Abstract
Background:
Obesity is a growing health concern, with an increasing prevalence. Overconsumption of a high-fat diet (HFD) is a risk factor for various diseases, including chronic kidney disease. Chronic HFD intake appears to be connected with ectopic deposition of lipids in the kidney, induction of endoplasmic reticulum (ER) stress, and renal dysfunction. Trans-chalcone is a flavonoid precursor with beneficial hepatoprotective, anti-inflammatory, anti-obesity, and anti-diabetic properties. Considering the role of fatty acid-binding protein 4 (FABP4) in triggering kidney diseases and inducing ER stress in response to lipids, the possible effects of Trans-chalcone and HFD intake on the renal expressions of FABP4 and indicators of ER stress were examined.
Materials and Methods:
Twenty-one male Wistar rats were grouped into three groups: (1) control received 10% Tween 80, (2) HFD received a liquid HFD (10 mL/kg) and 10% Tween 80, and (3) HFD plus chalcone received a liquid HFD and Trans-chalcone (20 mg/kg). Administrations were performed by daily oral gavage for 42 consecutive days. Finally, fasting blood samples were used to evaluate Castelli’s Risk Index-II (CRI-II). Additionally, the expression levels of FABP4, CAAT-enhancer-binding protein (C/EBP) homologous protein (CHOP), and glucose-regulated protein 78 (GRP78) in kidney samples were evaluated using real-time PCR.
Results:
Feeding with HFD significantly increased the atherogenic index (CRI-II) and the expression levels of FABP4, GRP78, and CHOP in the kidneys of animals. Conversely, Trans-chalcone significantly prevented these HFD-induced alterations.
Conclusion:
Trans-chalcone can inhibit HFD-induced ER stress by suppressing FABP4 expression in the kidneys of rats fed the HFD.
Keywords: Endoplasmic reticulum stress, fatty acid-binding protein 4, kidney, Trans-chalcone
INTRODUCTION
The prevalence of non-communicable chronic diseases, which are essentially the consequences of consuming unhealthy dietary patterns, is increasing around the world.[1] Previous studies have suggested that a chronic high-fat diet (HFD) intake is a risk factor for several diseases, such as chronic kidney disease (CKD), diabetes, non-alcoholic fatty liver disease, and some types of cancer.[2,3,4,5,6] Lipotoxicity, associated with excessive HFD intake, refers to the ectopic deposition of harmful fats in tissues, followed by organ injury. In the kidney, lipotoxicity causes injury by several mechanisms, including inflammation, mitochondrial dysfunction, endoplasmic reticulum (ER) stress, oxidative stress, and autophagy dysregulation.[3,6,7] As a complex organelle, the ER plays vital roles in protein folding, trafficking, and cellular homeostasis.[8,9] Aging, oxidative stress, high levels of free fatty acids, and hyperglycemia are stimuli that disturb protein homeostasis and cause the aggregation of unfolded or misfolded proteins within the ER lumen, a process known as ER stress.[8,10,11,12] Then, ER stress initiates the unfolded protein response (UPR), which acts to normalize the function of ER.[9] However, persistent or severe ER stress results in apoptosis and cell injury.[9,13,14,15] In this regard, severe ER stress up-regulates CAAT-enhancer-binding protein (C/EBP) homologous protein (CHOP) expression with a central role in ER stress-related apoptosis.[14,16].
As a member of the FABP family, fatty acid-binding protein 4 (FABP4) is expressed in macrophages,[17] adipocytes,[18] endothelial cells,[19] and different parts of the kidney.[17,20,21,22] The contribution of FABP4 in the etiology of various kidney diseases has been known.[6,22,23,24] It seems that FABP4 is linked to ectopic fat deposition in different organs.[25] It reversibly binds with lipids and plays a vital role as an intermediary in triggering ER stress in response to lipids.[13,22,26] Glucose-regulated protein 78 (GRP78), a member of the heat-shock protein (HSP70) family, is an ER chaperone. At the molecular level, it is an indicator of ER stress.[27,28] CHOP is another indicator of ER stress,[28,29] and its expression is regulated at the transcriptional (mRNA) level.[16,30] This marker of ER stress mediates cell apoptosis.[28,29]
Considering the increasing prevalence of non-communicable chronic diseases[1] and the role of lipotoxicity in renal dysfunction,[3,7,31,32] It is vital to find safe compounds with a protective role against HFD-induced kidney injury, and also identify their mechanisms of action. Trans-chalcone (1,3-Diphenyl-2-Propen-1-One), a member of the flavonoid family, is an intermediate in flavonoid biosynthesis.[33,34] This simple compound has several beneficial effects, such as anti-inflammatory, hepatoprotective, and anti-diabetic actions.[35,36,37] Notably, Trans-chalcone could inhibit HFD-induced increases in lipogenic genes expression in the livers and kidneys of rats.[35,37] However, the possible effects of this compound on HFD-induced ER stress and FABP4 expression are currently unknown. Hence, the present study investigated the potential impact of Trans-chalcone on FABP4 expression and ER stress in HFD-fed animals. The results of this study introduced a new molecular mechanism underlying the beneficial influence of Trans-chalcone on the kidney during metabolic syndrome.
MATERIALS AND METHODS
Animal experiments
Twenty-one male Wistar rats, weighing between 200 and 250 g, were purchased from the animal house of Tabriz University of Medical Sciences and kept under standard conditions (at 22 ± 2°C and 12 h dark/light cycle). All rats had unrestricted access to water and a standard diet throughout the experimental period. After a seven-day acclimatization period, the animals were randomly grouped into three experimental groups (n = seven rats per group):
The control (C) group received 10% Tween 80.
The HFD group received a liquid HFD (10 mL/kg)[38] and 10% Tween 80.
The HFD plus Trans-chalcone (HFD + TC) group received a liquid HFD (10 mL/kg) and Trans-chalcone (20 mg/kg).[35]
Tween 80 (10%) was used as a solvent for Trans-chalcone in the HFD + TC group, and 2 mL of Tween 80 (10%) was administered to the control and HFD groups. Tween 80, Trans-chalcone, and liquid HFD were administered by oral gavage once a day for 42 consecutive days.[35] The composition of the liquid HFD was as follows: 400 g of corn oil, 100 g of cholesterol, 36.4 g of Tween 80, 150 g of sucrose, 300 mL of distilled water, 80 g of whole milk powder, 31.1 g of propylene glycol, 10 g of sodium deoxycholate, 10 g of table salt, 1.5 g of mineral mixture, and 2.5 g of vitamin mixture. The caloric content of this HFD was 4342 kcal/L.[38]
After completion of all treatments, a mixture of ketamine (60 mg/kg) and xylazine (10 mg/kg) combination was injected intraperitoneally into overnight (8 h) fasted rats for anesthesia.[35] Blood samples from the inferior vena cava and kidney samples were collected immediately from all rats.
Biochemical measurements
Commercial kits (Pars Azmoon, Tehran, Iran) were used to measure high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) levels in serum samples. These parameters were used to calculate Castelli’s Risk Index-II (CRI-II) using the following formula:
Real-time PCR
The RNX-Plus solution kit from Fermentase, Cinagen Co., Iran, was utilized for total RNA extraction from kidney samples. As described in a previous study,[41] complementary DNA synthesis was carried out by Thermo Fisher Scientific Revert Aid Reverse Transcriptase (Thermo Scientific, Waltham, MA). To determine the expression levels of the target genes (GRP78, CHOP, and FABP4), normalization was performed using β-actin (as a housekeeping gene) and relative quantification using the 2−ΔΔCt method.[41] Table 1 displays the primer sequences of the housekeeping and target genes.
Table 1.
Primers used for real-time PCR analysis
| Primer name | Gene bank Accession No. Grp78 |
Primer sequence (5′→3′) |
|---|---|---|
| FABP4 | NM_053365.1 | Forward: GAAAGAAGTGGGAGTTGGCT |
| Reverse: TACTCTCTGACCGGATGACG | ||
| GRP78 | AY_216677 | Forward: CAGATCTTCTCCACGGCTTC |
| Reverse: GCAGGAGGAATTCCAGTCAG | ||
| CHOP | NM_024134 | Forward: GCATGAAGGAGAAGGAGCA |
| Reverse: CTTCCGGAGAGACAGACAG | ||
| β-actin | NM_031144.3 | Forward: GCGTCCACCTGCTAGTACAAC |
| Reverse: CGACGACTAGCTCAGCGATA |
Sequences were derived from NCBI (www.ncbi.nlm.nih.gov). CHOP: CAAT-enhancer-binding protein (C/EBP) homologous protein, FABP4: fatty acid-binding protein 4, GRP78: glucose-regulated protein 78
Statistical analysis
GraphPad Prism 7 (GraphPad Software, Inc., La Jolla, CA, USA) software was used for data analysis and graph plotting. Data are expressed as the mean ± standard error of the mean (SEM). The analysis of gene expression data was executed by one-way ANOVA followed by Tukey’s post-hoc test. The statistical significance level was defined as P < 0.05.
RESULTS
The effects of HFD-feeding and co-treatment with HFD and Trans-chalcone on CRI-II (LDL-C/HDL-C ratio) are indicated in Figure 1. In this case, the HFD significantly increased the CRI-II (P < 0.001). Additionally, Trans-chalcone caused a significant decrease (P < 0.001) in this atherogenic index in the HFD + TC group compared to the HFD group.
Figure 1.
The LDL-C/HDL-C ratio in experimental groups (n = 7). Data are expressed as mean ± SEM. ***P < 0.001 compared to the control group, ###P < 0.001 compared to the HFD group. C, control; HDL-C, high-density lipoprotein cholesterol; HFD, high-fat diet; HFD + TC, high-fat diet + Trans-chalcone; LDL-C, low-density lipoprotein cholesterol
Real-time PCR was conducted to investigate the influences of HFD-feeding and Trans-chalcone treatment on the renal expression of FABP4. As indicated in Figure 2, feeding with HFD significantly (P < 0.01) up-regulated FABP4 expression levels in the HFD group compared to the control group. Conversely, Trans-chalcone significantly (P < 0.05) down-regulated FABP4 expression levels in the HFD + TC group compared to the HFD group, reaching levels similar to the control.
Figure 2.
The mRNA expression levels of FABP4 in the kidneys of rats in experimental groups. Data are expressed as mean ± SEM (n = 4, duplicated). **P < 0.01 compared to the control group, #P < 0.05 compared to the HFD group. C, control; FABP4, Fatty acid binding protein 4; HFD, high-fat diet; HFD + TC, high-fat diet + Trans-chalcone.
As depicted in Figure 3, the mRNA expression levels of markers of ER stress, including GRP78 and CHOP, were significantly (P < 0.001) up-regulated in the kidneys of rats in the HFD group compared to the control group. Nevertheless, Trans-chalcone reversed these HFD-induced changes. The expression levels of GRP78 and CHOP were significantly lower in the HFD + TC group compared to the HFD group (P < 0.05 and P < 0.01, respectively) [Figure 3a and b].
Figure 3.
The mRNA expression levels of GRP78 (a) and CHOP (b) in the kidneys of rats in experimental groups (n = 4, duplicated). Data are expressed as mean ± SEM. ***P < 0.001 compared to the control group, #P < 0.05 compared to the HFD group, ##P < 0.01 compared to the HFD group. C, control; CHOP, CAAT-enhancer-binding protein (C/EBP) homologous protein, GRP78; Glucose-regulated protein 78, HFD, high-fat diet; HFD + TC, high-fat diet + Trans-chalcone
DISCUSSION
The present study examined the influences of HFD-feeding and co-treatment with Trans-chalcone on the renal mRNA expression levels of FABP4 and ER stress markers. According to the main findings of this study, chronic HFD intake significantly increased CRI-II levels, and Trans-chalcone could prevent the HFD-induced increase in this lipid index. On the other hand, feeding with HFD up-regulated the expression of renal FABP4, and Trans-chalcone prevented this HFD-induced alteration. Additionally, HFD-feeding led to the induction of ER stress in the kidneys of rats, and Trans-chalcone prevented this HFD-induced ER stress.
It is known that LDL-C to HDL-C ratio is a good predictor of cardiovascular risks.[42] In patients with CKD, the prevalence of dyslipidemia is much higher than in the general population.[43] In particular, these patients indicate higher levels of atherogenic index (CRI-II) compared to healthy adults.[40] In this study, HFD-fed animals showed increased CRI-II levels. On the other hand, Trans-chalcone inhibited HFD-induced elevation of this lipid index. Similarly, the role of Trans-chalcone in protection against HFD-induced insulin resistance and dyslipidemia has been suggested previously.[35,36]
Renal lipotoxicity promotes oxidative stress, ER stress, inflammation, and renal dysfunction.[3,7,31,32] It has been proposed that increased expression of FABP4 is linked to lipid accumulation during the progression of kidney diseases. In this regard, up-regulation of FABP4 expression causes lipid accumulation by impairing fatty acid oxidation.[6] It has also been shown that pharmacological inhibition of FABP4 can protect against renal ischemia-reperfusion injury.[24] In the current study, feeding with HFD increased expression levels of renal FABP4, but Trans-chalcone effectively prevented this change. Consistent with these results, in a recent study, persistent oral gavage of rats with liquid HFD resulted in renal injury, and Trans-chalcone could exert protective effects against this injury.[37] In the mentioned study, Trans-chalcone inhibited HFD-induced up-regulation of sterol regulatory element-binding protein (SREBP)-1c, fatty acid synthase (FAS), and Smad-3 gene expression levels.[37] SREBP-1c is a transcription factor for activating the transcription of lipogenic genes like FAS.[44] Hence, it seems that Trans-chalcone has a protective role against HFD-induced fat accumulation in the kidneys of animals.[37] Additionally, treatment with Trans-chalcone improved hepatic lipid metabolism in a rat model of HFD-induced non-alcoholic steatohepatitis (NASH). The anti-NASH influence of Trans-chalcone was mediated by diminishing hepatic lipogenesis, increasing fatty acid oxidation, and even promoting the efflux of cholesterol from hepatocytes.[35,36] Therefore, the repression of FABP4 expression in the kidneys of HFD-fed rats may be a mechanism of renal protective activity of Trans-chalcone.
On the other hand, ER stress is a significant cause of renal injury and dysfunction in the kidney by several mechanisms, including triggering mitochondrial dysfunction, decreasing fatty acid oxidation, increasing SREBP-1 activity and fatty acid synthesis, and inducing apoptosis and lipotoxicity.[45] Therefore, the effective reduction of ER stress can be regarded as a functional therapeutic approach for preventing renal disease.[45] The present study indicated the adverse effect of HFD-feeding on the kidney through the induction of ER stress, as reflected by increasing GRP78 and CHOP expression levels in the kidneys of HFD-fed rats. Consistent with the present study, Yao et al.[22] suggested that feeding with HFD led to up-regulation of FABP4 in the kidneys of patients with diabetic nephropathy, which also promotes apoptosis through the induction of ER stress. In another previous study, exogenous FABP4 induced ER stress in HepG2 cells, as confirmed by the up-regulation of two sensors of UPR and markers of ER stress, including inositol-requiring enzyme 1 (IRE1) and activating transcription factor 6 (ATF6).[13,46] Exogenous FABP4 also increased CHOP expression, another marker of ER stress, which led to apoptosis in these cells.[13] The mentioned study indicated that exogenous FABP4 could increase fatty acid-induced ER stress and related apoptosis.[13]
In the current study, Trans-chalcone could protect the kidneys of rats against ER stress-induced by HFD-feeding. Trans-chalcone effectively prevented HFD-induced increases in GRP78 and CHOP expression levels. Similarly, a recent study suggested that the chemical inhibition of FABP4 can suppress the progression of renal fibrosis by suppressing ER stress and apoptosis, achieved through the modulation of tubular lipid metabolism.[21] Genetic or pharmacological inhibition of FABP4 could also exert protection against acute kidney injury caused by cisplatin through the suppression of ER stress in the tubular epithelial cells.[47] Therefore, Trans-chalcone-induced inhibition of renal FABP4 is involved in its protective role against HFD-induced ER stress.
This study measured the mRNA levels of GRP78 and CHOP. However, as a limitation, the protein expression levels of these markers and ER stress-induced apoptotic cell death were not examined, which can be addressed in future studies. Finally, this study proposes a novel molecular mechanism by which Trans-chalcone shields animals from kidney disease caused by excessive HFD intake. This simple chalcone effectively reduces the atherogenic index as a metabolic risk factor for CKD. Also, Trans-chalcone inhibits HFD-induced ER stress by suppressing renal FABP4 expression.
Data availability
The data are available from the corresponding author upon reasonable request.
List of abbreviations
Abbreviation Definition
CHOP CAAT-enhancer-binding protein (C/EBP) homologous protein
CKD Chronic kidney disease
CRI-II Castelli’s Risk Index-II
ER Endoplasmic reticulum
FABP4 Fatty acid-binding protein 4
FAS Fatty acid synthase
GRP78 Glucose-regulated protein 78
HDL-C High-density lipoprotein cholesterol
HFD High-fat diet
LDL-C Low-density lipoprotein cholesterol
SREBP Sterol regulatory element-binding protein
Ethics approval and consent to participate
All experimental procedures were approved by the Ethics Committee of Tabriz University of Medical Sciences (Approval ID: IR.TBZMED.VCR.REC.1399.400).
Conflicts of interest
There are no conflicts of interest.
Acknowledgments
ChatGPT (OpenAI, 2024 version), QuillBot, and Grammarly were used only to enhance the article’s readability and overall language quality; the authors then reviewed and finalized the revisions. The selection of all references, data analysis, data interpretation, and discussion of results were performed by the authors.
Funding Statement
This study was funded by the Vice Chancellor for Research of Tabriz University of Medical Sciences, Tabriz, Iran (grant number 66799).
REFERENCES
- 1.Li Y, Sun Y, Wu H, Yang P, Huang X, Zhang L, et al. Metabolic syndromes increase significantly with the accumulation of bad dietary habits. J Nutr Health Aging. 2024;28:100017. doi: 10.1016/j.jnha.2023.100017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lian CY, Zhai ZZ, Li ZF, Wang L. High fat diet-triggered non-alcoholic fatty liver disease: A review of proposed mechanisms. Chem Biol Interact. 2020;330:109199. doi: 10.1016/j.cbi.2020.109199. [DOI] [PubMed] [Google Scholar]
- 3.Sun Y, Ge X, Li X, He J, Wei X, Du J, et al. High-fat diet promotes renal injury by inducing oxidative stress and mitochondrial dysfunction. Cell Death Dis. 2020;11:914. doi: 10.1038/s41419-020-03122-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chenxu G, Xianling D, Qin K, Linfeng H, Yan S, Mingxin X, et al. Fisetin protects against high fat diet-induced nephropathy by inhibiting inflammation and oxidative stress via the blockage of iRhom2/NF-κB signaling. Int Immunopharmacol. 2021;92:107353. doi: 10.1016/j.intimp.2020.107353. [DOI] [PubMed] [Google Scholar]
- 5.Duan Y, Zeng L, Zheng C, Song B, Li F, Kong X, et al. Inflammatory links between high fat diets and diseases. Front Immunol. 2018;9:2649. doi: 10.3389/fimmu.2018.02649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ren L, Cui H, Wang Y, Ju F, Cai Y, Gang X, et al. The role of lipotoxicity in kidney disease: From molecular mechanisms to therapeutic prospects. Biomed Pharmacother. 2023;161:114465. doi: 10.1016/j.biopha.2023.114465. [DOI] [PubMed] [Google Scholar]
- 7.Opazo-Ríos L, Mas S, Marín-Royo G, Mezzano S, Gómez-Guerrero C, Moreno JA, et al. Lipotoxicity and diabetic nephropathy: Novel mechanistic insights and therapeutic opportunities. Int J Mol Sci. 2020;21:2632. doi: 10.3390/ijms21072632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Victor P, Umapathy D, George L, Juttada U, Ganesh G V, Amin KN, et al. Crosstalk between endoplasmic reticulum stress and oxidative stress in the progression of diabetic nephropathy. Cell Stress Chaperones. 2021;26:311–21. doi: 10.1007/s12192-020-01176-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wu D, Huang LF, Chen XC, Huang XR, Li HY, AN N, et al. Research progress on endoplasmic reticulum homeostasis in kidney diseases. Cell Death Dis. 2023;14:473. doi: 10.1038/s41419-023-05905-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol. 2012;13:89–102. doi: 10.1038/nrm3270. [DOI] [PubMed] [Google Scholar]
- 11.Ghemrawi R, Khair M. Endoplasmic reticulum stress and unfolded protein response in neurodegenerative diseases. Int J Mol Sci. 2020;21:6127. doi: 10.3390/ijms21176127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hetz C, Saxena S. ER stress and the unfolded protein response in neurodegeneration. Nat Rev Neurol. 2017;13:477–91. doi: 10.1038/nrneurol.2017.99. [DOI] [PubMed] [Google Scholar]
- 13.Bosquet A, Guaita-Esteruelas S, Saavedra P, Rodríguez-Calvo R, Heras M, Girona J, et al. Exogenous FABP4 induces endoplasmic reticulum stress in HepG2 liver cells. Atherosclerosis. 2016;249:191–9. doi: 10.1016/j.atherosclerosis.2016.04.012. [DOI] [PubMed] [Google Scholar]
- 14.Hu H, Tian M, Ding C, Yu S. The C/EBP Homologous Protein (CHOP) transcription factor functions in endoplasmic reticulum stress-induced apoptosis and microbial infection. Front Immunol. 2019;9:3038. doi: 10.3389/fimmu.2018.03083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ayaub EA, Kolb PS, Mohammed‐Ali Z, Tat V, Murphy J, Bellaye P, et al. GRP78 and CHOP modulate macrophage apoptosis and the development of bleomycin‐induced pulmonary fibrosis. J Pathol. 2016;239:411–25. doi: 10.1002/path.4738. [DOI] [PubMed] [Google Scholar]
- 16.Klymenko O, Huehn M, Wilhelm J, Wasnick R, Shalashova I, Ruppert C, et al. Regulation and role of the ER stress transcription factor CHOP in alveolar epithelial type-II cells. J Mol Med (Berl) 2019;97:973–90. doi: 10.1007/s00109-019-01787-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Tanaka M, Furuhashi M, Okazaki Y, Mita T, Fuseya T, Ohno K, et al. Ectopic expression of fatty acid-binding protein 4 in the glomerulus is associated with proteinuria and renal dysfunction. Nephron Clin Pract. 2015;128:345–51. doi: 10.1159/000368412. [DOI] [PubMed] [Google Scholar]
- 18.Queipo-Ortuño MI, Escoté X, Ceperuelo-Mallafré V, Garrido-Sanchez L, Miranda M, Clemente-Postigo M, et al. FABP4 dynamics in obesity: Discrepancies in adipose tissue and liver expression regarding circulating plasma levels. PLoS One. 2012;7:e48605. doi: 10.1371/journal.pone.0048605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Elmasri H, Karaaslan C, Teper Y, Ghelfi E, Weng M, Ince TA, et al. Fatty acid binding protein 4 is a target of VEGF and a regulator of cell proliferation in endothelial cells. FASEB J. 2009;23:3865–73. doi: 10.1096/fj.09-134882. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Shaker AM, Mohamed ME, Ramzy T, Ali MI. Serum fatty acid-binding protein 4 as a biomarker for early detection of diabetic nephropathy in type 2 diabetes. Egypt J Intern Med. 2023;35:22. [Google Scholar]
- 21.Chen Y, Dai Y, Song K, Huang Y, Zhang L, Zhang C, et al. Pre-emptive pharmacological inhibition of fatty acid–binding protein 4 attenuates kidney fibrosis by reprogramming tubular lipid metabolism. Cell Death Dis. 2021;12:1–14. doi: 10.1038/s41419-021-03850-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yao F, Li Z, Ehara T, Yang L, Wang D, Feng L, et al. Fatty acid-binding protein 4 mediates apoptosis via endoplasmic reticulum stress in mesangial cells of diabetic nephropathy. Mol Cell Endocrinol. 2015;411:232–42. doi: 10.1016/j.mce.2015.05.003. [DOI] [PubMed] [Google Scholar]
- 23.Shi M, Ma L, Fu P. Role of fatty acid binding protein 4 (FABP4) in kidney disease. Curr Med Chem. 2020;27:3657–64. doi: 10.2174/0929867325666181008154622. [DOI] [PubMed] [Google Scholar]
- 24.Shi M, Guo F, Liao D, Huang R, Feng Y, Zeng X, et al. Pharmacological inhibition of fatty acid-binding protein 4 alleviated kidney inflammation and fibrosis in hyperuricemic nephropathy. Eur J Pharmacol. 2020;887:173570. doi: 10.1016/j.ejphar.2020.173570. [DOI] [PubMed] [Google Scholar]
- 25.Moreno-Vedia J, Girona J, Ibarretxe D, Masana L, Rodríguez-Calvo R. Unveiling the role of the fatty acid binding protein 4 in the metabolic-associated fatty liver disease. Biomedicines. 2022;10:197. doi: 10.3390/biomedicines10010197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Furuhashi M, Hotamisligil GS. Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nat Rev Drug Discov. 2008;7:489–503. doi: 10.1038/nrd2589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lee AS. The ER chaperone and signaling regulator GRP78/BiP as a monitor of endoplasmic reticulum stress. Methods. 2005;35:373–81. doi: 10.1016/j.ymeth.2004.10.010. [DOI] [PubMed] [Google Scholar]
- 28.Maleki MH, Nadimi E, Vakili O, Tavakoli R, Taghizadeh M, Dehghanian A, et al. Bilirubin improves renal function by reversing the endoplasmic reticulum stress and inflammation in the kidneys of type 2 diabetic rats fed high-fat diet. Chem Biol Interact. 2023;378:110490. doi: 10.1016/j.cbi.2023.110490. [DOI] [PubMed] [Google Scholar]
- 29.Nishitoh H. CHOP is a multifunctional transcription factor in the ER stress response. J Biochem. 2012;151:217–9. doi: 10.1093/jb/mvr143. [DOI] [PubMed] [Google Scholar]
- 30.Oyadomari S, Mori M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 2004;11:381–9. doi: 10.1038/sj.cdd.4401373. [DOI] [PubMed] [Google Scholar]
- 31.Bobulescu IA. Renal lipid metabolism and lipotoxicity. Curr Opin Nephrol Hypertens. 2010;19:393–402. doi: 10.1097/MNH.0b013e32833aa4ac. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ruan XZ, Varghese Z, Moorhead JF. An update on the lipid nephrotoxicity hypothesis. Nat Rev Nephrol. 2009;5:713–21. doi: 10.1038/nrneph.2009.184. [DOI] [PubMed] [Google Scholar]
- 33.PubChem. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004. PubChem Compound Summary for CID 637760, Trans-chalcone. [Google Scholar]
- 34.Ouyang Y, Li J, Chen X, Fu X, Sun S, Wu Q. Chalcone derivatives: Role in anticancer therapy. Biomolecules. 2021;11:894. doi: 10.3390/biom11060894. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Karimi-Sales E, Ebrahimi-Kalan A, Alipour MR. Preventive effect of Trans-chalcone on non-alcoholic steatohepatitis: Improvement of hepatic lipid metabolism. Biomed Pharmacother. 2019;109:1306–12. doi: 10.1016/j.biopha.2018.10.196. [DOI] [PubMed] [Google Scholar]
- 36.Karimi-Sales E, Jeddi S, Ebrahimi-Kalan A, Alipour MR. Trans-chalcone prevents insulin resistance and hepatic inflammation and also promotes hepatic cholesterol efflux in high-fat diet-fed rats: Modulation of miR-34a-, miR-451-, and miR-33a-related pathways. Food Funct. 2018;9:4292–8. doi: 10.1039/c8fo00923f. [DOI] [PubMed] [Google Scholar]
- 37.Alipour MR, Jeddi S, Karimi-Sales E. Trans-chalcone inhibits high-fat diet-induced disturbances in FXR/SREBP-1c/FAS and FXR/Smad-3 pathways in the kidney of rats. J Food Biochem. 2020;44:1–7. doi: 10.1111/jfbc.13476. [DOI] [PubMed] [Google Scholar]
- 38.Zou Y, Li J, Lu C, Wang J, Ge J, Huang Y, et al. High-fat emulsion-induced rat model of non-alcoholic steatohepatitis. Life Sci. 2006;79:1100–7. doi: 10.1016/j.lfs.2006.03.021. [DOI] [PubMed] [Google Scholar]
- 39.Chikezie CM, Ojiako OA, Emejulu AA, Chikezie PC. Atherogenicity of diabetic rats administered single and combinatorial herbal extracts. Bull Fac Pharm Cairo Univ. 2018;56:169–74. [Google Scholar]
- 40.Mannangi NB. Novel lipid indices in chronic kidney disease. Natl J Med Res. 2015;5:39–42. [Google Scholar]
- 41.Gholami H, Jeddi S, Zadeh-Vakili A, Farrokhfall K, Rouhollah F, Zarkesh M, et al. Transient congenital hypothyroidism alters gene expression of glucose transporters and impairs glucose sensing apparatus in young and aged offspring rats. Cell Physiol Biochem. 2017;43:2338–52. doi: 10.1159/000484386. [DOI] [PubMed] [Google Scholar]
- 42.Chen QJ, Lai HM, Chen BD, Li XM, Zhai H, He CH, et al. Appropriate LDL-C-to-HDL-C ratio cutoffs for categorization of cardiovascular disease risk factors among uygur adults in xinjiang, China. Int J Environ Res Public Health. 2016;13:225. doi: 10.3390/ijerph13020235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Chan C. Hyperlipidaemia in chronic kidney disease. Ann Acad Med Singap. 2005;34:31–5. [PubMed] [Google Scholar]
- 44.Sekiya M, Yahagi N, Matsuzaka T, Takeuchi Y, Nakagawa Y, Takahashi H, et al. SREBP-1-independent regulation of lipogenic gene expression in adipocytes. J Lipid Res. 2007;48:1581–91. doi: 10.1194/jlr.M700033-JLR200. [DOI] [PubMed] [Google Scholar]
- 45.Figueroa-Juárez E, Noriega LG, Pérez-Monter C, Alemán G, Hernández-Pando R, Correa-Rotter R, et al. The role of the unfolded protein response on renal lipogenesis in C57BL/6 mice. Biomolecules. 2021;11:73. doi: 10.3390/biom11010073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Gardner BM, Pincus D, Gotthardt K, Gallagher CM, Walter P. Endoplasmic reticulum stress sensing in the unfolded protein response. Cold Spring Harb Perspect Biol. 2013;5:a013169. doi: 10.1101/cshperspect.a013169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tan Z, Guo F, Huang Z, Xia Z, Liu J, Tao S, et al. Pharmacological and genetic inhibition of fatty acid‐binding protein 4 alleviated cisplatin‐induced acute kidney injury. J Cell Mol Med. 2019;23:6260–70. doi: 10.1111/jcmm.14512. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data are available from the corresponding author upon reasonable request.