lipolytic activities especially in the late logarithmic growth phase of L. pneumophila. Secreted PLA and GCAT activities, as well as cell-associated PLA and LPLA activities were regulated in a positive manner, whereas secreted LPLA and lipase activities were negatively regulated (Fig. 1A, B, and C).
Protease activity of L. pneumophila JR32 letA and rpoS mutant strains.
It was shown that L. pneumophila possesses a secreted protease, ProA, which is cytotoxic for macrophages and contributes to virulence of L. pneumophila in a guinea pig model of infection, but is not essential for bacterial multiplication in host cells (18, 31, 40, 48). Banerji et al. showed that ProA is necessary for activation of L. pneumophila PlaC, the secreted enzyme responsible for GCAT, PLA, LPLA, and lipase activities (10). We examined whether mutations in letA or rpoS affect L. pneumophila protease activity by incubating late-logarithmic-phase culture supernatants of L. pneumophila wild-type and mutant strains with azocasein as a protease substrate. Protease activity in letA and rpoS mutants was reduced to 62 and 57%, respectively, in comparison to 100% activity in L. pneumophila JR32. This reduction could be restored by complementation of the mutant strains (Fig. 2). There was no detectable protease activity present in L. pneumophila cell lysate samples (data not shown). With regard to our data, LetA and RpoS play a role in the positive regulation of the secreted protease activity of L. pneumophila, ProA.
FIG. 2.
Protease activities of late-logarithmic-phase culture supernatants of L. pneumophila JR32 wild-type, ΔletA and ΔrpoS mutant strains, and complemented ΔletA and ΔrpoS strains. Late-logarithmic-phase culture supernatants were incubated with azocasein for 1 h at 37°C and azocasein hydrolysis was evaluated. BYE was treated like culture supernatant samples and served as a negative control. Data are expressed as differences between OD420 values of culture samples and the OD420 value of BYE broth. The results represent the means and standard deviations of duplicate cultures and are representative of three independent experiments. ΔletA and ΔrpoS mutants were significantly different from the wild type (P < 0.01; Student's t test, n = 4). Abbreviations: JR32, L. pneumophila JR32; letA, L. pneumophila JR32 ΔletA; rpoS, L. pneumophila JR32 ΔrpoS; letA C, complemented L. pneumophila JR32 ΔletA; rpoS C, complemented L. pneumophila JR32 ΔrpoS.
Phosphatase activity of L. pneumophila JR32 letA and rpoS mutants.
L. pneumophila possesses two secreted phosphatase activities, the major one of which is coded by the map gene (3), and the cell-associated alkaline phosphatase activity Pho (41). In order to investigate whether LetA and RpoS are involved in the regulation of this activity, late-logarithmic-phase culture supernatants and cell lysates were incubated with p-NPP and phosphatase activity was monitored by release of p-NP. letA and rpoS mutant culture supernatants showed a minor reduction in phosphatase activity in comparison to the wild-type strain (92 and 66%, respectively, compared to 100% in JR32). The reduction was restored by complementation of the mutant strains (Fig. 3A). On the other hand, L. pneumophila letA and rpoS mutant late-logarithmic cell lysates had a higher phosphatase activity than the wild-type strain (135 and 122%, respectively, compared to 100% in JR32). This effect was as well restored by complementation (Fig. 3B). LetA and RpoS therefore play a positive role in regulation of secreted phosphatase activity and a negative role in the regulation of cell-associated phosphatase activity.
FIG. 3.

Phosphatase activities of late-logarithmic-phase culture samples of L. pneumophila JR32 wild-type, ΔletA and ΔrpoS mutant strains, and complemented ΔletA and ΔrpoS strains. Late-logarithmic (A) culture supernatants, as well as late-logarithmic (B) cell lysates were incubated with p-NPP for 1 h at 37°C and hydrolysis of p-NPP was evaluated. BYE and 40 mM Tris-HCl (pH 7.5, 25°C) were treated in the same way as the bacterial samples and served as negative controls for culture supernatants and cell lysates, respectively. Data are expressed as differences between the amount of p-NP released by culture samples and the amount released by BYE broth for supernatant samples and 40 mM Tris-HCl (pH 7.5, 25°C) for cell pellet lysates. These results represent the means and standard deviations of duplicate cultures and are representative of three independent experiments. ΔletA and ΔrpoS mutants were significantly different from the wild type in all experiments (P < 0.01; Student's t test, n = 4) except the ΔletA culture supernatant. Abbreviations: JR32, L. pneumophila JR32; letA, L. pneumophila JR32 ΔletA; rpoS, L. pneumophila JR32 ΔrpoS; letA C, complemented L. pneumophila JR32 ΔletA; rpoS C, complemented L. pneumophila JR32 ΔrpoS.
p-NPPC hydrolase activity of L. pneumophila JR32 letA and rpoS mutants.
L. pneumophila secretes a p-NPPC-hydrolyzing activity into its culture supernatant and the PlcA protein contributes to this activity (5, 9, 22). p-NPPC is an artificial substrate for phosphodiesterases, for example, phospholipases C, and has additionally been shown to be cleaved by phosphatases (22, 23, 66). In L. pneumophila it remains to be investigated which biochemical activities (PLC or other phosphodiesterases) hydrolyze p-NPPC. To date, it has not been determined whether L. pneumophila possesses a cell-associated p-NPPC hydrolase activity.
For investigation of the regulatory effect of LetA and RpoS on this hydrolytic activity, late-logarithmic-phase culture supernatants and cell lysates were incubated with p-NPPC andhydrolysis was monitored by release of p-NP. In letA and rpoSmutant strain culture supernatants and cell lysates, the p-NPPC-hydrolyzing activity was reduced significantly compared to the wild-type strain (69 and 54% for supernatants, respectively; 45 and 38% for cell lysates, respectively, compared to 100% in JR32) (Fig. 4A and B). The phenotypes could be restored by complementation (Fig. 4A and B). Therefore, LetA and RpoS positively affect p-NPPC hydrolase activity found in both cell lysate samples and culture supernatant samples.
FIG. 4.

p-NPPC hydrolase activities of late-logarithmic-phase culture samples of L. pneumophila JR32 wild-type, ΔletA and ΔrpoS mutant strains, and complemented ΔletA and ΔrpoS strains. Late-logarithmic (A) culture supernatants, as well as late-logarithmic (B) cell lysates were incubated with p-NPPC for 44 h at 37°C and hydrolysis of p-NPPC was evaluated. BYE and 40 mM Tris-HCl (pH 7.5 25°C) were treated in the same way as the bacterial samples and served as negative controls for culture supernatants and cell pellet lysates, respectively. Data are expressed as differences between the amount of p-NP released by culture samples and the amount released by BYE broth for supernatant samples and 40 mM Tris-HCl (pH 7.5 25°C) for cell lysates. The results shown here represent the means and standard deviations of duplicate cultures and are representative of three independent experiments. ΔletA and ΔrpoS mutants were significantly different from the wild type in all experiments (P < 0.01; Student's t test, n = 4). Abbreviations: JR32, L. pneumophila JR32; letA, L. pneumophila JR32 ΔletA; rpoS, L. pneumophila JR32 ΔrpoS; letA C, complemented L. pneumophila JR32 ΔletA; rpoS C, complemented L. pneumophila JR32 ΔrpoS.
RNase activity of L. pneumophila JR32 letA and rpoS mutants.
L. pneumophila secretes an RNase activity into its culture supernatant which is dependent on translocation by the Lsp type II secretion system (4, 59). In order to elucidate whether LetA and RpoS possess regulatory functions for this secreted activity, L. pneumophila JR32 and letA and rpoS mutants were grown on BSYE agar plates containing RNA. L. pneumophila letA and rpoS mutant strains showed a clear zone development around the bacteria, demonstrating no differences in RNase activity compared to JR32 (diameter of bacterial growth and clearing zones for JR32, 19.28 ± 0.85 mm; ΔletA, 18.85 ± 2.27 mm; Δ letA C, 19.64 ± 0.84 mm; ΔrpoS, 19.24 ± 0.28 mm; and ΔrpoS C, 19.19 ± 0.94 mm). There was no clear zone visible around a L. pneumophila 130b lspDE mutant (58) which was used as a negative control for the RNase test in comparison to wild-type L. pneumophila 130b (130b, 19.26 ± 0.61 mm; 130b ΔlspDE, 11.38 ± 0.17 mm) (Fig. 5). Therefore, L. pneumophila RNase activity is an example for a type II secreted activity that is not regulated by LetA and RpoS.
FIG. 5.

RNase activities of L. pneumophila JR32, ΔletA and ΔrpoS mutant strains, and complemented ΔletA and ΔrpoS strains. Bacterial cell suspensions of the strains were applied to RNA-containing BSYE agar plates and grown for 2 days at 37°C. Then, plates were covered with 10% trichloroacetic acid in order to visualize clear zones in which RNA was hydrolyzed. L. pneumophila strain 130b and its derivate ΔlspDE which is impaired in RNase secretion were used as a negative control by which the effect of the lacking RNase should be demonstrated. The results shown here are representative of three independent experiments. Abbreviations: JR32, L. pneumophila JR32; letA, L. pneumophila JR32 ΔletA; rpoS, L. pneumophila JR32 ΔrpoS; letA C, complemented L. pneumophila JR32 ΔletA; rpoS C, complemented L. pneumophila JR32 ΔrpoS; 130b, L. pneumophila 130b; lspDE, L. pneumophila 130b ΔlspDE.
Gene expression of plaC in L. pneumophila letA and rpoS mutant strains.
In order to investigate whether the changed activity levels of hydrolytic enzymes in L. pneumophila letA and rpoS mutant strains correspond to modified expression of a candidate gene coding for a lipolytic enzyme, we evaluated mRNA quantities for the L. pneumophila PLA, LPLA, and acyltransferase PlaC by RT-PCR. Our data show that plaC expression is reduced in letA and rpoS mutant strains during the late logarithmic growth phase compared to wild-type JR32 and the corresponding complemented strains (Fig. 6). As a standard for constitutive gene expression, the gene coding for subunit B of L. pneumophila gyrase was used. Here, no differences in expression levels were observed between the L. pneumophila strains (Fig. 6). The RNA used for RT-PCR experiments was proved to be free of DNA by leaving out the reverse transcription step of the PCR (data not shown).
FIG. 6.

Expression of plaC in L. pneumophila JR32, ΔletA and ΔrpoS mutant strains, and complemented ΔletA and ΔrpoS strains. RNA was isolated from L. pneumophila late logarithmic growth phase cultures and used for quantitative RT-PCR with specific primers for L. pneumophila plaC. Specific primers for L. pneumophila gyr, the constitutively expressed gene coding for subunit B of gyrase, were used as an internal control. The quantity of RNA applied in the experiment was 0.25 μg. A: 24 PCR cycles; B: 28 PCR cycles. The results shown here are representative of two independent experiments. JR32, L. pneumophila JR32; letA, L. pneumophila JR32 ΔletA; rpoS, L. pneumophila JR32 ΔrpoS; letA C, complemented L. pneumophila JR32 ΔletA; rpoS C, complemented L. pneumophila JR32 ΔrpoS; DNA, JR32 genomic DNA.
DISCUSSION
The life cycle of the pathogen L. pneumophila can be divided into two phases, the replicative phase and the transmissive phase (50). Similar to the situation in other gram-negative bacteria, components of a global regulation system have been identified in L. pneumophila (29, 32, 33, 37, 42, 44). Here, we examined whether two of these proteins, LetA (29, 33, 44) and RpoS (32), influence secreted and cell-associated hydrolytic activities of L. pneumophila.
Here we found that the secreted PLA activity was dramatically decreased in L. pneumophila letA and rpoS mutant strains, similar to the reduction in a type II secretion mutant that is not able to replicate within an amoebae infection model but remains infectious for macrophage cell lines (31, 58). Since this phenotype is also known for the rpoS and letA mutant strains of L. pneumophila JR32 (32, 44), our data point to an important role of PLA activity in infectivity and perhaps also in cytotoxicity of L. pneumophila. The protein that represents the major secreted PLA activity however still needs to be identified.
On the other hand, LPLA activity was significantly increased in L. pneumophila letA and rpoS mutant strains. This increase could be due to a more prominent activity of the major secreted LPLA activity PlaA, but it is also possible that another yet unidentified enzyme that contributes to the secreted LPLA activity is upregulated in the L. pneumophila letA and rpoS mutants. A further possibility is that a cofactor or an activator that is needed for LPLA activity is upregulated in the mutant strains and leads to increased LPLA activity.
We found that many type II secreted activities were decreased in the letA and rpoS knockout mutants (PLA, GCAT, protease, phosphatase, and p-NPPC hydrolase) and this leads to the question of whether the Lsp secretion apparatus may be directly affected in the mutants. However, the increased secreted LPLA activity, which also depends on the type II secretion system Lsp (25, 26), conflicts with this theory. Additionally, secreted RNase activity, which is not present in a type II secretion mutant (58), was not affected by the mutations in letA and rpoS. It is however possible that the Lsp apparatus is indeed influenced by the letA and rpoS mutations and that redundant enzymes translocated by other secretion systems are upregulated and balance the loss of type II secreted activities. Furthermore, LetA or RpoS could affect some sort of chaperone or assistant molecule required by the reduced activities, in order that the enzymatic proteins arrive, translocate, or be processed properly. In addition, it is also possible that mutations in letA and rpoS affect a building block of the Lsp type II secretion system required by some translocated molecules but not by others. Furthermore, the predominant reduction in hydrolytic activities observed in the letA mutant might result from locking the strain in the exponential growth phase, where hydrolytic enzymes of wild-type L. pneumophila would normally increase with growth. We found that the decrease in acyltransferase activity in L. pneumophila letA and rpoS mutants was indeed caused by a decrease in plaC gene expression. However, it still needs to be examined whether LetA or RpoS plays a direct role in the regulation of plaC or whether other members of the regulation cascade exist.
Since L. pneumophila letA and rpoS mutant strains showed very similar phenotypes with respect to the activities investigated, it is likely that these two regulators form a regulation cascade. This has already been hypothesized in several studies (29, 44). Additionally, mid-logarithmic-phase activities of letA and rpoS mutants showed the trend of alterations present in the late-logarithmic activities, but to a smaller extent (data not shown). As it was recently shown that rpoS is already expressed during the exponential growth phase (8), the regulation of hydrolytic enzymes seems to be effective or starts to build up a hydrolytic potential already in the replicative phase.
Here, we showed that the regulation proteins RpoS and LetA, which play a role in the control of bacterial virulence factors of L. pneumophila, control PLA, LPLA, acyltransferase, and other hydrolytic activities of L. pneumophila. Whether LetA and RpoS influence the hydrolytic enzyme activities directly, via regulation of structural gene transcription, or indirectly, via the expression control of activators, cofactors, or components of secretion apparatuses, still needs to be elucidated in future studies. Additionally, the identification of the major enzyme contributing to the secreted PLA activity of L. pneumophila is of importance, because the severe decrease in secreted PLA activity in the L. pneumophila rpoS and letA mutants, as well as in a type II secretion mutant, which are all defective for bacterial replication in amoebae, points to an important role of this enzyme for L. pneumophila's virulence properties.
Acknowledgments
We thank Michele S. Swanson for helpful discussion of our data and Sven Volkmar for providing BSYE/RNA agar plates.
REFERENCES
- 1.Abu, K. Y. 1996. The phagosome containing Legionella pneumophila within the protozoan Hartmannella vermiformis is surrounded by the rough endoplasmic reticulum. Appl. Environ. Microbiol. 62:2022-2028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Alli, O. A., L. Y. Gao, L. L. Pedersen, S. Zink, M. Radulic, M. Doric, and K. Y. Abu. 2000. Temporal pore formation-mediated egress from macrophages and alveolar epithelial cells by Legionella pneumophila. Infect. Immun. 68:6431-6440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Aragon, V., S. Kurtz, and N. P. Cianciotto. 2001. Legionella pneumophila major acid phosphatase and its role in intracellular infection. Infect. Immun. 69:177-185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Aragon, V., S. Kurtz, A. Flieger, B. Neumeister, and N. P. Cianciotto. 2000. Secreted enzymatic activities of wild-type and pilD-deficient Legionella pneumophila. Infect. Immun. 68:1855-1863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Aragon, V., O. Rossier, and N. P. Cianciotto. 2002. Legionella pneumophila genes that encode lipase and phospholipase C activities. Microbiology 148:2223-2231. [DOI] [PubMed] [Google Scholar]
- 6.Bachman, M. A., and M. S. Swanson. 2001. RpoS cooperates with other factors to induce Legionella pneumophila virulence in the stationary phase. Mol. Microbiol. 40:1201-1214. [DOI] [PubMed] [Google Scholar]
- 7.Bachman, M. A., and M. S. Swanson. 2004. The LetE protein enhances expression of multiple LetA/LetS-dependent transmission traits by Legionella pneumophila. Infect. Immun. 72:3284-3293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bachman, M. A., and M. S. Swanson. 2004. Genetic evidence that Legionella pneumophila RpoS modulates expression of the transmission phenotype in both the exponential phase and the stationary phase. Infect. Immun. 72:2468-2476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Baine, W. B. 1985. Cytolytic and phospholipase C activity in Legionella species. J. Gen. Microbiol. 131:1383-1391. [DOI] [PubMed] [Google Scholar]
- 10.Banerji, S., M. Bewersdorff, B. Hermes, N. P. Cianciotto, and A. Flieger. 2005. Characterization of the major secreted glycerophopholipid:cholesterol acyltranferase, PlaC, of Legionella pneumophila dependent on the zinc-metalloprotease. Infect. Immun. 73:2899-2909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Barker, A. P., A. I. Vasil, A. Filloux, G. Ball, P. J. Wilderman, and M.L.Vasil. 2004. A novel extracellular phospholipase C of Pseudomonas aeruginosa is required for phospholipid chemotaxis. Mol. Microbiol. 53:1089-1098. [DOI] [PubMed] [Google Scholar]
- 12.Berger, K. H., and R. R. Isberg. 1993. Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila. Mol. Microbiol. 7:7-19. [DOI] [PubMed] [Google Scholar]
- 13.Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37:911-917. [DOI] [PubMed] [Google Scholar]
- 14.Byrne, B., and M. S. Swanson. 1998. Expression of Legionella pneumophila virulence traits in response to growth conditions. Infect. Immun. 66:3029-3034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Caimano, M. J., C. H. Eggers, K. R. Hazlett, and J. D. Radolf. 2004. RpoS is not central to the general stress response in Borrelia burgdorferi but does control expression of one or more essential virulence determinants. Infect. Immun. 72:6433-6445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Cui, Y., A. Chatterjee, and A. K. Chatterjee. 2001. Effects of the two-component system comprising GacA and GacS of Erwinia carotovora subsp. carotovora on the production of global regulatory rsmB RNA, extracellular enzymes, and harpinEcc. Mol. Plant-Microbe Interact. 14:516-526. [DOI] [PubMed] [Google Scholar]
- 17.Denkin, S. M., and D. R. Nelson. 2004. Regulation of Vibrio anguillarum empA metalloprotease expression and its role in virulence. Appl. Environ. Microbiol. 70:4193-4204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Dreyfus, L. A., and B. H. Iglewski. 1986. Purification and characterization of an extracellular protease of Legionella pneumophila. Infect. Immun. 51:736-743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Edelstein, P. H. 1981. Improved semiselective medium for isolation of Legionella pneumophila from contaminated clinical and environmental specimens. J. Clin. Microbiol. 14:298-303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fields, B. S., R. F. Benson, and R. E. Besser. 2002. Legionella and Legionnaires' disease: 25 years of investigation. Clin. Microbiol. Rev. 15:506-526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Finck-Barbancon, V., J. Goranson, L. Zhu, T. Sawa, J. P. Wiener-Kronish, S. M. Fleiszig, C. Wu, L. Mende-Mueller, and D. W. Frank. 1997. ExoU expression by Pseudomonas aeruginosa correlates with acute cytotoxicity and epithelial injury. Mol. Microbiol. 25:547-557. [DOI] [PubMed] [Google Scholar]
- 22.Flieger, A., S. Gong, M. Faigle, M. Deeg, P. Bartmann, and B. Neumeister. 2000. Novel phospholipase A activity secreted by Legionella species. J. Bacteriol. 182:1321-1327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Flieger, A., S. Gong, M. Faigle, and B. Neumeister. 2000. Critical evaluation of p-nitrophenylphosphorylcholine (p-NPPC) as artificial substrate for the detection of phospholipase C. Enzyme Microb. Technol. 26:451-458. [DOI] [PubMed] [Google Scholar]
- 24.Flieger, A., S. Gong, M. Faigle, H. Northoff, and B. Neumeister. 2001. In vitro secretion kinetics of proteins from Legionella pneumophila in comparison to proteins from non-pneumophila species. Microbiology 147:3127-3134. [DOI] [PubMed] [Google Scholar]
- 25.Flieger, A., S. Gong, M. Faigle, S. Stevanovic, N. P. Cianciotto, and B. Neumeister. 2001. Novel lysophospholipase A secreted by Legionella pneumophila. J. Bacteriol. 183:2121-2124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Flieger, A., B. Neumeister, and N. P. Cianciotto. 2002. Characterization of the gene encoding the major secreted lysophospholipase A of Legionella pneumophila and its role in detoxification of lysophosphatidylcholine. Infect. Immun. 70:6094-6106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Flieger, A., K. Rydzewski, S. Banerji, M. Broich, and K. Heuner. 2004. Cloning and characterization of the gene encoding the major cell-associated phospholipase A of Legionella pneumophila, plaB, exhibiting hemolytic activity. Infect. Immun. 72:2648-2658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Fognini-Lefebvre, N., J. C. Lazzaroni, and R. Portalier. 1987. tolA, tolB and excC, three cistrons involved in the control of pleiotropic release of periplasmic proteins by Escherichia coli K12. Mol. Gen. Genet. 209:391-395. [DOI] [PubMed] [Google Scholar]
- 29.Gal-Mor, O., and G. Segal. 2003. The Legionella pneumophila GacA homolog (LetA) is involved in the regulation of icm virulence genes and is required for intracellular multiplication in Acanthamoeba castellanii. Microb. Pathog. 34:187-194. [DOI] [PubMed] [Google Scholar]
- 30.Garduno, R. A., E. Garduno, M. Hiltz, and P. S. Hoffman. 2002. Intracellular growth of Legionella pneumophila gives rise to a differentiated form dissimilar to stationary-phase forms. Infect. Immun. 70:6273-6283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Hales, L. M., and H. A. Shuman. 1999. Legionella pneumophila contains a type II general secretion pathway required for growth in amoebae as well as for secretion of the Msp protease. Infect. Immun. 67:3662-3666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hales, L. M., and H. A. Shuman. 1999. The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii. J. Bacteriol. 181:4879-4889. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Hammer, B. K., E. S. Tateda, and M. S. Swanson. 2002. A two-component regulator induces the transmission phenotype of stationary-phase Legionella pneumophila. Mol. Microbiol. 44:107-118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Heeb, S., and D. Haas. 2001. Regulatory roles of the GacS/GacA two-component system in plant-associated and other gram-negative bacteria. Mol. Plant-Microbe Interact. 14:1351-1363. [DOI] [PubMed] [Google Scholar]
- 35.Hengge-Aronis, R. 2002. Recent insights into the general stress response regulatory network in Escherichia coli. J. Mol. Microbiol. Biotechnol. 4:341-346. [PubMed] [Google Scholar]
- 36.Heuner, K., B. C. Brand, and J. Hacker. 1999. The expression of the flagellum of Legionella pneumophila is modulated by different environmental factors. FEMS Microbiol. Lett. 175:69-77. [DOI] [PubMed] [Google Scholar]
- 37.Heuner, K., J. Hacker, and B. C. Brand. 1997. The alternative sigma factor sigma28 of Legionella pneumophila restores flagellation and motility to an Escherichia coli fliA mutant. J. Bacteriol. 179:17-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Huebner, R. C., M. A. Gray, J. Holt, X. D. Wu, and J. P. Mays. 2000. Characterization of a recombinant outer surface protein A (OspA) vaccine against Lyme disease. Dev. Biol. (Basel) 103:163-173. [PubMed] [Google Scholar]
- 39.Hulsmann, A., T. M. Rosche, I. S. Kong, H. M. Hassan, D. M. Beam, and J. D. Oliver. 2003. RpoS-dependent stress response and exoenzyme production in Vibrio vulnificus. Appl. Environ. Microbiol. 69:6114-6120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Keen, M. G., and P. S. Hoffman. 1989. Characterization of a Legionella pneumophila extracellular protease exhibiting hemolytic and cytotoxic activities. Infect. Immun. 57:732-738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Kim, M. J., J. E. Rogers, M. C. Hurley, and N. C. Engleberg. 1994. Phosphatase-negative mutants of Legionella pneumophila and their behavior in mammalian cell infection. Microb. Pathog. 17:51-62. [DOI] [PubMed] [Google Scholar]
- 42.Lebeau, I., E. Lammertyn, E. De Buck, L. Maes, N. Geukens, L. Van Mellaert, and J. Anne. 2004. Novel transcriptional regulators of Legionella pneumophila that affect replication in Acanthamoeba castellanii. Arch. Microbiol. 181:362-370. [DOI] [PubMed] [Google Scholar]
- 43.Leimeister-Wachter, M., E. Domann, and T. Chakraborty. 1991. Detection of a gene encoding a phosphatidylinositol-specific phospholipase C that is coordinately expressed with listeriolysin in Listeria monocytogenes. Mol. Microbiol. 5:361-366. [DOI] [PubMed] [Google Scholar]
- 44.Lynch, D., N. Fieser, K. Gloggler, V. Forsbach-Birk, and R. Marre. 2003. The response regulator LetA regulates the stationary-phase stress response in Legionella pneumophila and is required for efficient infection of Acanthamoeba castellanii. FEMS Microbiol. Lett. 219:241-248. [DOI] [PubMed] [Google Scholar]
- 45.MacIntyre, S., T. J. Trust, and J. T. Buckley. 1979. Distribution of glycerophospholipid-cholesterol acyltransferase in selected bacterial species. J. Bacteriol. 139:132-136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Marra, A., S. J. Blander, M. A. Horwitz, and H. A. Shuman. 1992. Identification of a Legionella pneumophila locus required for intracellular multiplication in human macrophages. Proc. Natl. Acad. Sci. USA 89:9607-9611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Mengaud, J., C. Braun-Breton, and P. Cossart. 1991. Identification of phosphatidylinositol-specific phospholipase C activity in Listeria monocytogenes: a novel type of virulence factor? Mol. Microbiol. 5:367-372. [DOI] [PubMed] [Google Scholar]
- 48.Moffat, J. F., P. H. Edelstein, D. P. Regula, Jr., J. D. Cirillo, and L. S. Tompkins. 1994. Effects of an isogenic Zn-metalloprotease-deficient mutant of Legionella pneumophila in a guinea-pig pneumonia model. Mol. Microbiol. 12:693-705. [DOI] [PubMed] [Google Scholar]
- 49.Molmeret, M., D. M. Bitar, L. Han, and Y. A. Kwaik. 2004. Disruption of the phagosomal membrane and egress of Legionella pneumophila into the cytoplasm during the last stages of intracellular infection of macrophages and Acanthamoeba polyphaga. Infect. Immun. 72:4040-4051. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Molofsky, A. B., and M. S. Swanson. 2004. Differentiate to thrive: lessons from the Legionella pneumophila life cycle. Mol. Microbiol. 53:29-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Molofsky, A. B., and M. S. Swanson. 2003. Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication. Mol. Microbiol. 50:445-461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Ostroff, R. M., A. I. Vasil, and M. L. Vasil. 1990. Molecular comparison of a nonhemolytic and a hemolytic phospholipase C from Pseudomonas aeruginosa. J. Bacteriol. 172:5915-5923. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Park, K. J., M. J. Kang, S. H. Kim, H. J. Lee, J. K. Lim, S. H. Choi, S. J. Park, and K. H. Lee. 2004. Isolation and characterization of rpoS from a pathogenic bacterium, Vibrio vulnificus: role of σS in survival of exponential-phase cells under oxidative stress. J. Bacteriol. 186:3304-3312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Phillips, R. M., D. A. Six, E. A. Dennis, and P. Ghosh. 2003. In vivo phospholipase activity of the Pseudomonas aeruginosa cytotoxin ExoU and protection of mammalian cells with phospholipase A2 inhibitors. J. Biol. Chem. 278:41326-41332. [DOI] [PubMed] [Google Scholar]
- 55.Plekhanov, A. Y. 1999. Rapid staining of lipids on thin-layer chromatograms with amido black 10B and other water-soluble stains. Anal. Biochem. 271:186-187. [DOI] [PubMed] [Google Scholar]
- 56.Prestidge, L., V. Gage, and J. Spizizen. 1971. Protease activities during the course of sporulation on Bacillus subtilis. J. Bacteriol. 107:815-823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Reimmann, C., M. Beyeler, A. Latifi, H. Winteler, M. Foglino, A. Lazdunski, and D. Haas. 1997. The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N-butyryl-homoserine lactone and the formation of the virulence factors pyocyanin, cyanide, and lipase. Mol. Microbiol. 24:309-319. [DOI] [PubMed] [Google Scholar]
- 58.Rossier, O., and N. P. Cianciotto. 2001. Type II protein secretion is a subset of the PilD-dependent processes that facilitate intracellular infection by Legionella pneumophila. Infect. Immun. 69:2092-2098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Rossier, O., S. R. Starkenburg, and N. P. Cianciotto. 2004. Legionella pneumophila type II protein secretion promotes virulence in the A/J mouse model of Legionnaires' disease pneumonia. Infect. Immun. 72:310-321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Sadosky, A. B., L. A. Wiater, and H. A. Shuman. 1993. Identification of Legionella pneumophila genes required for growth within and killing of human macrophages. Infect. Immun. 61:5361-5373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Samrakandi, M. M., S. L. Cirillo, D. A. Ridenour, L. E. Bermudez, and J. D. Cirillo. 2002. Genetic and phenotypic differences between Legionella pneumophila strains. J. Clin. Microbiol. 40:1352-1362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Sato, H., D. W. Frank, C. J. Hillard, J. B. Feix, R. R. Pankhaniya, K. Moriyama, V. Finck-Barbancon, A. Buchaklian, M. Lei, R. M. Long, J. Wiener-Kronish, and T. Sawa. 2003. The mechanism of action of the Pseudomonas aeruginosa-encoded type III cytotoxin, ExoU. EMBO J. 22:2959-2969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Segal, G., M. Feldman, and T. Zusman. 2005. The Icm/Dot type-IV secretion systems of Legionella pneumophila and Coxiella burnetii. FEMS Microbiol. Rev. 29:65-81. [DOI] [PubMed] [Google Scholar]
- 64.Segal, G., and H. A. Shuman. 1997. Characterization of a new region required for macrophage killing by Legionella pneumophila. Infect. Immun. 65:5057-5066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Silva, A. J., and J. A. Benitez. 2004. Transcriptional regulation of Vibrio cholerae hemagglutinin/protease by the cyclic AMP receptor protein and RpoS. J. Bacteriol. 186:6374-6382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Srivastava, P. N., J. M. Brewer, and R. A. White, Jr. 1982. Hydrolysis of p-nitrophenylphosphorylcholine by alkaline phosphatase and phospholipase C from rabbit sperm-acrosome. Biochem. Biophys. Res. Commun. 108:1120-1125. [DOI] [PubMed] [Google Scholar]
- 67.Swanson, M. S., and R. R. Isberg. 1996. Analysis of the intracellular fate of Legionella pneumophila mutants. Ann. N. Y. Acad. Sci. 797:8-18. [DOI] [PubMed] [Google Scholar]
- 68.Whistler, C. A., N. A. Corbell, A. Sarniguet, W. Ream, and J. E. Loper. 1998. The two-component regulators GacS and GacA influence accumulation of the stationary-phase sigma factor σS and the stress response in Pseudomonas fluorescens Pf-5. J. Bacteriol. 180:6635-6641. [DOI] [PMC free article] [PubMed] [Google Scholar]


