Abstract
CHR101 ( ZmDDM1A ) encodes a chromatin remodeling factor involved in DNA methylation maintenance and transposable element silencing in maize. We analyzed two Mutator (Mu) insertion alleles of Chr101 : chr101-m1 , containing an insertion in the 5′ untranslated region, and chr101-m3 , containing an insertion in exon 3. Quantitative RT-PCR revealed that Chr101 transcript abundance was reduced by approximately 76-93% in both homozygous mutant lines at juvenile (V4) and adult (V7) vegetative stages. Reduced expression of Aspartic Proteinase A1 ( Apa1 ) was also observed in the mutant backgrounds examined.
Figure 1. Characterization of Chr101 ( ZmDDM1A ) Mutator insertion alleles and transcript accumulation in mutant plants .
(A) Gene model of Chr101 (GRMZM2G177165/Zm00001d007978) showing the locations of the Mu insertions. Numbered boxes indicate exons, with dark blue representing coding sequences (CDS) and light blue representing untranslated regions (UTRs). Red arrows indicate the insertion sites of chr101-m1 and chr101-m3 . Black arrows indicate primer positions used for genotyping and expression analyses.
(B–E) Quantitative RT-PCR analysis of Chr101 and Aspartic Proteinase A1 ( Apa1 ) transcript abundance in V4 and V7 leaf tissues. Expression levels in homozygous mutant plants were normalized to Ubiquitin and compared with wild-type B73 plants at the corresponding developmental stage. Relative expression values were calculated using the 2^-ΔΔCt method. Three technical replicates were averaged for each biological replicate prior to analysis. Statistical comparisons were performed using Student’s t-test on biological replicate ΔCt values (Yuan et al., 2006). Biological replicate numbers were B73 V4 (n = 2), chr101-m1 V4 (n = 4), chr101-m3 V4 (n = 2), B73 V7 (n = 2), chr101-m1 V7 (n = 4), and chr101-m3 V7 (n = 2). Error bars indicate ± standard error of the mean. ns, p ≥ 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001.
Description
Transposable elements (TEs) comprise approximately 85% of the maize ( Zea mays ) genome and are maintained in a transcriptionally silent state through epigenetic mechanisms including DNA methylation and chromatin remodeling (Schnable et al., 2009; Stitzer et al., 2021; Osakabe et al., 2021). The maize locus Chr101 ( ZmDDM1A ; GRMZM2G177165; Zm00001d007978) encodes an ortholog of Arabidopsis DECREASE IN DNA METHYLATION 1 (DDM1), a chromatin remodeling factor involved in maintaining DNA methylation and transcriptional silencing in nucleosome-dense chromatin (Li et al., 2014; Long et al., 2021). Previous studies demonstrated that disruption of Chr101 affects DNA methylation and chromatin-associated RNA-directed DNA methylation (RdDM) pathways in maize (Li et al., 2014; Fu et al., 2018; Long et al., 2021).
Mutator (Mu) transposable elements are widely used for gene tagging and functional analysis in maize because their insertions frequently disrupt gene expression and can be readily tracked in genetic populations (Robertson, 1978; Settles et al., 2004; McCarty et al., 2005). In this study, we examined two independent Mu insertion alleles of Chr101 . The chr101-m1 allele contains a Mu insertion within the 5′ untranslated region (UTR), whereas chr101-m3 contains a Mu insertion within exon 3 of the coding sequence ( Figure 1A ). These alleles provide an opportunity to compare the effects of 5′ UTR and coding-region insertions on Chr101 transcript accumulation during vegetative development.
Homozygous mutant lines were utilized for all downstream expression analyses. Zygosity was determined using insertion-specific junction primers and flanking genomic primers and was subsequently verified through sequence alignment of insertion-flanking genomic DNA (Supplementary Figures S1–S2).
Both Mu insertion alleles exhibited substantial reductions in Chr101 transcript accumulation (Supplementary Data File S1). For the 5′ UTR insertion allele, chr101-m1 , Chr101 expression was significantly reduced relative to B73 at both the V4 (p = 0.019) and V7 (p = 0.024) developmental stages ( Figure 1B, C). Transcript abundance was reduced by approximately 79% at V4 and 76% at V7. Similarly, the exon 3 insertion allele, chr101-m3 , showed significantly reduced Chr101 expression at V4 (p = 0.025) and V7 (p = 0.024), corresponding to reductions of approximately 93% and 88%, respectively ( Figure 1B, C). In both developmental stages, the exon 3 insertion was associated with a larger reduction in transcript abundance than the 5′ UTR insertion, although both alleles produced substantial decreases. These observations indicate that insertions in either the 5’UTR region or coding sequence function as strong transcriptional knockdown alleles of Chr101 .
Previous work by Stroud and McGinnis (2017) reported reduced Chr101 transcript abundance in both chr101-m1 and chr101-m3 homozygous mutants at the V9 developmental stage. Our results extend these observations by demonstrating that reduced Chr101 expression is already detectable at V4 and remains evident at V7.
In addition to Chr101 , expression of Aspartic Proteinase A1 ( Apa1 ; Zm00001d044132 or GRMZM2G130333) was examined as a representative euchromatic gene. Based on the B73 RefGen_v5 genome assembly, Apa1 resides within a gene-dense interval containing eight annotated genes within approximately 100 kb (Jiao et al., 2017) and was not selected based on any previously established relationship with CHR101.
Apa1 expression was significantly reduced in the chr101-m1 line at both V4 ( p = 0.0084) and V7 ( p = 0.0032), corresponding to reductions of approximately 98% and 97%, respectively, relative to B73 controls ( Figure 1D, E). Apa1 transcript abundance was also significantly reduced in the chr101-m3 line at V4 ( p = 0.0014), corresponding to an approximately 99% reduction relative to B73 ( Figure 1D ). Although mean Apa1 expression was lower in the chr101-m3 line at V7, the difference was not statistically significant ( p = 0.191). Thus, lower Apa1 transcript abundance was observed in both chr101 allele lines at V4 and in chr101-m1 at V7, although the association was not statistically significant in every comparison.
Although DDM1 proteins are best known for their functions in heterochromatin, maize ZmDDM1 also associates with transcription start sites and other euchromatic regions, and loss of maize DDM1-type remodelers affects RdDM-associated methylation and small-RNA accumulation near genes (Fu et al., 2018; Long et al., 2021). These findings demonstrate that ZmDDM1 is associated with gene-proximal chromatin and provide a possible context for the reduced Apa1 transcript abundance observed here. The consistent direction of the effect across two independent chr101 alleles supports the reproducibility of this association. However, Apa1 has not been identified as a direct ZmDDM1 target, and the mechanism underlying this expression difference remains unresolved.
Overall, these results further characterize two widely used Chr101 mutant alleles and extend previous observations of reduced Chr101 expression to the V4 and V7 stages of vegetative development. Both alleles function as strong knockdown alleles at the transcript level. Reduced Apa1 transcript abundance was also observed in both mutant lines in multiple comparisons, although whether this association represents a direct or indirect consequence of reduced CHR101 activity remains unknown.
Methods
Plant Materials and Growth
The wild-type line B73 was acquired from the Maize Genetics Cooperation Stock Center. Seeds for chr101-m1 (B73 background) and chr101-m3 (B73 background) were generously donated by the Springer Lab (University of Minnesota) and were originally described by Li et al. (2014). Premier B10281RG ProMix was used to propagate seeds in small pots. At the V4 developmental stage, seedlings were transferred to larger pots for the remainder of the experiment. Plants were grown under greenhouse conditions at 24–29°C and approximately 80% humidity and were watered twice per week.
Genotyping
Leaf tip tissue samples (approximately 2 cm in length) were collected for genotyping. DNA extraction was performed using the Quick-DNA™ Plant/Seed Miniprep Kit (Zymo Research D6020). To confirm homozygosity of the Mu insertions in Chr101 , PCR was performed using PCR Master Mix (Sydlabs, MB067-EQ2B). Reactions utilized flanking and junction primer sequences specific to the Mu transposable element. Actin primers were used as a positive control, and nuclease-free water was used as a negative control. Thermal cycling conditions were 95°C for 3 min; 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s (1 min per kilobase); followed by a final extension at 72°C for 5 min. Amplified products were visualized on 1% agarose gels using a GelDoc Go Imaging System (Bio-Rad).
RNA Extraction and Quantification
Leaf tip tissues (~2 cm) from Leaf 4 or Leaf 7 were collected from plants with confirmed homozygous Mu insertions at the V4 and V7 developmental stages, respectively. Samples were stored in TRIzol Reagent (Invitrogen) and ground prior to RNA extraction using the Direct-zol™ Miniprep Plus Kit (Zymo Research R2072). RNA quality was assessed using the Qubit™ RNA Broad-Range Assay Kit (Thermo Fisher Scientific), the Qubit™ RNA IQ Assay (Invitrogen), and agarose gel electrophoresis.
qRT-PCR and Data Analysis
To measure gene expression, qRT-PCR was performed using the Luna® Universal One-Step RT-qPCR Kit (E3005X; New England Biolabs) on a CFX Connect Real-Time PCR Detection System (Bio-Rad). Transcript levels of Chr101 , Apa1 , and Ubiquitin (reference gene, GRMZM2G409726) were measured. Relative expression values were calculated using the 2^-ΔΔCt method (Livak and Schmittgen, 2001). Three technical replicates were performed for each biological replicate and were averaged prior to analysis. Biological replicate numbers were B73 V4 (n = 2), chr101-m1 V4 (n = 4), chr101-m3 V4 (n = 2), B73 V7 (n = 2), chr101-m1 V7 (n = 4), and chr101-m3 V7 (n = 2). Statistical comparisons between genotypes were performed using Student’s t-test on biological replicate ΔCt values following the framework described by Yuan et al. (2006). Relative expression values are reported as means ± standard error of the mean.
Reagents
|
Primer Target |
Name |
Sequence (5' to 3') |
|
Genotyping PCR | ||
|
chr101-m1 Flank |
chr101F2 |
AAAGCTTCCGTTTCCTTCAGTTCAC |
|
chr101-m1 Flank |
chr101R4 |
CTCCAGTAGTCGCTCTTCCTCCTTC |
|
chr101-m3 Flank |
chr101F3 |
GAAGAGGCTGCTAGACTTGCTTTTG |
|
chr101-m3 Flank |
chr101R2 |
TCTTCTACCTGTGGCTGTTCAGCTTGAG |
|
Mutator TE |
Museq |
CGCCATGGCCTCCATTTCGTCGAATC |
|
RT-qPCR | ||
|
Chr101 Exon 6 |
ddm1-e6_f |
TCATCCACAACAACATACTTCCACT |
|
Chr101 Exon 6 |
ddm1-e6_r |
TGCCCACAAATGTTGGCCCT |
|
Apa1 |
apa_qf |
TGGCGGAAGGAGCACTGGAA |
|
Apa1 |
apa_qr |
CCGGCCGCTCCAATCTGTTC |
|
Ubiquitin |
Ubi-F |
GTCATAGTTCTGGGTAGTACGC |
|
Ubiquitin |
Ubi-R |
TGGAGGTTGTCAAAGTATCTGC |
Acknowledgments
We thank the Springer Lab (University of Minnesota) and Zhao Lab (University of Florida) for providing the mutant seed stocks used in this study. We also thank the USDA-ARS Maize Genetics Cooperation Stock Center (Urbana, Illinois, USA) for providing B73 seed.
We acknowledge access to shared equipment and greenhouse facilities provided by the Department of Biology at Hofstra University. We are grateful to Dr. Luciana Santoferrara for access to the Qubit fluorometer, Dr. Chris Boyko for assistance with reagent procurement and laboratory safety oversight, and Nancy Radecker for greenhouse management and plant care. We also thank the faculty and staff of the Department of Biology for their support of this project.
Funding Statement
This work was funded by Department of Biology at Hofstra University and the National Science Foundation (Award #2334573) to PI Wang.
Extended Data
Description: PCR using insertion-specific and flanking primers to confirm the genotypes of plants. Resource Type: Image. DOI: https://doi.org/10.22002/mrvke-e5r18
Description: Sequence alignment between the junction PCR product with Chr101. Resource Type: Image. DOI: https://doi.org/10.22002/4psz8-src28
Description: Raw qRT-PCR data and expression calculations. Resource Type: Dataset. DOI: https://doi.org/10.22002/25qsq-f7989
References
- Fu Fang-Fang, Dawe R. Kelly, Gent Jonathan I. Loss of RNA-Directed DNA Methylation in Maize Chromomethylase and DDM1-Type Nucleosome Remodeler Mutants. The Plant Cell. 2018 Jun 8;30(7):1617–1627. doi: 10.1105/tpc.18.00053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gent Jonathan I., Ellis Nathanael A., Guo Lin, Harkess Alex E., Yao Yingyin, Zhang Xiaoyu, Dawe R. Kelly. CHH islands: de novo DNA methylation in near-gene chromatin regulation in maize. Genome Research. 2012 Dec 26;23(4):628–637. doi: 10.1101/gr.146985.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiao Yinping, Peluso Paul, Shi Jinghua, Liang Tiffany, Stitzer Michelle C., Wang Bo, Campbell Michael S., Stein Joshua C., Wei Xuehong, Chin Chen-Shan, Guill Katherine, Regulski Michael, Kumari Sunita, Olson Andrew, Gent Jonathan, Schneider Kevin L., Wolfgruber Thomas K., May Michael R., Springer Nathan M., Antoniou Eric, McCombie W. Richard, Presting Gernot G., McMullen Michael, Ross-Ibarra Jeffrey, Dawe R. Kelly, Hastie Alex, Rank David R., Ware Doreen. Improved maize reference genome with single-molecule technologies. Nature. 2017 Jun 1;546(7659):524–527. doi: 10.1038/nature22971. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Qing, Eichten Steven R., Hermanson Peter J., Zaunbrecher Virginia M., Song Jawon, Wendt Jennifer, Rosenbaum Heidi, Madzima Thelma F., Sloan Amy E., Huang Ji, Burgess Daniel L., Richmond Todd A., McGinnis Karen M., Meeley Robert B., Danilevskaya Olga N., Vaughn Matthew W., Kaeppler Shawn M., Jeddeloh Jeffrey A., Springer Nathan M. Genetic Perturbation of the Maize Methylome. The Plant Cell. 2014 Dec 1;26(12):4602–4616. doi: 10.1105/tpc.114.133140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Livak Kenneth J., Schmittgen Thomas D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001 Dec 1;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- Long Jincheng, Liu Jinghan, Xia Aiai, Springer Nathan M., He Yan. Maize decrease in DNA methylation 1 targets RNA-directed DNA methylation on active chromatin. The Plant Cell. 2021 Mar 29;33(7):2183–2196. doi: 10.1093/plcell/koab098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McCarty Donald R., Mark Settles Andrew, Suzuki Masaharu, Tan Bao Cai, Latshaw Susan, Porch Tim, Robin Kevin, Baier John, Avigne Wayne, Lai Jinsheng, Messing Joachim, Koch Karen E., Curtis Hannah L. Steady‐state transposon mutagenesis in inbred maize. The Plant Journal. 2005 Sep 6;44(1):52–61. doi: 10.1111/j.1365-313x.2005.02509.x. [DOI] [PubMed] [Google Scholar]
- Osakabe Akihisa, Jamge Bhagyshree, Axelsson Elin, Montgomery Sean A., Akimcheva Svetlana, Kuehn Annika Luisa, Pisupati Rahul, Lorković Zdravko J., Yelagandula Ramesh, Kakutani Tetsuji, Berger Frédéric. The chromatin remodeler DDM1 prevents transposon mobility through deposition of histone variant H2A.W. Nature Cell Biology. 2021 Apr 1;23(4):391–400. doi: 10.1038/s41556-021-00658-1. [DOI] [PubMed] [Google Scholar]
- Osakabe Akihisa, Takizawa Yoshimasa, Horikoshi Naoki, Hatazawa Suguru, Negishi Lumi, Sato Shoko, Berger Frédéric, Kakutani Tetsuji, Kurumizaka Hitoshi. Molecular and structural basis of the chromatin remodeling activity by Arabidopsis DDM1. Nature Communications. 2024 Jul 11;15(1) doi: 10.1038/s41467-024-49465-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robertson Donald S. Characterization of a mutator system in maize. Mutation Research. 1978 Jul 1;51(1):21–28. doi: 10.1016/0027-5107(78)90004-0. [DOI] [Google Scholar]
- Schnable Patrick S., Ware Doreen, Fulton Robert S., Stein Joshua C., Wei Fusheng, Pasternak Shiran, Liang Chengzhi, Zhang Jianwei, Fulton Lucinda, Graves Tina A., Minx Patrick, Reily Amy Denise, Courtney Laura, Kruchowski Scott S., Tomlinson Chad, Strong Cindy, Delehaunty Kim, Fronick Catrina, Courtney Bill, Rock Susan M., Belter Eddie, Du Feiyu, Kim Kyung, Abbott Rachel M., Cotton Marc, Levy Andy, Marchetto Pamela, Ochoa Kerri, Jackson Stephanie M., Gillam Barbara, Chen Weizu, Yan Le, Higginbotham Jamey, Cardenas Marco, Waligorski Jason, Applebaum Elizabeth, Phelps Lindsey, Falcone Jason, Kanchi Krishna, Thane Thynn, Scimone Adam, Thane Nay, Henke Jessica, Wang Tom, Ruppert Jessica, Shah Neha, Rotter Kelsi, Hodges Jennifer, Ingenthron Elizabeth, Cordes Matt, Kohlberg Sara, Sgro Jennifer, Delgado Brandon, Mead Kelly, Chinwalla Asif, Leonard Shawn, Crouse Kevin, Collura Kristi, Kudrna Dave, Currie Jennifer, He Ruifeng, Angelova Angelina, Rajasekar Shanmugam, Mueller Teri, Lomeli Rene, Scara Gabriel, Ko Ara, Delaney Krista, Wissotski Marina, Lopez Georgina, Campos David, Braidotti Michele, Ashley Elizabeth, Golser Wolfgang, Kim HyeRan, Lee Seunghee, Lin Jinke, Dujmic Zeljko, Kim Woojin, Talag Jayson, Zuccolo Andrea, Fan Chuanzhu, Sebastian Aswathy, Kramer Melissa, Spiegel Lori, Nascimento Lidia, Zutavern Theresa, Miller Beth, Ambroise Claude, Muller Stephanie, Spooner Will, Narechania Apurva, Ren Liya, Wei Sharon, Kumari Sunita, Faga Ben, Levy Michael J., McMahan Linda, Van Buren Peter, Vaughn Matthew W., Ying Kai, Yeh Cheng-Ting, Emrich Scott J., Jia Yi, Kalyanaraman Ananth, Hsia An-Ping, Barbazuk W. Brad, Baucom Regina S., Brutnell Thomas P., Carpita Nicholas C., Chaparro Cristian, Chia Jer-Ming, Deragon Jean-Marc, Estill James C., Fu Yan, Jeddeloh Jeffrey A., Han Yujun, Lee Hyeran, Li Pinghua, Lisch Damon R., Liu Sanzhen, Liu Zhijie, Nagel Dawn Holligan, McCann Maureen C., SanMiguel Phillip, Myers Alan M., Nettleton Dan, Nguyen John, Penning Bryan W., Ponnala Lalit, Schneider Kevin L., Schwartz David C., Sharma Anupma, Soderlund Carol, Springer Nathan M., Sun Qi, Wang Hao, Waterman Michael, Westerman Richard, Wolfgruber Thomas K., Yang Lixing, Yu Yeisoo, Zhang Lifang, Zhou Shiguo, Zhu Qihui, Bennetzen Jeffrey L., Dawe R. Kelly, Jiang Jiming, Jiang Ning, Presting Gernot G., Wessler Susan R., Aluru Srinivas, Martienssen Robert A., Clifton Sandra W., McCombie W. Richard, Wing Rod A., Wilson Richard K. The B73 Maize Genome: Complexity, Diversity, and Dynamics. Science. 2009 Nov 20;326(5956):1112–1115. doi: 10.1126/science.1178534. [DOI] [PubMed] [Google Scholar]
- Settles A Mark, Holding David R, Tan Bao Cai, Latshaw Susan P, Liu Juan, Suzuki Masaharu, Li Li, O'Brien Brent A, Fajardo Diego S, Wroclawska Ewa, Tseung Chi-Wah, Lai Jinsheng, Hunter Charles T, Avigne Wayne T, Baier John, Messing Joachim, Hannah L Curtis, Koch Karen E, Becraft Philip W, Larkins Brian A, McCarty Donald R. Sequence-indexed mutations in maize using the UniformMu transposon-tagging population. BMC Genomics. 2007 May 9;8(1) doi: 10.1186/1471-2164-8-116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stitzer Michelle C., Anderson Sarah N., Springer Nathan M., Ross-Ibarra Jeffrey. The genomic ecosystem of transposable elements in maize. PLOS Genetics. 2021 Oct 14;17(10):e1009768–e1009768. doi: 10.1371/journal.pgen.1009768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stroud Linda K., McGinnis Karen M. Altered nucleosome positions in maize haplotypes and mutants of a subset of SWI/SNF‐like proteins . Plant Direct. 2017 Oct 1;1(4) doi: 10.1002/pld3.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yuan Joshua S, Reed Ann, Chen Feng, Stewart C Neal. Statistical analysis of real-time PCR data. BMC Bioinformatics. 2006 Feb 22;7(1) doi: 10.1186/1471-2105-7-85. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Description: PCR using insertion-specific and flanking primers to confirm the genotypes of plants. Resource Type: Image. DOI: https://doi.org/10.22002/mrvke-e5r18
Description: Sequence alignment between the junction PCR product with Chr101. Resource Type: Image. DOI: https://doi.org/10.22002/4psz8-src28
Description: Raw qRT-PCR data and expression calculations. Resource Type: Dataset. DOI: https://doi.org/10.22002/25qsq-f7989