Novel variant and enteroendocrine hormone deficiency in a patient with proline and glutamate‐rich protein with a coiled coil domain 1 (PERCC1) associated enteropathy: New diagnostic and therapeutic insights

Abstract

Proline and glutamate‐rich protein with a coiled coil domain 1 (PERCC1)‐associated enteropathy is a rare monogenic congenital diarrhea due to defective enteroendocrine cells (EECs). We describe a 6‐year‐old female with intestinal failure since birth. Biopsies demonstrated normal appearing gastric mucosa on hematoxylin and eosin stains. Commercial whole‐exome sequencing did not reveal clinically relevant variants. Subsequent testing, prompted by undetectable serum Gastrin, identified compound heterozygous variants in PERCC1: c.390 C > G (Y130X) and a novel c.492del (S164RfsX33) variant. Hormonal profiling showed low endogenous glucagon‐like peptide (GLP)‐1 and ‐2 levels, pre and postprandial. Immunohistochemistry showed a markedly reduced density of Gastrin containing G‐cells and preserved EEC. At 5.5 years, endogenous GLP‐2 deficiency supported off‐label Teduglutide therapy. Baseline Parenteral Nutrition Dependency Index (PNDI) was 67%; after 16 months, PNDI decreased to 35%, with improved stool output and appetite. Congenital diarrhea with low serum levels of Gastrin, GLP‐1, and ‐2 and abnormal G‐cell staining should prompt targeted genetic analysis for PERCC1 with whole genome sequencing. Timely diagnosis enables Teduglutide therapy and parenteral nutrition weaning.

1. INTRODUCTION

Congenital diarrhea and enteropathies (CODE) are a rare group of severe neonatal diseases. An increasingly recognized subgroup of CODE is caused by disruption in enteroendocrine cell (EEC) differentiation and/or development. A recessive type of EEC‐related infantile‐onset diarrhea, first described clinically in Jewish Iraqi families in 1997 ¹ was recently linked to biallelic deletion of the PERCC1 (proline and glutamate‐rich protein with a coiled coil domain 1) gene, a previously unannotated open reading frame first identified in 2019. ² PERCC1 codes for a proline and glutamate‐rich protein, whose role is still under investigation. Evolutionary bioinformatic analysis of PERCC1 suggested that it is a member of the YAP/TAZ/FAM181 family, involved in cell proliferation and survival. ³

Studies on patient‐derived intestinal organoids and knockout mice show impaired EEC development and reduced hormone production in patients with PERCC1. ² , ⁴ Stenke et al. found negligible level of Gastrin, endogenous glucagon‐like peptide (GLP)‐2 and other EEC derived hormones in a 14‐year‐old affected patient, and achieved reversal of this patient's intestinal failure using the GLP‐2 analogue, Teduglutide. ⁵ More recently, Tran et al. reported a 3‐year‐old affected patient, who was weaned off parenteral nutrition (PN) 2 months after starting Teduglutide. ⁶

PERCC1 enteropathy remains an ultra‐rare condition, with only 18 cases reported, ⁶ , ⁷ and is likely underdiagnosed as many commercial exome sequencing kits don't include probes designed to amplify this annotated signal coding exon gene. ² , ⁴ , ⁸ Clinically, PERCC1 presents as non‐syndromic, diet‐induced diarrhea requiring PN. Early detection is critical, as timely initiation of GLP‐2 analogue reduces PN dependency and can improve outcome. Herein, we describe a new case with a novel variant who was treated with Teduglutide.

2. CASE REPORT

A 6‐year‐old female of maternal Ashkenazi Jewish descent and father of Irish descent, was born at term following an uncomplicated pregnancy. At 13 days of life, she presented with poor feeding and severe osmotic diarrhea, indistinguishable from urine. Initial endoscopic and histological evaluations were normal, and she was discharged on hydrolyzed formula for suspected cow's milk protein allergy. Recurrent hospitalizations for dehydration followed, culminating at 2 months with significant weight loss, hyponatremia, and worsening diarrhea post‐Rotavirus vaccination. Repeated endoscopy with duodenal biopsies showed non‐specific findings. Immunology work up was negative. Whole exome sequencing was negative. She was discharged on home PN.

During follow‐up, she remained stable on PN but had poor oral intake due to high stool output, nausea, and food aversion which had slightly improved overtime. Recent reports on PERCC1 enteropathy and undetectable blood Gastrin level (<15 pg/mL) prompted targeted genetic testing, revealing compound heterozygosity: the known c.390 C > G (Y130X) variant (clinvar accession—VCV003255349.1) and a novel c.492del variant (g.16:1433085 C/‐ [GRCh38] c.492del [NM_001365310.2] p.S164RfsX33 [NP_001352239.1]) (Figure 1). Endocrine profiling with Mercodia Elisa showed low GLP‐1 and GLP‐2 plasma levels (1.8, 1.8, and 1.7 pmol/L for GLP‐1 and 2, 7 and 6 pmol/L for GLP‐2, at fasting, 45 min and 90 min postprandial, respectively). Immunohistochemistry (IHC) was performed on the initial normal Hematoxylin and eosin (H&E) appearing gastric antral biopsy, and revealed preserved EEC distribution on Synaptophysin and Chromogranin A stains, while gastrin containing G‐cells were markedly reduced on gastrin stain (Figure 2).

Figure 1.

Compound heterozygous variants in PERCC1 identified in a patient with congenital diarrhea. (A) Family pedigree showing PERCC1 allele segregation. (B) Sanger sequence chromatographs of two single nucleotide changes (underlined) in the proband (down arrows) inherited from the mom (left) and dad (right—deletion). Sanger sequencing was performed using following primers: Forward: 5′ GTACTTTGGCCGCAAGGATAA: Reverse: 5′ TGAGCTCAAGCCTCCCTTT). (C) Schematic representation of the PERCC1 protein domain architecture highlighting evolutionarily conserved motifs defined by Sanchez‐Pulido et al. ³ The numbers on top indicate the amino acid residues, and the predicted protein truncations of the maternal and paternal alleles are depicted underneath. aa, amino acids; COOH, C‐terminus; I2, Interface2; I3, Interface3; NH2, N‐terminus; PERCC1, proline and glutamate‐rich protein with a coiled coil domain 1; polyE, poly glutamate.

Figure 2.

Antral biopsies from a patient with proline and glutamate‐rich protein with a coiled coil domain 1 defect (PERCC1). (A) Hematoxylin and eosin stain showing normal appearing antral biopsy of the patient; (B) immunohistochemistry for Gastrin is almost negative with rare G‐cells present (red arrows); (C) tissue control of normal gastric antrum with numerous G‐cells present; (D) immunohistochemistry for Chromogranin A confirming the presence of endocrine cells in the patient's antral biopsy (×20 magnification, all images).

At 5.5 years, endogenous GLP‐2 deficiency supported off‐label Teduglutide therapy. Baseline PN Dependency Index (PNDI) was 67%. After 16 months, PNDI decreased to 35%, with reduced TPN frequency, and reduced stool output (Table 1). Due to limited oral intake and slower than expected PN weaning an upper endoscopy was done 15 months after Teduglutide initiation, and revealed endoscopy and pathology confirmed eosinophilic esophagitis (EoE). No major adverse effects were reported, aside from manageable reflux and needle phobia.

Table 1.

Patient characteristics at baseline and at 16 months after starting Teduglutide.

Characteristic	Baseline	16 months
Weight, kg (percentile)	15.6 (8th)	18.7 (14th)
Height, cm (percentile)	105 (17th)	111.4 (6th)
Body mass index, kg/m2 (percentile)	14.24 (23th)	14.5 (29th)
Parenteral nutrition requirement
Parenteral Nutrition Dependency Index%	67	35
mL/kg/day	55	19
kcal/kg/day	40	21
Nights/week	7	4
Oral intake, kcal/day (kcal/kg/day)	1000 (64)	1350 (77)
Oral intake, mL/kg (mL/kg/day)	800 (51)	830 (47)
Stools per 24 h, n	3–5	2

3. DISCUSSION

PERCC1 enteropathy is an ultra‐rare condition due to ECC dysfunction. We describe the 19th case of PERCC1 enteropathy, the third treated with Teduglutide and provide new insights into the diagnostic process. ⁵ , ⁶ , ⁷

The patient was found to carry the known Irish variant c.390 C > G (p.Tyr130*) on one allele. Given the autosomal recessive inheritance and strong clinical suspicion based on undetectable level of Gastrin, further analysis was pursued to identify a second pathogenic allele. Sanger sequencing confirmed a novel heterozygous single‐nucleotide deletion (c.492del) on the second allele, inherited from the father. This variant is absent in gnomADv4 (https://gnomad.broadinstitute.org/, PMID: 38057664) and TOPMEDv10 (https://bravo.sph.umich.edu/) databases and is to our knowledge not previously reported, expanding the spectrum of known PERCC1 variants. The c.492del change leads to a frameshift (p.S164Rfsx32) expected to produce a truncated protein, consistent with possible loss‐of‐function. However, protein level validation is currently not feasible as PERCC1 is a newly described gene with limited characterization, no commercially available antibodies, and expression is restricted to rare EEC populations (Protein Atlas version 25.0).

This is the first reported case with in vivo immunohistochemical assessment of G‐cells in PERCC1 enteropathy, showing reduced number of positive G‐cells when gastrin IHC is used. Analysis of mRNA hybridization in wild type and transgenic mice carrying a PERCC1 fusion construct revealed PERCC1 expressing cells are predominantly EEC, including G‐cells ² Consistent with animal data, patients with a PERCC1 defect exhibit low serum Gastrin levels and unremarkable Chromogranin A and Synaptophysin staining. ² , ⁶ These observations indicate that EEC appear to form normally but fail to differentiate into specific subtypes or produce certain enteroendocrine hormones, causing functional impairment.

While reduced GLP‐2 serum concentrations have been previously reported in PERCC1 enteropathy, ⁵ we observed for the first time that both GLP‐1 and ‐2 serum levels were decreased. These peptides are co‐secreted from enteroendocrine L‐cells and are generated from the same precursor molecule, proglucagon, through enzymatic cleavage. Their concomitant reduction points toward a broader EEC impairment, potentially specifically involving the L‐cells. Further studies are warranted to clarify the pathophysiological basis of this observation.

Ultimately, this case illustrates how precision medicine can improve outcomes in rare enteropathies. Diagnosis of PERCC1 enteropathy with GLP‐2 deficiency enabled targeted therapy with Teduglutide. The patient exhibits reduction in PN dependency, without significant side effects. These findings align with previous reports from Stenke et al. and Tran et al., in which patients discontinued PN within 1 week and 2 months, respectively. ⁵ However, in our case, the improvement is less pronounced as she still requires PN after 16 months. The patient was subsequently diagnosed with EoE, which probably contributed to difficulties with oral feeding beyond behavioral aspects, and delayed PN weaning. Currently, it's unknown if EoE is part of the expanding phenotype of PERCC1 or unique to this patient.

4. CONCLUSION

The insights gained from this case and previous reports suggest a practical diagnostic approach for this hard to establish genetic diagnosis. In infants presenting with early‐onset, diet induced diarrhea of unknown etiology and normal gastric and duodenal biopsy findings, serum Gastrin levels should be assessed. If Gastrin is undetectable, G‐cell immunostaining on antral biopsies is useful. A marked reduction in density of Gastrin positive cells should raise strong clinical suspicion for PERCC1 enteropathy, warranting focused genetic testing of the PERCC1 gene, utilizing whole genome sequencing. In addition, upon confirmation and demonstration of low GLP‐2 level, targeted hormone replacement therapy with Teduglutide can be considered.

CONFLICT OF INTEREST STATEMENT

Yaron Avitzur is supported by a non‐restricted grant by Takeda LTD for the International Intestinal Failure Registry. The remaining authors declare no conflicts of interest.

ETHICS STATEMENT

Written informed consent was obtained from the patient's parents/legal guardians.

Di Chio T, Gattini D, Belza C, et al. Novel variant and enteroendocrine hormone deficiency in a patient with proline and glutamate‐rich protein with a coiled coil domain 1 (PERCC1) associated enteropathy: new diagnostic and therapeutic insights. JPGN Rep. 2026;1‐4. 10.1002/jpr3.70259

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.