Skip to main content
NCBI home page
Journal of Lasers in Medical Sciences logoLink to Journal of Lasers in Medical Sciences
. 2026 Aug 8;17:e50924. doi: 10.34172/jlms.50924

Enhancing Proliferation and Pluripotency in Human Dental Pulp Stem Cells through 980-nm Laser Irradiation: Implications for Regenerative Dentistry

Mohammad Hasan Soheilifar 1, Parnia Hemmati 1, Maryam Ghahremani-Nasab 2, Afshan Shirkavand 3, Hoda Keshmiri Neghab 1, Sima Nobari 4, Elahe Reyhani 5, Razieh Amini 6,*
PMCID: PMC13675538  PMID: 42892942

Abstract

Introduction: Dental pulp stem cells (DPSCs) possess remarkable proliferative ability and multilineage differentiation potential, and they are known as immunomodulatory cells. Identifying factors that enhance DPSC proliferation is crucial, as accelerated expansion is necessary for tissue engineering applications, while maintaining pluripotency gene expression is essential to preserve their proliferative and differentiation potential. Low-level laser irradiation (LLLI) has increasingly been recognized as a promising non-invasive approach to accelerate proliferation and enhance tissue regeneration. Within this framework, the current study was designed to evaluate the influence of laser irradiation on proliferation, pluripotency, and angiogenesis in DPSCs.

Methods: The DPSCs were purchased from the Iranian Biological Resources Center and cultured under standard conditions. The experimental protocol involved exposing DPSCs to a 980 nm diode laser with an output power of 50 mW for a duration of 20 seconds, corresponding to an energy density of 1 J/cm2. Following a 24-hour incubation period post-irradiation, cell viability was quantitatively measured using the MTT colorimetric assay. Subsequently, the expression levels of Sox2, Nanog, VEGF, TGF-β, PCNA, and Cyclin D1 were assessed through quantitative reverse transcription-polymerase chain reaction (qRT-PCR), while the protein expression of Sox2, TGF-β, and Cyclin D1 was determined using western blot analysis.

Results: The results showed that laser irradiation at 980 nm for 20 seconds increased the expression of Sox2, TGF-β, and Cyclin D1 at the RNA expression level (P<0.05). Moreover, Sox2 and Cyclin D1 protein levels were increased compared to the control group.

Conclusion: Our findings suggest that irradiation with a 980-nm laser at an energy density of 1 J/cm2 significantly enhances the proliferative capacity and upregulates pluripotency marker expression in DPSCs, supporting its potential as a therapeutic approach in regenerative medicine.

Keywords: Dental pulp stem cells, Laser irradiation, Proliferation, Pluripotency, Angiogenesis

Introduction

Dental mesenchymal stem cells (DMSCs) are typically isolated from various dentoalveolar tissues and include some different cell types, such as human dental pulp stem cells (DPSCs), stem cells originating from the apical papilla (SCAPs), periodontal ligament stem cells (PDLSCs), and stem cells from human exfoliated deciduous teeth (SHED).1-6 These cell populations are characterized by robust expansion capacity and multilineage differentiation potential, with reported commitment toward osteogenic, adipogenic, neurogenic, and chondrogenic phenotypes.3,6

Dental-derived mesenchymal stem cells, particularly DPSCs and SHED, also possess notable immunomodulatory properties. These features support their potential use in allogeneic settings and make them attractive candidates as alternatives to bone marrow-derived mesenchymal stem cells in regenerative applications.6-10

In this context, identifying factors that can effectively enhance DPSC proliferation is crucial. Since DMSCs proliferation is a time-consuming process, recognizing effective methods and factors to accelerate their expansion is essential prior to their application in tissue engineering. Additionally, studies have shown that commonly used in vitro culture methods may reduce the expression of pluripotency markers (Oct4, Sox2, and Stro1) in human dental stem cells. Therefore, maintaining the expression of pluripotency-related genes is critical for preserving the functional properties of DPSCs.11-17 Several factors have been explored to promote DPSCs proliferation or differentiation, including insulin-like growth factor 1 (IGF-1), enamel matrix derivatives, and Trichostatin A (a histone deacetylase inhibitor) 6,18-23; however, a major limitation of these factors is their high cost. Among the approaches investigated for promoting MSC expansion, low-level laser therapy (LLLT), also termed low-level laser irradiation (LLLI), has attracted considerable attention due to its potential stimulatory effects on cell growth.6 Evidence indicates that LLLT increases cellular proliferation and regulates biological activity in various cell types, such as fibroblasts, keratinocytes, and osteoblasts. Additionally, it has shown effectiveness in wound healing, angiogenesis, reducing pain, and facilitating bone repair and remodeling.6,24-26 LLLT has been reported to influence several cellular processes, including proliferation, differentiation, migration, and programmed cell death. It may also modulate the production of growth factors such as FGF and VEGF, thereby contributing to tissue repair and regeneration.6,27,28 Multiple studies have demonstrated that LLLT exerts its effects via signaling pathways involving cytokines such as IGF-1, mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK), and bone morphogenetic protein (BMP)/Smad. In addition, LLLT increases intracellular ATP production, regulates the activity of inducible nitric oxide synthase, and suppresses several proinflammatory cytokines such as TNF-α, IL-1β, IL-6, and IL-8. It also regulates growth factors such as PDGF, IGF-1, NGF, and FGF-2.29-32 Successful tissue engineering strategies rely heavily on angiogenesis, as the establishment of a functional vascular network is essential for tissue survival and regeneration. However, achieving adequate vascularization remains a major challenge in this field. DPSCs are very useful in tissue engineering due to their angiogenic properties.33-35 DPSCs induce angiogenesis by releasing angiogenic factors into the conditioned medium (CM), and the supernatant profile of these cells shows the presence of VEGF and MCP-1, classical factors that induce angiogenesis.35-39 In view of these observations, the present study was designed to evaluate the effects of LLLT, applied under defined laser parameters, on the expression of proliferation-related markers (PCNA and Cyclin D1) as well as pluripotency-associated genes (Oct4, Sox2, and Nanog) in DPSCs. In addition, the present study evaluated the effect of LLLT on the angiogenic potential of DPSCs by analyzing the secretion levels of angiogenesis-related markers, including VEGF and TGF-β.

Material and Methods

Dental pulp stem cell culture

DPSCs were purchased from the Iranian Biological Resource Center. The cells were maintained in the α-MEM medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS; DNAbiotech) and 1% penicillin/streptomycin (DNAbiotech). Cultures were then incubated at 37°C in a humidified atmosphere containing 5% CO₂ for three days until reaching confluence.

Laser irradiation

DPSCs were seeded in 24-well plates and irradiated using a 980-nm, 50-mW near-infrared (NIR) Laser Diode Dot Module (spot size~2 mm in diameter at the aperture, continuous wave output; JTSF, Inc). The procedure was conducted under sterile conditions within a laminar flow hood. A fixed distance was maintained between the laser device and the surface of the cell layer in all experimental groups (Table 1). Each sample received a single irradiation session, and post-irradiation assessments were carried out 24 hours later to evaluate the effects.

Table 1. Parameters of laser irradiation time and energy density applied to DPSCs.

Laser irradiation time Energy density (J/cm2)
10 s 0.5
20 s 1
40 s 2
80 s 4
Open in a new tab

Cell viability assay

Cell viability was evaluated using the MTT assay. Briefly, DPSCs were seeded in 96-well plates at a density of 10,000 cells per well and allowed to incubate for 24 hours. After exposing DPSCs to irradiation for 10, 20, 40, and 80 seconds, each well received 0.2 mL of MTT solution (0.5 mg/mL), which was then incubated for 4 hours at 37°C. Subsequently, the supernatant was removed, and 100 μL of DMSO (Sigma-Aldrich) was added to each well and then incubated for half an hour. Finally, the absorbance was measured by an ELISA reader at a wavelength range of 540 to 630 nm.

Quantitative reverse transcriptase polymerase chain reaction (qRT -PCR) analysis

Gene expression levels of Sox2, Nanog, VEGF, TGF-β, PCNA, and Cyclin D1 were quantified via qRT-PCR using the primer sequences detailed in Table 2. Following a 24-hour incubation period in 6-well plates, DPSCs were subjected to 980-nm laser irradiation for 20 seconds. Total RNA was subsequently isolated using RNX-PlusTM solution (SinaClon) and quantified using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Subsequently, cDNA was then synthesized from the extracted RNA using a commercial kit (Parstous Biotechnology, Iran). Targeted gene expression was evaluated through qRT-PCR and analyzed via the 2–∆∆Ct method, and β-actin was used as a reference gene.40,41

Table 2. Primer sequences of genes used for qRT-PCR .

Gene Primer sequence (5' to 3') Product length (bp)
Sox2 Forward TACAACTCCATGACCAGCTCG 118
Reverse ACTTGACCACCGAACCCATG
Nanog Forward ATTCTTCCACCAGTCCCAAAGG 207
Reverse AGCTGAGGTTCAGGATGTTGG
VEGF Forward ATCTTCAAGCCATCCTGTGTGC 138
Reverse TATGTGCTGGCCTTGGTGAGG
TGF-β Forward AGGGATAACACACTGCAAGTGG 176
Reverse AAGCAATAGTTGGTGTCCAGGG
PCNA Forward AAGATGCCTTCTGGTGAATTTGC 267
Reverse TGTCACCGTTGAAGAGAGTGG
Cyclin D1 Forward TTCGTGGCCTCTAAGATGAAGG 125
Reverse TTGAGCTTGTTCACCAGGAGC
β-actin Forward AGACGCAGGATGGCATGGG 161
Reverse GAGACCTTCAACACCCCAGCC
Open in a new tab

Western blotting

The expression of Sox2, TGF-β, and Cyclin D1 proteins with and without irradiation was measured by western blotting. To this end, DPSCs were cultured in 6-well plates for 24 hours. The cells were then irradiated with a 980-nm laser for 20 seconds. Cell lysates were prepared using a buffer supplemented with a protease inhibitor cocktail. Equal amounts of protein (20 µg per sample) were then separated by SDS-PAGE and transferred onto nitrocellulose membranes. To minimize non-specific antibody interactions, membranes were blocked using non-fat dry milk (NFDM). After blocking, the membranes were incubated overnight at 4°C with primary antibodies targeting Sox2, TGF-β, Cyclin D1, and β-actin. After thorough washing steps, membranes were incubated with goat anti-mouse HRP-conjugated secondary antibodies for 1 hour at room temperature. Finally, protein bands were detected using an enhanced chemiluminescence (ECL) detection system.41

Statistical analysis

Experiments were performed in triplicate. Data were reported as mean ± standard error of the mean (SEM). Statistical analyses were carried out in GraphPad Prism version 7 (GraphPad Software Inc., La Jolla, CA, USA). Comparisons between two independent groups were conducted using a two-tailed unpaired Student’s t-test. Statistical significance was defined as *P < 0.05 and **P < 0.01.

Results

Short-duration laser irradiation enhances DPSCs viability

According to the MTT results (Figure 1), the cell viability of the group that was exposed to laser irradiation for 10 seconds was not statistically significant compared to the control group. In irradiation for 20 seconds, the cell viability increased significantly compared to the control group (P < 0.001). In contrast, the effects of laser irradiation for 40 and 80 seconds on cell survival were not significant.

Figure 1.

Figure 1

Histogram of the MTT assay on the effects of irradiation on the viability of DPSCs after exposure times of 10, 20, 40, and 80 seconds (**P < 0.01).

Open in a new tab

qRT -PCR reveals significant upregulation of proliferation and pluripotency genes following irradiation in DPSCs

qRT-PCR was performed to determine whether irradiation influenced genes associated with proliferation, pluripotency, and angiogenic signaling. Relative to control cells, irradiated DPSCs showed significant increases in Sox2, TGF-β, and Cyclin D1 expression, with fold changes of 2.76, 1.76, and 2.30, respectively (P < 0.05). VEGF and PCNA expression increased modestly by 1.31- and 1.30-fold, whereas Nanog expression showed no statistically significant change (0.90-fold of control); none of these latter changes reached statistical significance (Figure 2).

Figure 2.

Figure 2

Histogram of the qRT-PCR of Sox2, Nanog, VEGF, TGF-β, PCNA, and Cyclin D1 genes expression after exposure to laser irradiation. The gene expression is expressed as fold change relative to the control (*P < 0.05)

Open in a new tab

Protein expression levels of Sox2, TGF-β, and Cyclin D1 in irradiated DPSCs

Western blot analysis was performed to assess the protein levels of Sox2, TGF-β, and Cyclin D1 following irradiation (Figure 3). These targets were selected based on the qRT-PCR findings. The results indicated that TGF-β protein expression remained unchanged between irradiated and control groups. In contrast, Cyclin D1 protein levels were elevated following laser exposure. Notably, Sox2 protein expression was markedly higher in irradiated DPSCs than in untreated controls.

Figure 3.

Figure 3

The expression level of TGF-β, Sox2, and Cyclin D1 proteins in DPSCs exposed to irradiation

Open in a new tab

Discussion

In the present study, we investigated the effects of 980-nm laser irradiation on the survival, proliferation, pluripotency, and potential angiogenic potential of DPSCs. Our MTT assay findings indicated that cell viability in the group exposed to 20 seconds of laser irradiation was higher than that in the control group. qRT-PCR analysis revealed significant increases in the expression levels of TGF-β, Cyclin D1, and Sox2 genes post-irradiation, while no significant changes were observed in PCNA, VEGF, and Nanog gene expression. Additionally, Western blotting demonstrated that Cyclin D1 and Sox2 protein levels significantly increased following 980-nm laser irradiation, whereas TGF-β protein expression remained unchanged.

The efficacy of low-level laser therapy (LLLT) in modulating cell proliferation is highly contingent upon specific laser parameters. Consequently, defining the optimal configurations, including energy density, output power, and the distance between the source and target cells, is imperative to maximize the proliferative capacity of dental stem cells for clinical applications.13,27,42,43 Research indicates that red and infrared wavelengths (600–1200 nm) elicit biological responses, with energy densities ranging from 0.05 to 10 J/cm2 associated with biostimulatory effects 6,12,44-46; however, doses exceeding 10 J/cm2 may lead to inhibitory outcomes.44 Low-power lasers (660, 810, or 980 nm) with energy densities of 0.1 to 3 J/cm2 have been shown to promote DMSC proliferation, although further research is needed to refine optimal laser parameters.6

Consistent with these findings, the MTT assay results demonstrated that a 20-second exposure to a 980-nm laser at an energy density of 1 J/cm2 enhanced the viability of DPSCs. Cyclin D1, a critical regulator of cell cycle progression, was significantly upregulated under laser irradiation, corroborating the findings of Sperandio et al., who reported increased Cyclin D1 expression in keratinocytes following low-level laser treatment.47-49 Parallel to previous reports, our findings showed that Cyclin D1 expression significantly increased at both the gene and protein levels under the influence of laser irradiation. Based on these results, it can be stated that the stimulating effect of laser irradiation on cellular proliferation may be mediated, at least in part, through the upregulation of Cyclin D1.

In addition, DPSCs can promote tissue vascularization by secreting angiogenic factors that act on local endothelial cells or by differentiating into endothelial-like cells within the vasculature.50,51 Since angiogenesis is critical for tissue regeneration and repair, DPSC-conditioned medium (DPSC-CM) is expected to contain factors that stimulate this process. The role of VEGF in regulating the migration and differentiation of endothelial cells (ECs) and in recruiting them for angiogenesis and endothelialization in injured tissue has been well-established. Analysis of the DPSCs-CM has shown the presence of VEGF and MCP-1, two classical factors that induce angiogenesis. In addition, DPSCs demonstrate angiogenic potential through the expression of endothelial differentiation markers.35,52-55 Nawam et al.14 investigated the angiogenic and odontogenic effects of low-level laser therapy (660 nm, 1 J/cm2) on the dentin-pulp complex in vitro. They reported that laser irradiation at these parameters significantly upregulated VEGF and VEGFR2 expression.14

In our study, qRT-PCR analysis revealed that VEGF gene expression showed a slight, non-significant increase 24 hours post-irradiation, which is generally consistent with previous reports, although the magnitude of the response was lower in the present study. This suggests that the cellular response to laser irradiation may depend on experimental conditions, including the laser dose and exposure duration.

A network of transcriptional regulators, including Sox2, Oct4, and Nanog, is essential for preserving the undifferentiated phenotype and self-renewing properties of stem cells.56,57 Consistent with this role, Oct4 and Nanog expression has been documented in DPSCs expressing the stem cell-associated markers STRO-1⁺ and CD146⁺. The knockout of Oct4 and Nanog leads to a significant reduction in the proliferative capacity of human DPSCs as well as in the expression of STRO-1⁺ and CD146⁺ markers. These factors are critical for the functional properties of DPSCs, as loss of Oct4 and Nanog expression has been shown to significantly reduce both the proliferative and osteogenic potential of these cells. In addition, the upregulation of Oct4/Nanog increases the colony-forming ability and promotes osteogenic, chondrogenic, and adipogenic differentiation capacity of pulp stem cells.58-60 Another study has shown that STAT3, Oct4, and Sox2 can play a key role in preserving the pluripotency of DPSCs and PDLCs by maintaining intercellular interactions.61 However, in vitro culture methods may reduce the expression of pluripotency markers (Oct4, Sox2, and Stro-1) in DPSCs, PDLCs, and other MSCs.62 A number of stimulating factors can be used to overcome this problem. In this context, studies have shown that laser irradiation can be a suitable option for both increasing the proliferation of stem cells and serving as a regenerative therapy.11-17 In the present study, the expression of Sox2 and Nanog was evaluated following a 20-second laser irradiation of DPSCs. Our qRT-PCR findings revealed that while LLLT failed to upregulate Nanog, it induced a significant increase in Sox2 transcript levels. This upregulation was further validated at the translational level, as Western blot analysis demonstrated a significant elevation in Sox2 protein expression in the irradiated groups. In conclusion, given that Sox2 is activated in response to physical or chemical stimuli, our findings indicate that laser irradiation may enhance pluripotency through the upregulation of Sox2 expression.

TGF-β is a cytokine with a critical role in biological processes and is secreted by cells, including endothelial cells, fibroblasts, macrophages, platelets, and immune cells.63-65 MSCs can induce angiogenic processes through the TGF-β/SMAD pathway. Moreover, TGF-β expression is directly correlated with blood vessel density.66 TGF-β is involved in the differentiation of SHED into vascular smooth muscle cells, which may have potential applications in vascular regenerative medicine.63 As demonstrated by Arany et al. 67, low-level laser treatment facilitates the activation of latent TGF-β, which subsequently induces the in vitro differentiation of dental stem cells into odontoblasts and enhances in vivo dentin regeneration.67

Our findings revealed a significant increase in TGF-β gene expression following laser irradiation, whereas no significant changes were observed at the protein level compared with the control group. This discrepancy may result from mRNA instability and rapid degradation prior to translation, as well as potential epigenetic mechanisms, such as microRNAs inhibitory function, that may regulate TGF-β translation despite the presence of mRNA.

One limitation of the present study is that gene and protein expression were evaluated at a single time point (24 hours post-irradiation). Since cellular responses to low-level laser irradiation may vary over time, assessing multiple time points could provide a more comprehensive understanding of the temporal dynamics of proliferation and the expression of pluripotency markers. Future studies should investigate the temporal effects of 980-nm laser irradiation on DPSCs.

Conclusion

In conclusion, notwithstanding the inherent limitations of this study, our findings suggest that a 980-nm laser irradiation protocol (20 s, 1 J/cm2) significantly enhances the viability, proliferative capacity, and pluripotency potential of DPSCs. Notably, the applied laser treatment successfully upregulated the expression of both Sox2 and Cyclin D1 at both the transcriptomic and translational levels, indicating a robust molecular response to irradiation. While TGF-β gene expression was elevated, no corresponding change in protein levels was observed, and laser irradiation did not affect VEGF gene expression. Given that no statistically significant changes were observed for VEGF or TGF-β under the experimental conditions, it is suggested that angiogenic effects may be context-dependent or require longer time points or additional stimuli. Overall, the results support the potential utility of laser irradiation as a practical and cost-efficient adjunct in regenerative dentistry. Further experimental and preclinical research is needed to substantiate these outcomes and to clarify the biological mechanisms responsible for the observed effects.

Acknowledgements

We acknowledge the Yara Institute of Wound and Tissue Repair Technologies for hosting the experimental work and for the technical assistance essential to the related assays. We utilized AI-powered tools to check grammar and enhance the academic quality of the text, which was primarily written by the authors. After using this tool/service, the authors reviewed and edited the content as needed and takes full responsibility for the content of the published article.

Competing Interests

The authors declare that there is no conflict of interest.

Ethical Approval

All experimental protocols were approved by the Ethical Committee of Hamadan University of Medical Sciences (Ethics Approval Code: IR.UMSHA.REC.1400.677).

Funding

This work was funded by Hamadan University of Medical Sciences (Grant ID: 14010206687).

Please cite this article as follows: Soheilifar MH, Hemmati P, Ghahremani-Nasab M, Shirkavand A, Keshmiri Neghab H, Nobari S, et al. Enhancing proliferation and pluripotency in human dental pulp stem cells through 980-nm laser irradiation: implications for regenerative dentistry. J Lasers Med Sci 2026;17:e50924. doi:10.34172/jlms.50924

References

  • 1.Ledesma-Martínez E, Mendoza-Núñez VM, Santiago-Osorio E. Mesenchymal stem cells derived from dental pulp: a review. Stem Cells Int. 2016;2016:4709572. doi: 10.1155/2016/4709572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chen Y, Huang H, Li G, Yu J, Fang F, Qiu W. Dental-derived mesenchymal stem cell sheets: a prospective tissue engineering for regenerative medicine. Stem Cell Res Ther. 2022;13(1):38. doi: 10.1186/s13287-022-02716-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Li B, Ouchi T, Cao Y, Zhao Z, Men Y. Dental-derived mesenchymal stem cells: state of the art. Front Cell Dev Biol. 2021;9:654559. doi: 10.3389/fcell.2021.654559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Aydin S, Şahin F. Stem cells derived from dental tissues. Adv Exp Med Biol. 2019;1144:123–32. doi: 10.1007/5584_2018_333. [DOI] [PubMed] [Google Scholar]
  • 5.Hsiao HY, Nien CY, Hong HH, Cheng MH, Yen TH. Application of dental stem cells in three-dimensional tissue regeneration. World J Stem Cells. 2021;13(11):1610–24. doi: 10.4252/wjsc.v13.i11.1610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Borzabadi-Farahani A. Effect of low-level laser irradiation on proliferation of human dental mesenchymal stem cells; a systemic review. J Photochem Photobiol B. 2016;162:577–82. doi: 10.1016/j.jphotobiol.2016.07.022. [DOI] [PubMed] [Google Scholar]
  • 7.Andrukhov O, Behm C, Blufstein A, Rausch-Fan X. Immunomodulatory properties of dental tissue-derived mesenchymal stem cells: implication in disease and tissue regeneration. World J Stem Cells. 2019;11(9):604–17. doi: 10.4252/wjsc.v11.i9.604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yang N, Liu X, Chen X, Yu S, Yang W, Liu Y. Stem cells from exfoliated deciduous teeth transplantation ameliorates Sjögren’s syndrome by secreting soluble PD-L1. J Leukoc Biol. 2022;111(5):1043–55. doi: 10.1002/jlb.6ma0921-752rr. [DOI] [PubMed] [Google Scholar]
  • 9.Wen S, Zheng X, Yin W, Liu Y, Wang R, Zhao Y, et al. Dental stem cell dynamics in periodontal ligament regeneration: from mechanism to application. Stem Cell Res Ther. 2024;15(1):389. doi: 10.1186/s13287-024-04003-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Min Q, Yang L, Tian H, Tang L, Xiao Z, Shen J. Immunomodulatory mechanism and potential application of dental pulp-derived stem cells in immune-mediated diseases. Int J Mol Sci. 2023;24(9):8068. doi: 10.3390/ijms24098068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Peng Z, Liu L, Zhang W, Wei X. Pluripotency of dental pulp cells and periodontal ligament cells was enhanced through cell-cell communication via STAT3/Oct-4/Sox2 signaling. Stem Cells Int. 2021;2021:8898506. doi: 10.1155/2021/8898506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Abo El-Dahab MM, Gheith M, Soliman NL, Aly RM. Effect of diode laser potentiality on proliferation of dental pulp stem cells (in vitro study) Bull Natl Res Cent. 2020;44(1):170. doi: 10.1186/s42269-020-00414-9. [DOI] [Google Scholar]
  • 13.Amid R, Kadkhodazadeh M, Gilvari Sarshari M, Parhizkar A, Mojahedi M. Effects of two protocols of low-level laser therapy on the proliferation and differentiation of human dental pulp stem cells on sandblasted titanium discs: an in vitro study. J Lasers Med Sci. 2022;13:e1. doi: 10.34172/jlms.2022.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.El Nawam H, El Backly R, Zaky A, Abdallah A. Low-level laser therapy affects dentinogenesis and angiogenesis of in vitro 3D cultures of dentin-pulp complex. Lasers Med Sci. 2019;34(8):1689–98. doi: 10.1007/s10103-019-02804-6. [DOI] [PubMed] [Google Scholar]
  • 15.Etemadi A, Aghaie M, Sayar F, Chiniforush N. Effect of photobiomodulation therapy with 660 and 980 nm diode lasers on differentiation of periodontal ligament mesenchymal stem cells. Sci Rep. 2024;14(1):20587. doi: 10.1038/s41598-024-71386-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Dawoud LE, Hegazy EM, Galhom RA, Youssef MM. Photobiomodulation therapy upregulates the growth kinetics and multilineage differentiation potential of human dental pulp stem cells-an in vitro study. Lasers Med Sci. 2022;37(3):1993–2003. doi: 10.1007/s10103-021-03461-4. [DOI] [PubMed] [Google Scholar]
  • 17.Tong J, Subbiah SK, Rampal S, Ramasamy R, Wu X, You Y, et al. Effect of 660-nm LED photobiomodulation on the proliferation and chondrogenesis of meniscus-derived stem cells (MeSCs) Sci Rep. 2024;14(1):19735. doi: 10.1038/s41598-024-70258-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Duncan HF, Kobayashi Y, Kearney M, Shimizu E. Epigenetic therapeutics in dental pulp treatment: hopes, challenges and concerns for the development of next-generation biomaterials. Bioact Mater. 2023;27:574–93. doi: 10.1016/j.bioactmat.2023.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Noda S, Kawashima N, Yamamoto M, Hashimoto K, Nara K, Sekiya I, et al. Effect of cell culture density on dental pulp-derived mesenchymal stem cells with reference to osteogenic differentiation. Sci Rep. 2019;9(1):5430. doi: 10.1038/s41598-019-41741-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Widowati W, Noverina R, Ayuningtyas W, Kurniawan D, Kusuma HSW, Arumwardana S, et al. Proliferation, characterization and differentiation potency of adipose tissue-derived mesenchymal stem cells (AT-MSCs) cultured in fresh frozen and non-fresh frozen plasma. Int J Mol Cell Med. 2019;8(4):283–94. doi: 10.22088/ijmcm.Bums.8.4.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zhang B, Xiao M, Cheng X, Bai Y, Chen H, Yu Q, et al. Enamel matrix derivative enhances the odontoblastic differentiation of dental pulp stem cells via activating MAPK signaling pathways. Stem Cells Int. 2022;2022:2236250. doi: 10.1155/2022/2236250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lv T, Wu Y, Mu C, Liu G, Yan M, Xu X, et al. Insulin-like growth factor 1 promotes the proliferation and committed differentiation of human dental pulp stem cells through MAPK pathways. Arch Oral Biol. 2016;72:116–23. doi: 10.1016/j.archoralbio.2016.08.011. [DOI] [PubMed] [Google Scholar]
  • 23.Pan H, Yang Y, Xu H, Jin A, Huang X, Gao X, et al. The odontoblastic differentiation of dental mesenchymal stem cells: molecular regulation mechanism and related genetic syndromes. Front Cell Dev Biol. 2023;11:1174579. doi: 10.3389/fcell.2023.1174579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Berni M, Brancato AM, Torriani C, Bina V, Annunziata S, Cornella E, et al. The role of low-level laser therapy in bone healing: systematic review. Int J Mol Sci. 2023;24(8):7094. doi: 10.3390/ijms24087094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fernandes KP, Souza NH, Mesquita-Ferrari RA, de Fatima Teixeira da Silva D, Rocha LA, Alves AN, et al. Photobiomodulation with 660-nm and 780-nm laser on activated J774 macrophage-like cells: effect on M1 inflammatory markers. J Photochem Photobiol B. 2015;153:344–51. doi: 10.1016/j.jphotobiol.2015.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Rodrigues NC, Brunelli R, de Araújo HS, Parizotto NA, Renno AC. Low-level laser therapy (LLLT) (660nm) alters gene expression during muscle healing in rats. J Photochem Photobiol B. 2013;120:29–35. doi: 10.1016/j.jphotobiol.2013.01.002. [DOI] [PubMed] [Google Scholar]
  • 27.Rezaei F, Shakoori S, Fazlyab M, Esnaashari E, Tour Savadkouhi S. Effect of low-level laser on proliferation, angiogenic and dentinogenic differentiation of human dental pulp stem cells. BMC Oral Health. 2025;25(1):441. doi: 10.1186/s12903-025-05656-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.AlGhamdi KM, Kumar A, Alfayez M, Mahmood A. Influence of low-level red laser irradiation on the proliferation, viability, and differentiation of human embryonic stem cell-derived mesenchymal stem cells. Life (Basel) 2025;15(7):1125. doi: 10.3390/life15071125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kushibiki T, Hirasawa T, Okawa S, Ishihara M. Low reactive level laser therapy for mesenchymal stromal cells therapies. Stem Cells Int. 2015;2015:974864. doi: 10.1155/2015/974864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Gao X, Xing D. Molecular mechanisms of cell proliferation induced by low power laser irradiation. J Biomed Sci. 2009;16(1):4. doi: 10.1186/1423-0127-16-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tamimi R, Zamanlui Benisi S, Eskandarian Boroujeni M, Torkamani MJ. Review on the molecular mechanisms of low-level laser therapy: gene expression and signaling pathways. Lasers Med Sci. 2025;40(1):160. doi: 10.1007/s10103-025-04393-z. [DOI] [PubMed] [Google Scholar]
  • 32.Pavlov S, Babenko N, Kumetchko M, Litvinova O, Komarchuk I. Activation of reparative processes of chronic wounds using photobiomodulation therapy (experimental study) Pol Merkur Lekarski. 2024;52(3):261–7. doi: 10.36740/Merkur202403101. [DOI] [PubMed] [Google Scholar]
  • 33.Hilkens P, Fanton Y, Martens W, Gervois P, Struys T, Politis C, et al. Pro-angiogenic impact of dental stem cells in vitro and in vivo. Stem Cell Res. 2014;12(3):778–90. doi: 10.1016/j.scr.2014.03.008. [DOI] [PubMed] [Google Scholar]
  • 34.El Moshy S, Radwan IA, Rady D, Abbass MM, El-Rashidy AA, Sadek KM, et al. Dental stem cell-derived secretome/conditioned medium: the future for regenerative therapeutic applications. Stem Cells Int. 2020;2020:7593402. doi: 10.1155/2020/7593402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bronckaers A, Hilkens P, Fanton Y, Struys T, Gervois P, Politis C, et al. Angiogenic properties of human dental pulp stem cells. PLoS One. 2013;8(8):e71104. doi: 10.1371/journal.pone.0071104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Boomsma RA, Geenen DL. Mesenchymal stem cells secrete multiple cytokines that promote angiogenesis and have contrasting effects on chemotaxis and apoptosis. PLoS One. 2012;7(4):e35685. doi: 10.1371/journal.pone.0035685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tao H, Han Z, Han ZC, Li Z. Proangiogenic features of mesenchymal stem cells and their therapeutic applications. Stem Cells Int. 2016;2016:1314709. doi: 10.1155/2016/1314709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kichenbrand C, Velot E, Menu P, Moby V. Dental pulp stem cell-derived conditioned medium: an attractive alternative for regenerative therapy. Tissue Eng Part B Rev. 2019;25(1):78–88. doi: 10.1089/ten.TEB.2018.0168. [DOI] [PubMed] [Google Scholar]
  • 39.Mabotuwana NS, Rech L, Lim J, Hardy SA, Murtha LA, Rainer PP, et al. Paracrine factors released by stem cells of mesenchymal origin and their effects in cardiovascular disease: a systematic review of pre-clinical studies. Stem Cell Rev Rep. 2022;18(8):2606–28. doi: 10.1007/s12015-022-10429-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ghahremani-Nasab M, Akbari-Gharalari N, Rahmani Del Bakhshayesh A, Ghotaslou A, Ebrahimi-Kalan A, Mahdipour M, et al. Synergistic effect of chitosan-alginate composite hydrogel enriched with ascorbic acid and alpha-tocopherol under hypoxic conditions on the behavior of mesenchymal stem cells for wound healing. Stem Cell Res Ther. 2023;14(1):326. doi: 10.1186/s13287-023-03567-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Soheilifar MH, Dastan D, Masoudi-Khoram N, Keshmiri Neghab H, Nobari S, Tabaie SM, et al. In vitro and in vivo evaluation of the diabetic wound healing properties of saffron (Crocus sativus L) petals. Sci Rep. 2024;14(1):19373. doi: 10.1038/s41598-024-70010-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Karkehabadi H, Zafari J, Khoshbin E, Abbasi R, Esmailnasab S, Doosti-Irani A. Effect of low-level laser therapy on differentiation and proliferation of human dental pulp stem cells: a systematic review. J Lasers Med Sci. 2023;14:e47. doi: 10.34172/jlms.2023.47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Asnaashari M, Shojaeian S, Mesgharani A, Mehrabinia P. The effect of low-level laser therapy on the viability of human dental pulp stem cells. J Lasers Med Sci. 2022;13:e60. doi: 10.34172/jlms.2022.60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Atasoy KT, Korkmaz YT, Odaci E, Hanci H. The efficacy of low-level 940 nm laser therapy with different energy intensities on bone healing. Braz Oral Res. 2017;31:e7. doi: 10.1590/1807-3107BOR-2017.vol31.0007. [DOI] [PubMed] [Google Scholar]
  • 45.AlGhamdi AS, Shibly O, Ciancio SG. Osseous grafting part I: autografts and allografts for periodontal regeneration--a literature review. J Int Acad Periodontol. 2010;12(2):34–8. [PubMed] [Google Scholar]
  • 46.Bernardi L, Luisi SB, Fernandes R, Dalberto TP, Valentim L, Bogo Chies JA, et al. The isolation of stem cells from human deciduous teeth pulp is related to the physiological process of resorption. J Endod. 2011;37(7):973–9. doi: 10.1016/j.joen.2011.04.010. [DOI] [PubMed] [Google Scholar]
  • 47.Fassl A, Sicinski P. PC4: a new regulator of cyclin D1 transcript levels. J Cell Biol. 2024;223(3):e202401056. doi: 10.1083/jcb.202401056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Cardona-Benavides IJ, Cristobal-Vargas S, De Ramón C, Rojas EA, Misiewicz-Krzeminska I, Isidro I, et al. Exploring the role of cyclin D1 in the pathogenesis of multiple myeloma beyond cell cycle regulation. Mol Oncol. 2025;19(11):3175–92. doi: 10.1002/1878-0261.70085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sperandio FF, Simões A, Corrêa L, Aranha AC, Giudice FS, Hamblin MR, et al. Low-level laser irradiation promotes the proliferation and maturation of keratinocytes during epithelial wound repair. J Biophotonics. 2015;8(10):795–803. doi: 10.1002/jbio.201400064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Tang MQ, Ye L, Gao B. Role of dental pulp stem cells to promote angiogenesis in cell-based regenerative endodontics. Chin J Dent Res. 2023;26(3):129–42. doi: 10.3290/j.cjdr.b4330823. [DOI] [PubMed] [Google Scholar]
  • 51.Luzuriaga J, Irurzun J, Irastorza I, Unda F, Ibarretxe G, Pineda JR. Vasculogenesis from human dental pulp stem cells grown in matrigel with fully defined serum-free culture media. Biomedicines. 2020;8(11):483. doi: 10.3390/biomedicines8110483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Hilkens P, Bronckaers A, Ratajczak J, Gervois P, Wolfs E, Lambrichts I. The angiogenic potential of DPSCs and SCAPs in an in vivo model of dental pulp regeneration. Stem Cells Int. 2017;2017:2582080. doi: 10.1155/2017/2582080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Mattei V, Martellucci S, Pulcini F, Santilli F, Sorice M, Delle Monache S. Regenerative potential of DPSCs and revascularization: direct, paracrine or autocrine effect? Stem Cell Rev Rep. 2021;17(5):1635–46. doi: 10.1007/s12015-021-10162-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Karaöz E, Doğan BN, Aksoy A, Gacar G, Akyüz S, Ayhan S, et al. Isolation and in vitro characterisation of dental pulp stem cells from natal teeth. Histochem Cell Biol. 2010;133(1):95–112. doi: 10.1007/s00418-009-0646-5. [DOI] [PubMed] [Google Scholar]
  • 55.Yusof MF, Zahari W, Hashim SN, Osman ZF, Chandra H, Kannan TP, et al. Angiogenic and osteogenic potentials of dental stem cells in bone tissue engineering. J Oral Biol Craniofac Res. 2018;8(1):48–53. doi: 10.1016/j.jobcr.2017.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Finley LWS, Vardhana SA, Carey BW, Alonso-Curbelo D, Koche R, Chen Y, et al. Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity. Nat Cell Biol. 2018;20(5):565–74. doi: 10.1038/s41556-018-0086-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Verneri P, Vazquez Echegaray C, Oses C, Stortz M, Guberman A, Levi V. Dynamical reorganization of the pluripotency transcription factors Oct4 and Sox2 during early differentiation of embryonic stem cells. Sci Rep. 2020;10(1):5195. doi: 10.1038/s41598-020-62235-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Hong H, Zeng K, Zhou C, Chen X, Xu Z, Li M, et al. The pluripotent factor OCT4A enhances the self-renewal of human dental pulp stem cells by targeting lncRNA FTX in an LPS-induced inflammatory microenvironment. Stem Cell Res Ther. 2023;14(1):109. doi: 10.1186/s13287-023-03313-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Wei Y, Peng Z. Pluripotency of periodontal ligament and dental pulp cells is induced by intercellular communication via the CDX2/Oct-4/Sox2 pathway. Ann Transl Med. 2022;10(16):868. doi: 10.21037/atm-22-3492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Huang CE, Hu FW, Yu CH, Tsai LL, Lee TH, Chou MY, et al. Concurrent expression of Oct4 and Nanog maintains mesenchymal stem-like property of human dental pulp cells. Int J Mol Sci. 2014;15(10):18623–39. doi: 10.3390/ijms151018623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Peng Z, Liu L, Zhang W, Wei X. Pluripotency of dental pulp cells and periodontal ligament cells was enhanced through cell-cell communication via STAT3/Oct-4/Sox2 signaling. Stem Cells Int. 2021;2021:8898506. doi: 10.1155/2021/8898506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Han SM, Han SH, Coh YR, Jang G, Chan Ra J, Kang SK, et al. Enhanced proliferation and differentiation of Oct4- and Sox2-overexpressing human adipose tissue mesenchymal stem cells. Exp Mol Med. 2014;46(6):e101. doi: 10.1038/emm.2014.28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Xu JG, Zhu SY, Heng BC, Dissanayaka WL, Zhang CF. TGF-β1-induced differentiation of SHED into functional smooth muscle cells. Stem Cell Res Ther. 2017;8(1):10. doi: 10.1186/s13287-016-0459-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Li Y, Jiang H, Li X, Zhu H, Dai Y, Zhang J, et al. Platelet-specific deletion of TGF-β1 impairs septic thrombosis in mice-brief report. Arterioscler Thromb Vasc Biol. 2025;45(1):136–43. doi: 10.1161/atvbaha.124.322029. [DOI] [PubMed] [Google Scholar]
  • 65.Shi X, Young CD, Zhou H, Wang X. Transforming growth factor-β signaling in fibrotic diseases and cancer-associated fibroblasts. Biomolecules. 2020;10(12):1666. doi: 10.3390/biom10121666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Li GC, Zhang HW, Zhao QC, Sun LI, Yang JJ, Hong L, et al. Mesenchymal stem cells promote tumor angiogenesis via the action of transforming growth factor β1. Oncol Lett. 2016;11(2):1089–94. doi: 10.3892/ol.2015.3997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Arany PR, Cho A, Hunt TD, Sidhu G, Shin K, Hahm E, et al. Photoactivation of endogenous latent transforming growth factor-β1 directs dental stem cell differentiation for regeneration. Sci Transl Med. 2014;6(238):238ra69. doi: 10.1126/scitranslmed.3008234. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Lasers in Medical Sciences are provided here courtesy of Shahid Beheshti University of Medical Sciences

RESOURCES