Sirtuin 2 Contributes to Pancreatic Injury and Inflammation by Modulating Immediate Early Response 3–Mediated Ferroptosis in Acute Pancreatitis

Abstract

Background & Aims

Acute pancreatitis is a potentially life-threatening inflammatory disorder characterized by trypsin overactivation within acinar cells. Although sirtuin 2 is linked to inflammation, its precise role in acute pancreatitis remains poorly understood.

Methods

Rats were pretreated with AGK2 a (sirtuin 2 inhibitor), Ferrostatin-1 (ferroptosis inhibitor), 1α,25-dihydroxyvitamin D3 (an immediate early response 3 inhibitor), adeno-associated virus–sirtuin 2, or adeno-associated virus–short hairpin-sirtuin 2 before L-arginine–induced acute pancreatitis. RNA sequencing was performed to identify potential downstream targets of sirtuin 2. In vitro, sirtuin 2 and immediate early response 3 expression was manipulated by small interfering RNA or overexpression plasmids. The effects on ferroptosis and inflammation were assessed using Western blot, quantitative polymerase chain reaction, immunofluorescence, and assays measuring reactive oxygen species, iron (II), mitochondrial membrane potential, and lipid peroxidation. Regulatory mechanisms among sirtuin 2, immediate early response 3, and ferroptosis were further investigated using co-immunoprecipitation and dual-luciferase assays.

Results

AGK2 or ferrostatin-1 alone reduced pancreatic damage, inflammation, and ferroptosis, with combination therapy showing synergy. Sirtuin 2 or immediate early response 3 inhibition was protective, upregulating solute carrier family 7 member 11–glutathione peroxidase 4, reducing reactive oxygen species, iron (II), and lipid peroxides, and restoring mitochondrial function. Conversely, overexpression of sirtuin 2 or immediate early response 3 produced the opposite effects. AGK2 and 1α,25-dihydroxyvitamin D3 reversed damage from sirtuin 2 overexpression. Co-immunoprecipitation confirmed sirtuin 2 deacetylates and upregulates immediate early response 3. Luciferase assays showed immediate early response 3 transcriptionally represses solute carrier family 7 member 11. Clinically, serum sirtuin 2 and immediate early response 3 were elevated in patients with acute pancreatitis and correlated with disease severity and inflammation.

Conclusions

Sirtuin 2 enhances immediate early response 3 expression via deacetylation, inhibiting the solute carrier family 7 member 11–glutathione peroxidase 4 axis and promoting ferroptosis, thereby exacerbating acute pancreatitis. Serum sirtuin 2 and immediate early response 3 are potential biomarkers for acute pancreatitis severity. This study reveals a novel sirtuin 2–immediate early response 3-mediated mechanism driving ferroptosis in acute pancreatitis.

Graphical abstract

Summary.

Sirtuin 2 upregulates immediate early response 3 through deacetylation, thereby inhibiting the solute carrier family 7 member 11–glutathione peroxidase 4 axis and promoting ferroptosis, thus exacerbating acute pancreatitis. Elevated serum sirtuin 2 and immediate early response 3 are associated with Sequential Organ Failure Assessment score and inflammation, suggesting that they can serve as biomarkers for predicting the severity of acute pancreatitis.

What You Need to Know.

Background

Acute pancreatitis is a potentially life-threatening inflammatory disorder characterized by trypsin overactivation within acinar cells. Although sirtuin 2 is linked to inflammation, its precise role in acute pancreatitis remains poorly understood.

Impact

Sirtuin 2 upregulates immediate early response 3 through deacetylation, thereby inhibiting the solute carrier family 7 member 11–glutathione peroxidase 4 axis and promoting ferroptosis, thus exacerbating acute pancreatitis. This study reveals a novel sirtuin 2–immediate early response 3-mediated mechanism driving ferroptosis in acute pancreatitis.

Future Directions

Serum sirtuin 2 and immediate early response 3 are potential biomarkers for acute pancreatitis severity. Targeting sirtuin 2 and immediate early response 3 will be a novel therapy for treating and assessing the prognosis of acute pancreatitis.

Acute pancreatitis (AP) is a common inflammatory disease of the digestive system, characterized by notable incidence and mortality rates.^1,2 Approximately 80% of patients with AP manifest mild disease with a short clinical course and achieve a favorable prognosis. However, in the absence of timely intervention, about 20% of patients progress to moderate or severe acute pancreatitis (SAP).3, 4, 5, 6 SAP is frequently accompanied by complications such as pancreatic or peripancreatic necrosis, systemic inflammatory response syndrome, and multiple organ failure.^7,8 The associated mortality rate ranges from 15% to 30%.⁹ Current management of AP primarily relies on supportive treatments, such as aggressive fluid resuscitation and nutritional support, and specific therapies targeting its pathogenesis are still lacking.^10,11 Therefore, further investigation into the pathogenesis of AP and the identification of novel therapeutic targets are of great clinical significance.

The sirtuin family comprises 7 histone deacetylases (SIRT1–7). They play crucial roles in diverse cellular processes, including apoptosis, inflammation, metabolism, aging, stress responses, and tumorigenesis.^12,13 Sirtuin 2 (SIRT2) is the only sirtuin predominantly localized in the cytoplasm and shuttles between the nucleus and cytoplasm via nuclear export signals.¹⁴ It regulates key processes including aging, metabolism, apoptosis, differentiation, RNA transport and binding, and DNA damage response.^15,16 Previous studies have demonstrated that SIRT2 deficiency reduces inducible nitric oxide synthase expression, nitric oxide production, and reactive oxygen species (ROS) generation in lipopolysaccharide (LPS)-induced macrophages by inhibiting nuclear factor-κB (NF-κB) activation.¹⁷ SIRT2 exacerbates LPS-induced kidney inflammation by upregulating C-X-C motif chemokine ligand 2 and C-C motif ligand 2, whereas SIRT2 deficiency downregulates these chemokines, reduces neutrophil and macrophage infiltration, and alleviates renal tubular damage and dysfunction.¹⁸ In neuroinflammatory conditions, the SIRT2 inhibitor AGK2 blocks NF-κB nuclear translocation, decreases terminal deoxynucleotidyl transferase dUTP nick end labeling–positive cell death, and suppresses LPS-induced expression of Caspase-3 and bcl-2-associated X protein.¹⁵ Furthermore, SIRT2 deacetylates nuclear factor erythroid 2-related factor 2 (Nrf2) in cardiac tissue, reducing antioxidant protein expression. Correspondingly, SIRT2 knockout mice exhibit enhanced Nrf2-mediated cardioprotection under pressure overload, and AGK2 treatment decreases ROS levels in cardiomyocytes while mitigating cardiac hypertrophy.¹⁹ These findings indicate that SIRT2 deficiency or inhibition attenuates inflammatory responses, oxidative stress, and ROS accumulation, thereby ameliorating disease progression in various contexts. Because oxidative stress and ROS accumulation can induce ferroptosis—a form of cell death characterized by iron-dependent lipid peroxidation—SIRT2 may regulate ferroptosis, although the specific mechanisms remain to be elucidated.

Ferroptosis is closely linked to inflammatory processes in AP. Abnormal iron metabolism frequently occurs at the onset of AP.²⁰ Recent studies have shown that elevated serum iron levels are strongly associated with higher mortality and poorer prognosis in patients with AP.²¹ Iron overload disrupts pancreatic exocrine function and induces ferroptosis in acinar cells, thereby contributing to pancreatitis.²² Inhibition of ferroptosis has been reported to reduce ROS generation during AP, alleviate pancreatic inflammation, and help prevent multiple organ failure. For instance, liproxstatin-1 treatment attenuates lipid peroxidation in the kidneys and intestines of SAP rats, inhibits ferroptosis, and reduces damage to pancreatic, renal, and intestinal tissues.^23,24 Wedelolactone suppresses ferroptosis by inhibiting oxidative stress and lipid peroxidation while upregulating glutathione peroxidase 4 (GPX4) expression, thereby mitigating AP-associated lung injury.²⁵ Thus, targeting ferroptosis represents a promising therapeutic strategy for AP.

In this study, we demonstrate that inhibition or knockdown of SIRT2 suppresses ferroptosis, pancreatic inflammation, and tissue injury, whereas SIRT2 overexpression exacerbates these effects. These findings suggest a mechanistic link between SIRT2 and ferroptosis in the context of pancreatic inflammation and injury during AP. We identified the immediate early response 3 (IER3; also known as IEX-1), a member of the immediate early gene family, as a downstream target of SIRT2.26, 27, 28 Our findings indicate that IER3 modulates ferroptosis. Specifically, IER3 overexpression promotes ferroptosis, whereas its silencing or inhibition attenuates ferroptosis, pancreatic inflammation, and tissue damage in AP. SIRT2 upregulates IER3 expression through deacetylation, thereby promoting ferroptosis and exacerbating pancreatic injury and inflammatory responses. Clinical data reveal elevated serum levels of SIRT2 and IER3 in patients with AP, which positively correlate with inflammatory cytokines (interleukin [IL]1β, IL6, and tumor necrosis factor-α [TNF-α]) and disease severity. These results provide novel insights into the molecular pathogenesis of AP and suggest potential therapeutic targets.

Results

Inhibiting Sirtuin 2 Alleviates Pancreatic Injury, Inflammation, and Ferroptosis in Acute Pancreatitis

To investigate the role of SIRT2 in AP, rats were pretreated with the SIRT2 inhibitor AGK2 prior to AP induction with L-arginine (Figure 1A). Compared with the sham group, the AP group displayed pronounced pancreatic edema, necrosis, inflammatory cell infiltration, and hemorrhage (Figure 1B). Pancreatic injury scores (Figure 1C), as well as serum amylase (Figure 1D), lipase (Figure 1E), and inflammatory cytokines including IL1β, IL6, and TNF-α (Figure 1F–H), were markedly elevated in the AP group, thereby confirming successful model establishment. AGK2 pretreatment alleviated pancreatic injury (Figure 1B and C) and significantly reduced serum amylase, lipase, and inflammatory cytokine levels compared with the AP group (Figure 1D–H). Relative to the sham group, pancreatic glutathione (GSH) levels were decreased in the AP group (Figure 1I), whereas lipid peroxides (Figure 1J), ferrous iron (Figure 1K), and malondialdehyde (MDA) (Figure 1L) were elevated. Transmission electron microscopy analysis revealed ferroptosis-associated mitochondrial abnormalities in AP rats, characterized by mitochondrial shrinkage, outer membrane rupture, and reduced cristae density (Figure 1M). AGK2 pretreatment restored GSH levels, and reduced lipid peroxides, ferrous iron, and MDA (Figure 1I–L), and ameliorated mitochondrial damage (Figure 1M). These findings indicate that SIRT2 inhibition mitigates inflammation, attenuates pancreatic injury, and suppresses ferroptosis in AP.

Figure 1.

Inhibiting SIRT2 alleviates pancreatic injury, inflammation, and ferroptosis in AP. (A) Schematic diagram of AP and AGK2 + AP model rat experimental design. (B and C) Representative H&E-stained images and pathologic scores of pancreatic tissues from Sham, AP, and AGK2 + AP rats (n = 6 rats per group). (D–H) Serum levels of amylase, lipase, IL1β, IL6, and TNF-α in Sham, AP, and AGK2 + AP rats. (I–L) Pancreatic levels of GSH, lipid peroxides, ferrous iron, and MDA in Sham, AP, and AGK2 + AP rats. (M) Representative transmission electron microscopy images of pancreatic tissues from Sham, AP, and AGK2 + AP rats. (N and O) Representative immunofluorescence images and relative fluorescence intensity of SIRT2 colocalized with amylase in pancreatic tissues from Sham, AP, and AGK2 + AP rats. (P and Q) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in pancreatic tissues from Sham, AP, and AGK2 + AP rats. (R and S) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in pancreatic tissues from Sham, AP, and AGK2 + AP rats. (T and U) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in AR42J cells treated with phosphate-buffered saline (Con), caerulein (AP), and AGK2 + caerulein (AGK2 + AP) (n = 3 biologically independent samples per group). (V and W) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in AR42J cells from Con, AP, and AGK2 + AP groups. (X–AE) Representative images and quantification of ROS (DCFH-DA, green; mean green intensity per cell), Fe2+ (FeRhoNox-1, orange; mean orange intensity per field), the mitochondrial membrane potential (JC-1: red, aggregates; green, monomers; red/green ratio per cell), lipid peroxidation (BODIPY 581/591 C11, red: reduced; green: oxidized; green/red ratio per cell) levels in AR42J cells from Con, AP, and AGK2 + AP groups. Statistical analysis: 1-way analysis of variance with Tukey’s post hoc test was applied to panels (C–L, O, AB–AD and AE). Two-way analysis of variance with Tukey’s post hoc test was used for panels (Q–S and U–W). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Because AP is characterized by injury and inflammation in pancreatic acinar cells, we performed immunofluorescence colocalization of SIRT2 with amylase, an established acinar cell marker. SIRT2 expression was markedly elevated in acinar cells during AP, and AGK2 treatment effectively suppressed this upregulation (Figure 1N and O). Western blot analysis revealed elevated SIRT2 and reduced GPX4 and solute carrier family 7 member 11 (SLC7A11) expression in pancreatic tissues of AP rats, changes that were reversed by AGK2 treatment (Figure 1P and Q). Quantitative polymerase chain reaction (qPCR) analysis further confirmed that AGK2 reduced messenger RNA (mRNA) levels of SIRT2 and inflammatory cytokines (IL6, TNF-α), while enhancing GPX4 and SLC7A11 expression (Figure 1R and S).

In vitro, an AP model was established by treating AR42J pancreatic acinar cells with caerulein. Consistent with in vivo findings, AGK2 (10 μM) pretreatment suppressed SIRT2 and inflammatory cytokines upregulation while restoring GPX4 and SLC7A11 expression at both the protein and mRNA levels (Figure 1T–W, Figure 2). Furthermore, AGK2 reduced ROS (DCFH-DA assay), ferrous iron (FeRhoNox-1 assay), and lipid peroxidation (BODIPY C11 assay), and partially restored mitochondrial membrane potential (JC-1 assay) (Figure 1X–AE).

Figure 2.

Effects of AGK2 on cell viability and on the expression of SIRT2, IER3, GPX4, and SLC7A11 in AR42J pancreatic acinar cells. (A) Cell viability of AR42J cells treated with varying concentrations of AGK-2 (n = 3 biologically independent samples per group). (B and C) Western blot images and relative protein levels of SIRT2, IER3, GPX4, and SLC7A11 in AR42J cells from phosphate-buffered saline (Con) and AGK2 (n = 3 biologically independent samples per group). (D) mRNA expression levels of SIRT2, IER3, GPX4, and SLC7A11 in AR42J cells from Con and AGK2 groups. Statistical significance was determined using 1-way analysis of variance followed by Tukey’s post hoc test for (A), Two-way analysis of variance with Tukey’s post hoc test for (C) and (D). Data are presented as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Collectively, these results demonstrate that SIRT2 inhibition alleviates pancreatic injury, mitigates inflammation, and suppresses ferroptosis in AP. Given that inhibition of ferroptosis has been shown to mitigate pancreatic damage and inflammation, we speculate that SIRT2 exacerbates pancreatic injury and inflammation by modulating ferroptosis in acinar cells.

Inhibition of Ferroptosis and/or Sirtuin 2 Provides Protective Effects Against Acute Pancreatitis

To further investigate the regulatory relationship between SIRT2 and ferroptosis, rats were treated with AGK2 and/or the ferroptosis inhibitor ferrostatin-1 (Fer-1) prior to AP induction (Figure 3A). Compared with the AP group, treatment with either AGK2 or Fer-1 alone alleviated pancreatic injury (Figure 3B and C), reduced serum amylase and lipase levels (Figure 3D and E), increased pancreatic GSH content (Figure 3F), and decreased lipid peroxides (Figure 3G), ferrous iron (Figure 3H), MDA (Figure 3I), and mitochondrial abnormalities such as swelling, cristae loss, and outer membrane rupture (Figure 3J). Notably, combined administration of AGK2 and Fer-1 produced more pronounced effects than either monotherapy, further reducing pancreatic damage, lowering serum amylase and lipase levels, restoring GSH, and decreasing lipid peroxides, ferrous iron, MDA, and mitochondrial defects (Figure 3B–J). These findings suggest that simultaneous inhibition of SIRT2 and ferroptosis exerts superior therapeutic efficacy in AP. Western blot and qPCR analyses revealed that both AGK2 and Fer-1 individually downregulated SIRT2 and inflammatory cytokines (IL6 and TNF-α), while upregulating GPX4 and SLC7A11 expression (Figure 3K–N). Importantly, the combination treatment was more effective than either agent alone in suppressing SIRT2 and cytokines expression and in enhancing GPX4 and SLC7A11 levels (Figure 3K–N).

Figure 3.

Inhibition of ferroptosis and/or SIRT2 provides protective effects against AP. (A) Schematic diagram of AP, AGK2 + AP, Fer-1 + AP and AGK2 + Fer-1 + AP model rat experimental design. (B and C) Representative H&E-stained images and pathologic scores of pancreatic tissues from AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP groups (n = 3 rats per group). (D and E) Serum levels of amylase and lipase in AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP rats. (F–I) Pancreatic levels of GSH, lipid peroxides, ferrous iron, and MDA in AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP rats. (J) Representative transmission electron microscopy images of pancreatic tissues from AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP rats. (K and L) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in pancreatic tissues from AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP rats. (M and N) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in pancreatic tissues from AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP rats. (O) Cell viability of AR42J cells treated with varying concentrations of Fer-1 (n = 3 biologically independent samples per group). (P and Q) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in AR42J cells treated with caerulein (AP), AGK2 + caerulein (AGK2 + AP), Fer-1 + caerulein (Fer-1 + AP), or AGK2 + Fer-1 + caerulein (AGK2 + Fer-1 + AP) (n = 3 biologically independent samples per group). (R and S) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in AR42J cells from AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP groups. (T–AA) Representative images and quantification of ROS (DCFH-DA, green; mean green intensity per cell), Fe²⁺ (FeRhoNox-1, orange; mean orange intensity per field), the mitochondrial membrane potential (JC-1: red, aggregates; green, monomers; red/green ratio per cell), lipid peroxidation (BODIPY 581/591 C11, red: reduced; green: oxidized; green/red ratio per cell) levels in AR42J cells from AP, AGK2 + AP, Fer-1 + AP, and AGK2 + Fer-1 + AP groups. Statistical analysis: one-way analysis of variance with Tukey’s post hoc test was applied to panels (C–I, O, X–Z and AA). Two-way analysis of variance with Tukey’s post hoc test was used for panels (L–N and Q–S). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Consistent with the in vivo results, combined treatment with AGK2 (10 μM) and Fer-1 (5 μM) further suppressed SIRT2 upregulation, reduced IL6 and TNF-α expression, and restored GPX4 and SLC7A11 levels in the in vitro AP model (Figure 3O–S). Moreover, the combination more effectively reduced intracellular ROS and iron (II) (Fe²⁺) accumulation, attenuated mitochondrial membrane potential decline, and inhibited lipid peroxidation (Figure 3T–AA). Collectively, these findings indicate that inhibition of either SIRT2 or ferroptosis suppresses SIRT2 expression, prevents ferroptosis, and alleviates pancreatic tissue damage and inflammation, thereby conferring protection against AP. Simultaneous inhibition of SIRT2 and ferroptosis confers a synergistic protective effect.

Sirtuin 2 Aggravates Acute Pancreatitis–Induced Pancreatic Injury, Inflammation, and Ferroptosis

To further delineate the role of SIRT2 in AP, we achieved SIRT2 knockdown using adeno-associated virus (AAV)-short hairpin (sh)-SIRT2 and overexpression using AAV-SIRT2. The efficiency of AAV-sh-SIRT2 and AAV-SIRT2 was detected by qPCR and Western blot (Figure 4). Compared with the AP and AAV-sh-NC+AP groups, the AAV-sh-SIRT2+AP group exhibited markedly attenuated pancreatic injury (Figure 5A and B), reduced serum amylase (Figure 5C) and lipase levels (Figure 5D), elevated pancreatic GSH (Figure 5E), and decreased lipid peroxides (Figure 5F), Fe²⁺ (Figure 5G), and MDA (Figure 5H), accompanied by ameliorated mitochondrial swelling, cristae loss, and outer membrane rupture (Figure 5I). Conversely, AAV-SIRT2+AP rats exhibited exacerbated pancreatic injury (Figure 5A and B), elevated serum amylase (Figure 5C) and lipase levels (Figure 5D), reduced GSH (Figure 5E), increased lipid peroxides (Figure 5F), Fe²⁺ (Figure 5G), and MDA (Figure 5H), and aggravated mitochondrial damage (Figure 5I). Western blot and qPCR analyses demonstrated that SIRT2 knockdown via AAV-sh-SIRT2 suppressed the expression of SIRT2, IL6, and TNF-α, while restoring GPX4 and SLC7A11 expression in the AP rat model (Figure 5J–M). In contrast, opposite effects were observed with SIRT2 overexpression mediated by AAV-SIRT2 (Figure 5N–Q).

Figure 4.

Validation of AAV-sh-SIRT2 and AAV-SIRT2 efficacy. (A) qPCR results for the efficacy of AAV-sh-SIRT2 (n = 3 rats per group). (B and C) Representative H&E-stained images and pathologic scores of pancreatic tissues from Sham, AAV-sh-NC, AAV-sh-SIRT2, AAV-Con, and AAV-SIRT2 groups (n = 3 rats per group). (D and E) Western blot images and relative protein levels of SIRT2, IER3, GPX4, and SLC7A11 in pancreatic tissues from Sham, AAV-sh-NC, AAV-sh-SIRT2 rats. (F) mRNA expression levels of SIRT2, IER3, GPX4, and SLC7A11 in pancreatic tissues from Sham, AAV-sh-NC, AAV-sh-SIRT2 rats. (G and H) Western blot images and relative protein levels of SIRT2, IER3, GPX4, and SLC7A11 in pancreatic tissues from Sham, AAV-Con, and AAV-SIRT2 rats. (I) mRNA expression levels of SIRT2, IER3, GPX4, and SLC7A11 in pancreatic tissues from Sham, AAV-Con, and AAV-SIRT2 rats. Statistical analysis: 1-way analysis of variance with Tukey’s post hoc test was applied to panels (A and C). Two-way analysis of variance with Tukey’s post hoc test was used for panels (E, F, H and I). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Figure 5.

SIRT2 aggravates AP-induced pancreatic injury, inflammation, and ferroptosis. (A and B) Representative H&E-stained images and pathologic scores of pancreatic tissues from AP, AAV-sh-SIRT2 + AP, AAV-sh-NC + AP, AAV-SIRT2 + AP, and AAV-Con + AP groups (n = 3 rats per group). (C and D) Serum amylase and lipase levels in AP, AAV-sh-SIRT2 + AP, AAV-sh-NC + AP, AAV-SIRT2 + AP, and AAV-Con + AP rats. (E–H) Levels of GSH, lipid peroxides, ferrous iron, and MDA in pancreatic tissues from AP, AAV-sh-SIRT2 + AP, AAV-sh-NC + AP, AAV-SIRT2 + AP, and AAV-Con + AP rats. (I) Representative transmission electron microscopy images of pancreatic tissues from AP, AAV-sh-SIRT2 + AP, AAV-sh-NC + AP, AAV-SIRT2 + AP, and AAV-Con + AP rats. (J and K) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in pancreatic tissues from AP, AAV-sh-SIRT2 + AP, and AAV-sh-NC + AP rats. (L and M) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in pancreatic tissues from AP, AAV-sh-SIRT2 + AP, and AAV-sh-NC + AP rats. (N and O) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-Con + AP rats. (P and Q) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-Con + AP rats. (R and S) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in AR42J cells treated with phosphate-buffered saline (Con), caerulein (AP), si-NC + caerulein (si-NC + AP), or si-SIRT2 + caerulein (si-SIRT2 + AP) (n = 3 biologically independent samples per group). (T and U) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in AR42J cells from Con, AP, si-NC + AP, and si-SIRT2 + AP groups. (V and W) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in AR42J cells treated with phosphate-buffered saline (Con), caerulein (AP), pcDNA3.1 + caerulein (pcDNA3.1 + AP), or pcDNA3.1-SIRT2 + caerulein (pcDNA3.1-SIRT2 + AP). (X and Y) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in AR42J cells from Con, AP, pcDNA3.1 + AP, and pcDNA3.1-SIRT2 + AP groups. (Z–AG) Representative images and quantification of ROS (DCFH-DA, green; mean green intensity per cell), Fe2+ (FeRhoNox-1, orange; mean orange intensity per field), the mitochondrial membrane potential (JC-1: red, aggregates; green, monomers; red/green ratio per cell), lipid peroxidation (BODIPY 581/591 C11, red: reduced; green: oxidized; green/red ratio per cell) levels in AR42J cells from Con, AP, si-NC + AP, si-SIRT2 + AP, pcDNA3.1-SIRT2 + AP, and pcDNA3.1 + AP groups. Statistical analysis: 1-way analysis of variance with Tukey’s post hoc test was applied to panels (B–H and AD–AG). Two-way analysis of variance with Tukey’s post hoc test was used for panels (K–M, O–Q, S–U and W–Y). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Subsequently, SIRT2 was silenced or overexpressed in pancreatic acinar cells prior to establishing the in vitro AP model. Western blot and qPCR analyses indicated that SIRT2 silencing via small interfering (si)-SIRT2 inhibited the upregulation of SIRT2, IL6, and TNF-α, while enhancing SLC7A11 and GPX4 expression (Figure 5R–U, Figure 6A–C). Conversely, SIRT2 overexpression elevated the expression of SIRT2, IL6, and TNF-α, while reducing SLC7A11 and GPX4 expression (Figure 5V–Y, Figure 6D–F). SIRT2 knockdown also suppressed ROS and Fe²⁺ accumulation, prevented mitochondrial membrane potential loss, and reduced lipid peroxidation (Figure 5Z–AG). Conversely, SIRT2 overexpression promoted ROS and Fe²⁺ accumulation, decreased mitochondrial membrane potential, and enhanced lipid peroxidation (Figure 5Z–AG). In summary, these findings indicate that SIRT2 upregulation exacerbates pancreatic injury, inflammation, and ferroptosis in AP, whereas SIRT2 inhibition confers protective effects.

Figure 6.

Effects of SIRT2 knockdown or overexpression on the expression of SIRT2, IER3, GPX4, and SLC7A11 in AR42J pancreatic acinar cells without AP induction. (A and B) Western blot images and relative protein levels of SIRT2, IER3, GPX4, and SLC7A11 in AR42J cells treated with phosphate-buffered saline (Con), si-NC, and si-SIRT2 (n = 3 biologically independent samples per group). (C) mRNA expression levels of SIRT2, IER3, GPX4, and SLC7A11 in AR42J cells from Con, si-NC, and si-SIRT2 groups. (D and E) Western blot images and relative protein levels of SIRT2, IER3, GPX4, and SLC7A11 in AR42J cells treated with phosphate-buffered saline (Con), pcDNA3.1, and pcDNA3.1-SIRT2 groups. (F) mRNA expression levels of SIRT2, IER3, GPX4, and SLC7A11 in AR42J cells from Con, pcDNA3.1, and pcDNA3.1-SIRT2 groups. Statistical significance was determined using 2-way analysis of variance with Tukey’s post hoc test. Data are presented as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

AGK2 Reverses the Adverse Effects of Sirtuin 2 Overexpression in Acute Pancreatitis

To further substantiate the role of SIRT2 in AP, we generated a rat model with AAV-SIRT2–mediated SIRT2 overexpression and pretreated the animals with AGK2. AP was subsequently induced with L-arginine. Compared with the AAV-SIRT2+AP group, the AAV-SIRT2+AGK2+AP group exhibited attenuated pancreatic injury (Figure 7A and B); lower serum amylase (Figure 7C) and lipase (Figure 7D); higher pancreatic GSH (Figure 7E); reduced lipid peroxides (Figure 7F), Fe²⁺ (Figure 7G), and MDA (Figure 7H); and ameliorated mitochondrial swelling, cristae loss, and outer membrane rupture (Figure 7I). Western blot and qPCR further indicated that, relative to the AAV-SIRT2+AP group, the AAV-SIRT2+AGK2+AP group exhibited lower SIRT2, IL6, and TNF-α expression and higher GPX4 and SLC7A11 expression (Figure 7J–M).

Figure 7.

AGK2 reverses the adverse effects of SIRT2 overexpression in AP. (A and B) Representative H&E-stained images and pathologic scores of pancreatic tissues from AP, AGK2 + AP, AAV-SIRT2 + AP, and AAV-SIRT2 + AGK2 + AP groups (n = 3 rats per group). (C and D) Serum amylase and lipase levels in AP, AGK2 + AP, AAV-SIRT2 + AP, and AAV-SIRT2 + AGK2 + AP rats. (E–H) Levels of GSH, lipid peroxides, ferrous iron, and MDA in pancreatic tissues from AP, AGK2 + AP, AAV-SIRT2 + AP, and AAV-SIRT2 + AGK2 + AP rats. (I) Representative transmission electron microscopy images of pancreatic tissues from AP, AGK2 + AP, AAV-SIRT2 + AP, and AAV-SIRT2 + AGK2 + AP rats. (J and K) Western blot images and relative protein levels of SIRT2, GPX4, and SLC7A11 in pancreatic tissues from AP, AGK2 + AP, AAV-SIRT2 + AP, and AAV-SIRT2 + AGK2 + AP rats. (L and M) mRNA expression levels of SIRT2, GPX4, SLC7A11, IL6, and TNF-α in pancreatic tissues from AP, AGK2 + AP, AAV-SIRT2 + AP, and AAV-SIRT2 + AGK2 + AP rats. (N–U) Representative images and quantification of ROS (DCFH-DA, green; mean green intensity per cell), Fe2+ (FeRhoNox-1, orange; mean orange intensity per field), he mitochondrial membrane potential (JC-1: red, aggregates; green, monomers; red/green ratio per cell), lipid peroxidation (BODIPY 581/591 C11, red: reduced; green: oxidized; green/red ratio per cell) levels in AR42J cells from AP, AGK2 + AP, AGK2 + pcDNA3.1-SIRT2 + AP, pcDNA3.1-SIRT2 + AP, AGK2 + pcDNA3.1 + AP, and pcDNA3.1 + AP groups (n = 3 biologically independent samples per group). Statistical analysis: 1-way analysis of variance followed by Tukey’s post hoc test was applied to panels (B–H and R–U). Two-way analysis of variance followed by Tukey’s post hoc test was used for panels (K–M). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

In the in vitro AP model, AGK2 pretreatment reduced SIRT2-overexpression–induced increases in ROS, Fe²⁺, and lipid peroxidation and partially restored mitochondrial membrane potential (Figure 7N–U). Taken together, these results demonstrate that AGK2 reverses the detrimental effects of SIRT2 overexpression by attenuating pancreatic injury, dampening inflammation, and suppressing ferroptosis in AP.

Identification of Downstream Target Genes of Sirtuin 2 Involved in Acute Pancreatitis

To identify target genes regulated by SIRT2 during AP, RNA sequencing was conducted on pancreatic tissues from Sham, AP, and AGK2+AP rats. Differentially expressed inflammation-related genes in the AP vs Sham group were compared with those in the AGK2+AP vs AP group. Twenty inflammation-related genes were significantly upregulated during AP and markedly downregulated following AGK2 treatment (Figure 8A and B). Among these candidate SIRT2-regulated genes, the immediate early response protein IER3 was particularly noteworthy (Figure 8A and B). A previous study reported that IER3 expression was elevated by approximately fourfold in acinar clusters during experimental AP induction in KrasG12D mice. IER3 upregulation in acinar cells during pancreatitis enhanced the oncogenic effects of KrasG12D.²⁹ Therefore, IER3 was selected for further investigation. Western blot and qPCR revealed that IER3 protein and mRNA levels were significantly upregulated in pancreatic tissues of AP rats, whereas AGK2 treatment markedly reduced its expression (Figure 8C and D). To further investigate the regulatory relationship between SIRT2 and IER3, immunofluorescence colocalization analysis was conducted. The results showed that SIRT2 and IER3 were colocalized and highly expressed during AP, whereas AGK2 pretreatment reduced both their colocalization and expression (Figure 8E and F).

Figure 8.

Identification of downstream target genes regulated by SIRT2 in AP. (A) Overlapping inflammatory-related genes upregulated in AP vs Sham and downregulated in AGK2 + AP vs AP, identified by RNA sequencing (n = 3 rats per group). (B) Heatmap of 20 inflammation-related genes potentially regulated by SIRT2 in Sham, AP, and AGK2 + AP groups (n = 3 rats per group). (C and D) Western blot images and relative protein levels of IER3 in pancreatic tissues from Sham, AP, and AGK2 + AP groups (n = 3 rats per group). (E and F) Representative immunofluorescence images and relative fluorescence intensity of SIRT2 colocalized with IER3 in pancreatic tissues from Sham, AP, and AGK2 + AP rats. (G and H) Western blot images and relative protein levels of IER3 in AR42J cells from Con, AP, and AGK2 + AP groups (n = 3 biologically independent samples per group). (I and J) Western blot images and relative protein levels of IER3 in pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-Con + AP rats (n = 3 rats per group). (K and L) Western blot images and relative protein levels of IER3 in AR42J cells from Con, AP, pcDNA3.1 + AP, and pcDNA3.1-SIRT2 + AP groups (n = 3 biologically independent samples per group). (M and N) Western blot images and relative protein levels of IER3 in pancreatic tissues from AP, AAV-sh-SIRT2 + AP, and AAV-sh-NC + AP rats (n = 3 rats per group). (O and P) Western blot images and relative protein levels of IER3 in AR42J cells from Con, AP, si-NC + AP, and si-SIRT2 + AP groups (n = 3 biologically independent samples per group). All statistical analyses were performed using 1-way analysis of variance followed by Tukey’s post hoc test. Data are presented as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Subsequent in vitro experiments confirmed that IER3 expression was elevated in the AP cell model, and this upregulation was suppressed by AGK2 pretreatment (Figure 8G and H). Furthermore, SIRT2 overexpression, achieved via AAV-SIRT2 in vivo or pcDNA3.1-SIRT2 transfection in vitro, enhanced IER3 expression (Figure 8I–L). Conversely, SIRT2 downregulation, induced by AAV-sh-SIRT2 in vivo or si-SIRT2 in vitro, reduced IER3 expression during AP (Figure 8M–P). Collectively, these findings suggest that IER3 is a downstream target of SIRT2 in AP.

Inhibition of Immediate Early Response 3 Mitigates Acute Pancreatitis–Induced Pancreatic Injury, Inflammation, and Ferroptosis

To determine the functional role of IER3 in AP, rats were pretreated with the IER3 inhibitor 1α,25-dihydroxyvitamin D3 (1α,25(OH)₂D₃) for 1, 3, 7, and 14 days prior to AP induction. IER3 suppression was strongest at day 14 (Figure 9), at which point pancreatic histology, serum amylase, lipase, and inflammatory cytokines also showed the greatest improvement. A 14-day time point was then chosen for subsequent experiments (Figure 10A). Treatment with 1α,25(OH)₂D₃ significantly alleviated pancreatic injury (Figure 10B and C), reduced serum amylase and lipase levels (Figure 10D and E), restored GSH levels, decreased lipid peroxides, ferrous iron, and MDA (Figure 10F–I), and ameliorated mitochondrial structural abnormalities (Figure 10J). Western blot and qPCR further confirmed that 1α,25(OH)₂D₃ decreased IER3, IL6, and TNF-α expression while increasing GPX4 and SLC7A11 expression during AP (Figure 10K–N).

Figure 9.

Efficacy of 1α,25(OH)₂D₃ pretreatment for 1, 3, 7, and 14 days in IER3-targeted therapy for AP. (A and B) Representative H&E-stained images and pathologic scores of pancreatic tissues from 1, 3, 7, and 14 days (D) pretreatment of 1α,25(OH)2D₃ rats (n = 3 rats per group). (C–G) Serum levels of amylase, lipase, IL1β, IL6, and TNF-α from 1, 3, 7, and 14 days pretreatment of 1α,25(OH)2D₃ rats. (H–J) Western blot images, relative protein, and mRNA levels of IER3 from 1, 3, 7, and 14 days pretreatment of 1α,25(OH)2D₃ rats. Statistical significance was determined using 1-way analysis of variance with Tukey’s post hoc test. Data are presented as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Figure 10.

Inhibition of IER3 mitigates AP-induced pancreatic injury, inflammation, and ferroptosis. (A) Schematic diagram of AP and lα,25(OH)2D3 + AP model rat experimental design. (B and C) Representative H&E-stained images and pathologic scores of pancreatic tissues from AP and 1α,25(OH)₂D₃ + AP groups (n = 3 rats per group). (D and E) Serum amylase and lipase levels in AP and 1α,25(OH)₂D₃ + AP rats. (F–I) Levels of GSH, lipid peroxides, ferrous iron, and MDA in pancreatic tissues from AP and 1α,25(OH)₂D₃ + AP rats. (J) Representative transmission electron microscopy images of pancreatic tissues from AP and 1α,25(OH)₂D₃ + AP rats. (K and L) Western blot images and relative protein levels of IER3, GPX4, and SLC7A11 in pancreatic tissues from AP and 1α,25(OH)₂D₃ + AP rats. (M and N) mRNA expression levels of IER3, GPX4, SLC7A11, IL6, and TNF-α in pancreatic tissues from AP and 1α,25(OH)₂D₃ + AP rats. (O) qPCR results for the efficacy of si-IER3 (n = 3 biologically independent samples per group). (P and Q) Western blot images and relative protein levels of IER3, GPX4, and SLC7A11 in AR42J cells treated with phosphate-buffered saline (Con), caerulein (AP), si-NC + caerulein (si-NC + AP), or si-IER3 + caerulein (si-IER3 + AP) (n = 3 biologically independent samples per group). (R and S) mRNA expression levels of IER3, GPX4, SLC7A11, IL6, and TNF-α in AR42J cells from Con, AP, si-NC + AP, and si-IER3 + AP groups. (T and U) Western blot images and relative protein levels of IER3, GPX4, and SLC7A11 in AR42J cells treated with phosphate-buffered saline (Con), caerulein (AP), pCMV-HA + caerulein (pCMV-HA + AP), or pCMV-HA-IER3 + caerulein (pCMV-HA-IER3 + AP). (V and W) mRNA expression levels of IER3, GPX4, SLC7A11, IL6, and TNF-α in AR42J cells from Con, AP, pCMV-HA + AP, and pCMV-HA-IER3 + AP groups. (X–AE) Representative images and quantification of ROS (DCFH-DA, green; mean green intensity per cell), Fe2+ (FeRhoNox-1, orange; mean orange intensity per field), the mitochondrial membrane potential (JC-1: red, aggregates; green, monomers; red/green ratio per cell), lipid peroxidation (BODIPY 581/591 C11, red: reduced; green: oxidized; green/red ratio per cell) levels in AR42J cells from Con, AP, si-IER3 + AP, si-NC + AP, pCMV-HA-IER3 + AP, and pCMV-HA + AP groups. Statistical analysis: Student t test was was performed for panels (C–I). One-way analysis of variance followed by Tukey’s post hoc test was applied to panels (O and AB–AE). Two-way analysis of variance followed by Tukey’s post hoc test was used for panels (L–N, Q–S and U–W). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

In vitro, IER3 was either overexpressed or silenced in pancreatic acinar cells using pCMV-HA-IER3 or si-IER3, respectively, prior to caerulein-induced AP modeling. The efficiency of si-IER3 was determined by qPCR (Figure 10O). Western blot and qPCR demonstrated that si-IER3 reduced IER3, IL6, and TNF-α expression while increasing GPX4 and SLC7A11 levels (Figure 10P–S). Conversely, IER3 overexpression elevated IER3, IL6, and TNF-α expression and suppressed GPX4 and SLC7A11 expression (Figure 10T–W). In addition, IER3 silencing reduced intracellular accumulation of ROS, Fe²⁺, and lipid peroxidation, while restoring mitochondrial membrane potential (Figure 10X–AE). By contrast, IER3 overexpression promoted ROS, Fe²⁺, and lipid peroxidation accumulation and accelerated mitochondrial membrane potential loss (Figure 10X–AE). Collectively, these findings demonstrate that IER3 upregulation drives pancreatic injury, inflammation, and ferroptosis during AP, whereas IER3 inhibition or silencing effectively attenuates these pathologic processes.

Sirtuin 2 Promotes Ferroptosis-Induced Pancreatic Injury and Inflammation via Regulating Immediate Early Response 3

To interrogate the regulatory interplay between SIRT2 and IER3, we established an AP rat model featuring AAV-mediated SIRT2 overexpression and administered the IER3 inhibitor 1α,25(OH)₂D₃ as pretreatment. Pretreatment with 1α,25(OH)₂D₃ markedly ameliorated SIRT2-overexpression–induced pancreatic injury (Figure 11A and B); lowered serum amylase and lipase (Figure 11C and D); restored pancreatic GSH while reducing lipid peroxides, Fe²⁺, and MDA (Figure 11E–H); and mitigated mitochondrial abnormalities (Figure 11I). Western blot and qPCR demonstrated that 1α,25(OH)₂D₃ suppressed SIRT2-overexpression–driven upregulation of IER3, IL6, and TNF-α, while concomitantly increasing SLC7A11 and GPX4 expression (Figure 11J–M). In in vitro experiments, pancreatic acinar cells were cotransfected with a SIRT2 overexpression plasmid plus si-IER3, or with si-SIRT2 plus an IER3 overexpression plasmid, followed by caerulein treatment to model AP. Western blot and qPCR showed that IER3 silencing dampened SIRT2-overexpression–induced increases in IER3, IL6, and TNF-α, while upregulating SLC7A11 and GPX4 (Figure 11N–Q). Conversely, IER3 overexpression counteracted the effects of SIRT2 silencing by reversing SLC7A11 and GPX4 upregulation and further augmenting IL6 and TNF-α expression (Figure 11R–U). Moreover, IER3 silencing curtailed SIRT2-overexpression–driven accumulation of ROS, Fe²⁺, and lipid peroxidation and restored mitochondrial membrane potential, whereas IER3 overexpression abrogated the protective effects of SIRT2 silencing, reinstating ROS and Fe²⁺ accumulation, lipid peroxidation, and mitochondrial membrane potential loss (Figure 11V–AC).

Figure 11.

SIRT2 promotes ferroptosis-induced pancreatic injury and inflammation via IER3 regulation. (A and B) Representative H&E-stained images and pathologic scores of pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-SIRT2 + lα,25(OH)2D3 + AP groups (n = 3 rats per group). (C and D) Serum amylase and lipase levels in AP, AAV-SIRT2 + AP, and AAV-SIRT2 + lα,25(OH)2D3 + AP rats. (E–H) Levels of GSH, lipid peroxides, ferrous iron, and MDA in pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-SIRT2 + lα,25(OH)2D3 + AP rats. (I) Representative transmission electron microscopy images of pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-SIRT2 + lα,25(OH)2D3 + AP rats. (J and K) Western blot images and relative protein levels of IER3, GPX4, and SLC7All in pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-SIRT2 +lα,25(OH)2D3 + AP rats. (L and M) mRNA expression levels of IER3, GPX4, SLC7All, IL6, and TNF-α in pancreatic tissues from AP, AAV-SIRT2 + AP, and AAV-SIRT2 + lα,25(OH)2D3 + AP rats. (N and O) Western blot images and relative protein levels of IER3, GPX4, and SLC7All in AR42J cells treated with caerulein (AP), si-SIRT2 + caerulein (si-SIRT2 + AP), si-SIRT2 + pCMV-HA-IER3 + caerulein (si-SIRT2 + pCMV-HA-IER3 + AP), or si-SIRT2 + pCMV-HA + caerulein (si-SIRT2 + pCMV-HA + AP) (n = 3 biologically independent samples per group). (P and Q) mRNA expression levels of IER3, GPX4, SLC7All, IL6, and TNF-α in AR42J cells from AP, si-SIRT2 + AP, si-SIRT2 + pCMV-HA-IER3 + AP, and si-SIRT2 + pCMV-HA + AP groups. (R and S) Western blot images and relative protein levels of IER3, GPX4, and SLC7All in AR42J cells treated with caerulein (AP), pcDNA3.l-SIRT2 + caerulein (pcDNA3.l-SIRT2 + AP), pcDNA3.l-SIRT2 + si-IER3 + caerulein (pcDNA3.1-SIRT2 + si-IER3 + AP), or pcDNA3.1-SIRT2 + si-NC + caerulein (pcDNA3.1-SIRT2 + si-NC + AP). (T and U) mRNA expression levels of IER3, GPX4, SLC7A11, IL6, and TNF-α in AR42J cells from AP, pcDNA3.1-SIRT2 + AP, pcDNA3.1-SIRT2 + si-IER3 + AP, and pcDNA3.1-SIRT2 + si-NC + AP groups. (V–AC) Representative images and quantification of ROS (DCFH-DA, green; mean green intensity per cell), Fe2+ (FeRhoNox-1, orange; mean orange intensity per field), the mitochondrial membrane potential (JC-1: red, aggregates; green, monomers; red/green ratio per cell), lipid peroxidation (BODIPY 581/591 C11, red: reduced; green: oxidized; green/red ratio per cell) levels AR42J cells from si-SIRT2 + pCMV-HA-IER3 + AP, si-SIRT2 + pCMV-HA + AP, pcDNA3.1-SIRT2 + si-IER3 + AP, and pcDNA3.1-SIRT2 + si-NC + AP groups. Statistical analysis: 1-way analysis of variance followed by Tukey’s post hoc test was applied to panels (B–H, Z and AA–AC). Two-way analysis of variance followed by Tukey’s post hoc test was used for panels (K–M, O–Q and S–U). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Taken together, these findings indicate that IER3 inhibition—either pharmacologically with 1α,25(OH)₂D₃ or genetically via siRNA—offsets the deleterious consequences of SIRT2 overexpression on pancreatic injury, inflammation, and ferroptosis in AP. Thus, SIRT2 exacerbates pancreatic injury, inflammation, and ferroptosis, at least in part through IER3-dependent mechanisms.

Sirtuin 2 Enhances Immediate Early Response 3 Expression via Deacetylation

To elucidate the mechanism through which SIRT2 regulates IER3 expression, co-immunoprecipitation (Co-IP) assays were conducted. Plasmids encoding Flag-tagged SIRT2 and HA-tagged IER3 were transfected into pancreatic acinar cells. Co-IP with antibodies against Flag, HA, and lysine acetylation revealed a physical interaction between SIRT2 and IER3 in pancreatic acinar cells (Figure 12A and B) and confirmed that IER3 was acetylated in acinar cells (Figure 12C). Moreover, the interaction between SIRT2 and IER3 was enhanced during AP, whereas the acetylation of IER3 was reduced during AP. These observations led us to hypothesize that during AP, SIRT2 regulates IER3 expression via deacetylation. To further interrogate this mechanism, pancreatic acinar cells were either pretreated with AGK2 or transfected with a SIRT2 overexpression plasmid, followed by Co-IP using antibodies against SIRT2. The results demonstrated that SIRT2 overexpression upregulated IER3 expression but decreased IER3 acetylation, whereas AGK2 treatment downregulated IER3 expression but enhanced IER3 acetylation (Figure 12D–F), and these effects were enhanced during AP. Collectively, these findings indicate that SIRT2 at least partially regulates IER3 expression through deacetylation during AP.

Figure 12.

SIRT2 enhances IER3 expression via deacetylation, and IER3 inhibits the transcriptional activation of SLC7A11. (A) Co-IP using an anti-Flag antibody after cotransfection of Flag-SIRT2 and HA-IER3 plasmids into AR42J cells treated with or without caerulein (n = 3 biologically independent samples per group). (B) Co-IP using an anti-HA antibody after cotransfection of Flag-SIRT2 and HA-IER3 plasmids into AR42J cells treated with or without caerulein. (C) Co-IP using an anti-lysine acetylation antibody after transfection of HA-IER3 plasmids into AR42J cells treated with or without caerulein. (D) Co-IP using an anti-SIRT2 antibody after treating AR42J cells with PBS, AGK2, caerulein, AGK2 + caerulein. (E) Co-IP using an anti-SIRT2 antibody after transfection with pcDNA3.1 or pcDNA3.1-SIRT2 in AR42J cells. (F) Co-IP using an anti-SIRT2 antibody after transfection with pcDNA3.1-SIRT2 in AR42J cells treated with or without caerulein. (G and H) Dual-luciferase reporter assay evaluating IER3 regulation of SLC7A11 promoter activity. (I) qPCR results for the efficacy of si-SLC7A11 (n = 3 biologically independent samples per group). (J and K) Western blot images and relative protein levels of SLC7A11 in AR42J cells treated with si-NC, si-IER3, si-IER3 + si-NC, si-IER3 + si-SLC7A11 (n = 3 biologically independent samples per group). Statistical analysis: 2-way analysis of variance followed by Tukey’s post hoc test was used for panels (A–H). One-way analysis of variance followed by Tukey’s post hoc test was applied to panels (I) and (K). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Immediate Early Response 3 Negatively Regulates Solute Carrier Family 7 Member 11 Expression

To investigate the regulatory function of IER3 in ferroptosis during AP, a dual-luciferase reporter assay was performed. As shown in Figure 12G and H, IER3 overexpression suppressed SLC7A11 promoter activity, whereas IER3 silencing augmented it. Furthermore, si-SLC7A11 eliminated the upregulation effect of si-IER3 on SLC7A11 (Figure 12I–K). These findings demonstrate that IER3 acts as a negative regulator of SLC7A11 expression.

Sirtuin 2 and Immediate Early Response 3 Levels Are Elevated in Patients With Acute Pancreatitis and Correlate With Disease Severity

To assess alterations in SIRT2 and IER3 levels in patients with clinical AP and examine their correlation with clinical indicators, blood samples were collected from affected individuals. Enzyme-linked immunosorbent assay revealed that serum concentrations of SIRT2, IER3, IL1β, IL6, and TNF-α were markedly elevated in patients with AP (Figure 13A–E). Correlation analyses were performed between serum SIRT2 and IER3 concentrations and clinical parameters, including Sequential Organ Failure Assessment (SOFA) scores and serum IL1β, IL6, and TNF-α. The analysis demonstrated that elevated serum SIRT2 was associated with increased IER3 concentrations, higher SOFA scores, and elevated IL1β, IL6, and TNF-α levels (Figure 13F–J). Similarly, increased serum IER3 was correlated with higher SOFA scores and elevated IL1β, IL6, and TNF-α (Figure 13K–N). Both SIRT2 and IER3 in patients with AP were positively correlated with SOFA scores and proinflammatory cytokines. Collectively, these findings demonstrate that serum SIRT2 and IER3 are elevated in patients with AP and are positively associated with both disease severity and systemic inflammatory responses.

Figure 13.

SIRT2 and IER3 levels are elevated in patients with AP and correlate with disease severity and inflammatory cytokines. (A–E) Serum levels of SIRT2, IER3, IL1β, IL6, and TNF-α in healthy individuals (n = 10) and patients with AP (n = 20). (F–J) Correlation analysis between serum SIRT2 levels and IER3, SOFA scores, IL1β, IL6, and TNF-α levels. (K–N) Correlation analysis between serum IER3 levels and SOFA scores, IL1β, IL6, and TNF-α levels. Statistical analysis: Student t test was performed for panels (A–E). The simple linear regression analysis was used for panels (F–N). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P. < 0.001; ∗∗∗∗P < .0001.

Discussion

The global incidence of AP has steadily risen, and the mortality rate of SAP remains alarmingly high.^3,7,30 At present, clinical management of AP predominantly depends on supportive measures, including fluid resuscitation and nutritional support.31, 32, 33 To date, no specific therapeutic strategies directly targeting the underlying pathogenesis of AP have been established. Therefore, elucidating the molecular mechanisms of AP and developing targeted therapeutic strategies are critical for improving clinical outcomes and patient prognosis.

Accumulating evidence indicates that ferroptosis is intricately linked to inflammatory responses across multiple diseases, including AP. Inhibition of ferroptosis has been shown to markedly attenuate tissue injury and inflammatory responses in AP.23, 24, 25 SIRT2 has been implicated in the regulation of inflammation, oxidative stress, and ROS production in diverse pathological contexts, including LPS-induced macrophage activation, renal inflammation, neuroinflammation, and pressure overload–induced cardiac hypertrophy. Pharmacologic or genetic inhibition of SIRT2 has been demonstrated to suppress inflammation, attenuate oxidative stress, and reduce ROS accumulation—a cascade intimately associated with ferroptosis.^15,17, 18, 19 On this basis, we hypothesized that SIRT2 may function as a modulator of ferroptosis.

However, whether SIRT2 influences the inflammatory response in AP via the regulation of ferroptosis has remained unclear. Our results demonstrate that either pharmacologic inhibition of SIRT2 with AGK2 or genetic knockdown of SIRT2 via AAV-sh-SIRT2 effectively alleviates pancreatic injury and inflammation while preventing ferroptosis in AP. Conversely, SIRT2 overexpression mediated by AAV-SIRT2 in AP rats exacerbated pancreatic injury, inflammation, and ferroptosis. Consistent findings were corroborated in in vitro AP models. Furthermore, AGK2 conferred protective effects comparable to those of Fer-1, a well-characterized ferroptosis inhibitor, by reducing pancreatic tissue injury, inflammatory responses, and ferroptosis. Notably, combined administration of AGK2 and Fer-1 exerted synergistic protective effects against AP. Collectively, these findings suggest that SIRT2 modulates the inflammatory response in AP by functioning as a key regulator of ferroptosis.

Subsequent RNA sequencing analysis identified IER3 as a significantly differentially expressed gene (DEG) potentially regulated by SIRT2. IER3, a prototypical stress response gene, is extensively implicated in the regulation of cellular processes including proliferation, apoptosis, inflammatory responses, and oxidative stress.^34,35 As an immediate early gene, IER3 is rapidly induced by diverse stimuli such as DNA damage, growth factors, cytokines, viral infections, and ionizing radiation. Its functional roles are highly context-dependent, varying with both cell type and microenvironmental conditions. Previous studies have reported that elevated IER3 expression promotes invasive progression in bladder cancer, underscoring its potential as a prognostic biomarker for patients with bladder cancer.³⁵ More recently, IER3 was shown to be markedly upregulated in oral squamous cell carcinoma, where it activates the canonical Wnt/β-catenin pathway, promotes aberrant glycolysis, and thereby accelerates tumor progression.³⁴ In addition, IER3 can be transcriptionally activated by the tumor suppressor TAp73β, thereby inducing apoptosis in cervical cancer cells.³⁶ Evidence also suggests that IER3 modulates NF-κB–dependent antiapoptotic signaling in human colon cancer cells.³⁷ Furthermore, studies in malignant gliomas have shown that IER3 overexpression promotes apoptosis in response to γ-irradiation.³⁸ Moreover, IER3 is enriched in inflammatory regions of pancreatic tissue in KrasG12D mice and in peritumoral inflammatory areas of human pancreatic ductal adenocarcinoma, with expression particularly elevated in distinct acinar cell clusters. In experimentally induced AP in KrasG12D mice, IER3 expression was elevated by approximately 4-fold. Elevated IER3 expression in acinar cells during pancreatitis has been shown to potentiate the oncogenic effects of KrasG12D.²⁹ Nevertheless, the precise role of IER3 in AP pathogenesis remains insufficiently understood. In this study, we demonstrated that pharmacologic inhibition of SIRT2 with AGK2, as well as genetic silencing of SIRT2 via AAV-sh-SIRT2 or si-SIRT2, significantly reduced IER3 expression in both in vivo and in vitro AP models. Conversely, SIRT2 overexpression markedly increased IER3 expression. Together, these findings suggest that IER3 functions as a downstream effector regulated by SIRT2.

Previous studies have demonstrated that 1α,25(OH)₂D₃ functions as an effective inhibitor of IER3.^39,40 It suppresses IER3 transcription by targeting specific regulatory elements within the IER3 promoter³⁹ and has also been reported to inhibit IER3 expression in arteriovenous fistulas.⁴⁰ In our study, 1α,25(OH)₂D₃ markedly attenuated pancreatic injury and inflammation, while simultaneously suppressing IER3 expression and ferroptosis induced by AP. In the in vitro AP model, silencing IER3 suppressed inflammation and ferroptosis in acinar cells, whereas IER3 overexpression produced the opposite effect. These findings suggest that IER3 promotes pancreatic injury and inflammation primarily through ferroptosis activation. Furthermore, 1α,25(OH)₂D₃ treatment or IER3 silencing partially reversed the deleterious effects of SIRT2 overexpression during AP onset, whereas IER3 overexpression abrogated the protective effects conferred by SIRT2 inhibition. These results indicate that SIRT2 regulates ferroptosis in AP at least in part through modulation of IER3 expression.

Co-IP assays further demonstrated that SIRT2 directly interacts with IER3 and enhances its expression through deacetylation. AGK2 suppressed IER3 expression by disrupting the SIRT2–IER3 interaction and enhancing IER3 acetylation. In addition, dual-luciferase reporter assays revealed that IER3 acts as a negative regulator of SLC7A11 expression. The SLC7A11–GPX4 axis is well-established as a critical determinant of ferroptosis regulation. Inhibition of SLC7A11 reduces cellular cysteine uptake, induces GSH depletion, inactivates GPX4, and promotes lipid peroxides accumulation, thereby triggering ferroptosis.⁴¹ Previous studies have shown that IER3 downregulates p-Nrf2 levels to block Nrf2 activation, thereby regulating inflammatory stress responses and tumor development.^42,43 Our study further confirms that IER3 inhibits Nrf2 activation. Inhibiting or silencing IER3 increases p-Nrf2 levels, whereas its overexpression decreases p-Nrf2 levels (Figure 14). In AP, Nrf2 positively regulates SLC7A11 expression, and IER3 negatively regulates SLC7A11 by suppressing Nrf2 activation. Specifically, ML385 (a Nrf2 inhibitor) reverses the promotional effect of IER3 knockdown on SLC7A11, whereas TBHQ (a Nrf2 activator) mitigates the inhibitory effect of IER3 overexpression on SLC7A11, with this regulatory effect further enhanced in the context of AP (Figure 15). Therefore, SIRT2 likely exacerbates pancreatic injury and inflammation by upregulating IER3 expression. The upregulation of IER3 can inhibit the positive regulation of Nrf2 on the SLC7A11–GPX4 axis, thereby driving ferroptosis activation during AP onset. Moreover, pharmacologic targeting of SIRT2 by AGK2 or of IER3 by 1α,25(OH)₂D₃ each markedly decreased the recruitment of macrophages and neutrophils into the pancreas during AP (Figure 16).

Figure 14.

IER3 inhibits Nrf2 activation. (A and B) Representative immunofluorescence images of p-Nrf2 (green) costained with 4′,6-diamidino-2-phenylindole (DAPI; blue) and the percentage of p-Nrf2-positive cells in the pancreatic tissues from Sham, AP, and 1α,25(OH)2D₃ + AP groups. (C and D) Representative immunohistochemistry images of p-Nrf2 and the percentage of p-Nrf2-positive cells in the pancreatic tissues from Sham, AP, and 1α,25(OH)2D₃ + AP groups. (E and F) Representative immunofluorescence images and relative fluorescence intensity of p-Nrf2 (green) costained with DAPI (blue) in AR42J cells treated with phosphate-buffered saline (Con), caerulein (AP), si-NC + caerulein (si-NC + AP), si-IER3 + caerulein (si-IER3 + AP), pCMV-HA-IER3 + caerulein (pCMV-HA-IER3 + AP), pCMV-HA + caerulein (pCMV-HA + AP). Statistical significance was determined using 1-way analysis of variance with Tukey’s post hoc test. Data are presented as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Figure 15.

Nrf2 positively regulates SLC7A11, whereas IER3 negatively regulates SLC7A11 by suppressing Nrf2 activation in AP. (A and B) Representative immunofluorescence images and relative fluorescence intensity of p-Nrf2 (green) costained with 4′,6-diamidino-2-phenylindole (DAPI; blue) in AR42J cells treated with phosphate-buffered saline (PBS; Con), si-IER3, ML385 (HY-100523, MCE), si-IER3 + ML385, caerulein (AP), si-IER3 + AP, ML385 + AP, si-IER3 + ML385 + AP. (C) Dual-luciferase reporter assay of SLC7A11 promoter activity in AR42J cells treated with PBS (Con), si-IER3, ML385, si-IER3 + ML385, caerulein (AP), si-IER3 + AP, ML385 + AP, si-IER3 + ML385 + AP. (D–F) Representative Western blot images, relative protein and mRNA levels of SLC7A11 in AR42J cells treated with PBS (Con), si-IER3, ML385, si-IER3 + ML385, caerulein (AP), si-IER3 + AP, ML385 + AP, si-IER3 + ML385 + AP. (G and H) Representative immunofluorescence images and relative fluorescence intensity of p-Nrf2 (green) costained with DAPI (blue) in AR42J cells treated with PBS (Con), pCMV-HA-IER3, TBHQ (HY-100489, MCE), pCMV-HA-IER3 + TBHQ, caerulein (AP), pCMV-HA-IER3 + AP, TBHQ + AP, pCMV-HA-IER3 + TBHQ + AP. (I) Dual-luciferase reporter assay of SLC7A11 promoter activity in AR42J cells treated with PBS (Con), pCMV-HA-IER3, TBHQ, pCMV-HA-IER3 + TBHQ, caerulein (AP), pCMV-HA-IER3 + AP, TBHQ + AP, pCMV-HA-IER3 + TBHQ + AP. (J–L) Representative Western blot images, relative protein and mRNA levels of SLC7A11 in AR42J cells treated with PBS (Con), pCMV-HA-IER3, TBHQ, pCMV-HA-IER3 + TBHQ, caerulein (AP), pCMV-HA-IER3 + AP, TBHQ + AP, pCMV-HA-IER3 + TBHQ + AP. Statistical analysis: 1-way analysis of variance with Tukey’s post hoc test was applied to panels (B, E, F, H, K and L). Two-way analysis of variance with Tukey’s post hoc test was used for panels (C and I). Data are expressed as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Figure 16.

Macrophage and neutrophil staining showing the effect of AGK2 targeting SIRT2 or 1α,25(OH)2D₃ targeting IER3 on the immune cell composition in AP. (A and B) Representative immunofluorescence images of F4/80 (green) costained with 4′,6-diamidino-2-phenylindole (DAPI; blue) and the percentage of F4/80-positive cells in the pancreatic tissues from Sham, AP, and AGK2 + AP groups. (C and D) Representative immunofluorescence images of Ly6G (green) costained with DAPI (blue) and the percentage of Ly6G-positive cells in the pancreatic tissues from Sham, AP, and AGK2 + AP groups. (E and F) Representative immunofluorescence images of F4/80 (green) costained with DAPI (blue) and the percentage of F4/80-positive cells in the pancreatic tissues from Sham, AP, and 1α,25(OH)2D₃ + AP groups. (G and H) Representative immunofluorescence images of Ly6G (green) costained with DAPI (blue) and the percentage of Ly6G-positive cells in the pancreatic tissues from Sham, AP, and 1α,25(OH)2D₃ + AP groups. Statistical significance was determined using 1-way analysis of variance with Tukey’s post hoc test. Data are presented as mean ± standard deviation. ∗P < .05; ∗∗P < .01; ∗∗∗P < .001; ∗∗∗∗P < .0001.

Our findings exhibit discrepancies with those of Quan et al,⁴⁴ who have reported a protective role of SIRT2 in caerulein-induced mild edematous pancreatitis using 4- to 6-month-old global Sirt2 knockout mice. In contrast, our study demonstrates that SIRT2 aggravates pancreatic injury, inflammation, and ferroptosis in L-arginine–induced severe necrotizing pancreatitis in 6- to 8-week-old rats, via acute pharmacologic inhibition and AAV9-mediated knockdown. These divergent outcomes may mainly be attributed to fundamental differences in experimental models (caerulein vs L-arginine), animal species and age (immunologically mature mice vs young rats), and SIRT2 modulation strategies (lifelong knockout with potential compensatory adaptations vs acute targeted intervention). Collectively, these differences highlight SIRT2’s context-dependent role in AP.

In summary, our findings indicated that SIRT2 upregulated IER3 expression through direct interaction and deacetylation, thereby suppressing the SLC7A11–GPX4 axis, activating ferroptosis, and exacerbating pancreatic injury and inflammation in AP. Furthermore, clinical data from patients with AP revealed that serum SIRT2 and IER3 levels were positively correlated with SOFA scores and circulating IL1β, IL6, and TNF-α. Thus, serum SIRT2 and IER3 might serve as novel prognostic biomarkers for assessing AP severity. Collectively, these findings delineate a mechanistic pathway whereby SIRT2 contributed to AP pathogenesis through IER3 regulation and highlight potential therapeutic targets for AP management.

Materials and Methods

Establishment of Acute Pancreatitis Rat Model

Male Sprague–Dawley rats (6–8 weeks) were obtained from Jiangsu Gempharmatech Co, Ltd and randomly assigned to experimental groups. Prior to experimentation, all rats were fasted for 12 hours with free access to water. We used male rats only, given the higher incidence and worse prognosis of AP in male mice,^45,46 and to avoid confounding from cyclic sex hormone fluctuations in female mice.47, 48, 49 The AP model was induced by 2 intraperitoneal injections of L-arginine (2.5 g/kg, A8220, Solarbio) at a 1-hour interval.⁵⁰ Forty-eight hours after the final injection, rats were anesthetized with 1% pentobarbital sodium and euthanized. Blood and pancreatic tissue samples were collected for subsequent analyses. All animal procedures were performed in strict accordance with the Animal Research: Reporting of In Vivo Experiments guidelines and were reviewed and approved by the Animal Ethics Committee of Anhui Medical University (Approval No. LLSC20251635).

In Vivo Experiments

Before AP induction, rats were pretreated with AGK2 (10 mg/kg, KM4346, KKL), 1α,25(OH)₂D₃ (0.001 mg/kg, D1530, Sigma), or Fer-1 (5 mg/kg, KM4347, KKL). To achieve local knockdown or overexpression of SIRT2, AAV9 vectors were constructed. These included SIRT2-specific shRNA (AAV-sh-SIRT2, General Biol), control shRNA (AAV-sh-NC, General Biol), a SIRT2 overexpression plasmid (AAV-SIRT2, General Biol), and a control plasmid (AAV-Con, General Biol). Each rat received 2 × 10¹¹ viral genomes via tail vein injection. After 3 weeks of normal feeding, the AP model was induced.

Hematoxylin and Eosin Staining

Pancreatic tissues were fixed in 4% paraformaldehyde, paraffin-embedded, and sectioned. Sections were stained with hematoxylin and eosin (H&E). Histopathologic changes (edema, hemorrhage, inflammation, and necrosis) were evaluated in a double-blind manner as previously described.⁵¹

Immunofluorescence

Immunofluorescence was performed on paraffin-embedded pancreatic sections (5 μm) and cultured cells. For tissues, sections were stained with primary antibodies against SIRT2 (sc-28298, Santa Cruz, 1:50), amylase (66,133-1, Proteintech, 1:200), IER3 (bs-6840R, Bioss, 1:200), p-Nrf2 (phospho S40, ab76026, Abcam, 1:500), F4/80 (P47789-1B1, Abmart, 1:200), and Ly6G (65078-1-Ig, Proteintech, 1:200). For cells, fixed, permeabilized, and blocked cells were incubated overnight with anti-p-Nrf2 (phospho S40, ab76026, Abcam, 1:500). Both were then treated with corresponding secondary antibodies and 4′,6-diamidino-2-phenylindole (G1012, Servicebio). Fluorescence images were processed in ImageJ to obtain mean intensity values from field-based measurements.

Immunohistochemistry

Paraffin-embedded pancreatic sections (5 μm) were first incubated with a primary antibody against p-Nrf2 (phospho S40) (ab76026, Abcam, 1:100), then with a secondary antibody, developed with 3,3'-diaminobenzidine (PV-9000, zsbio), and counterstained with hematoxylin (G1004, Servicebio). The percentage of p-Nrf2-positive cells in the pancreas was calculated from field-based measurements using ImageJ.

Biochemical Analyses

Serum levels of amylase (C016-1-1, Jiancheng Bioengineering), lipase (A054-1-1, Jiancheng Bioengineering), IL1β (SBJ-R0546, Senbeijia), TNF-α (SBJ-R0040, Senbeijia), and IL6 (SBJ-R0755, Senbeijia) were measured. Pancreatic tissue levels of MDA (D751053-0096, Sangon), lipid peroxides (D799602-0050, Sangon), GSH (KTB1600, Abbkine), and Fe²⁺ (BC5415, Solarbio) were quantified using commercial kits according to the manufacturers’ protocols.

Transmission Electron Microscopy

Pancreatic tissues were cut into 1-mm³ pieces, stained with uranyl acetate and lead citrate for 15 minutes, and examined with a HITACHI HT7800 transmission electron microscope.

Cell Culture and Treatment

Rat pancreatic acinar AR42J cells (ATCC) were cultured in F12K medium supplemented with 20% fetal bovine serum at 37 °C in a 5% CO₂ atmosphere. An in vitro AP model was established by treating cells with caerulein (120 nM, IC4660, Solarbio) for 24 hours. All experiments were performed independently in triplicate.

Western Blot

Proteins were extracted from tissues and cells using RIPA buffer (P0013B, Beyotime). Protein concentrations were determined using a BCA kit (P0009, Beyotime). Equal amounts of protein were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis, transferred to polyvinylidene fluoride membranes, blocked, and incubated overnight at 4 °C with primary antibodies against actin, SIRT2 (AF5256, Affinity), SLC7A11 (DF12509, Affinity), GPX4 (DF6701, Affinity), and IER3 (bs-6840R, Bioss). Horseradish peroxidase–conjugated secondary antibodies were applied, and signals were detected by enhanced chemiluminescence. Band intensities were quantified using Image J and normalized to β-actin.

Real-Time Polymerase Chain Reaction

Total RNA was extracted with TRIzol reagent (G3013, Servicebio) and reverse-transcribed using HiScript III RT SuperMix (R323-01, Vazyme). qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme). Glyceraldehyde 3-phosphate dehydrogenase served as the internal control, and relative gene expression was calculated using the 2^ˆ−ΔΔCt method. Primer sequences are provided in Table 1.

Table 1.

Primers Used for Quantitative Real-Time Polymerase Chain Reaction

Name	Sense (5′–3′)	Antisense (5′–3′)
IL6	ACTTCCAGCCAGTTGCCTTCTTG	TGGTCTGTTGTGGGTGGTATCCTC
TNF-α	TCAAGAGCCCTTGCCCTAAG	TGGAAGACTCCTCCCAGGTA
SIRT2	ACGGCACCTTCTACACAT CAC AC	GGGCTTTACCACATTCTGACA CTTC
IER3	CTCAGAACACTACCGCCAGATGC	AAGACCTCCGTCCGTCAC CAG
SLC7A11	CCATCATCATCGGCACCGTCA TC	TACTCCACAGGCAGACCAGAACAC
GPX4	ACCAGTTCGGGAGGCAGGAG	CACAGTGGGTGGGCATCGTC
GAPDH	GACATGCCGCCTGGAGAAAC	AGCCCAGGATGCCCTTTAGT

Cellular Reactive Oxygen Species, Iron (II), Mitochondrial Membrane Potential, and Lipid Peroxidation Assays

Intracellular ROS (DCFH-DA assay, S0033S, Beyotime), Fe²⁺ (FeRhoNox-1 assay, MX4558, MKBio), mitochondrial membrane potential (JC-1 assay, KTA4001, Abbkine), and lipid peroxidation (BODIPY-C11, S0043S, Beyotime) were measured using commercial kits. Fluorescence images were acquired using an Olympus microscope.

Cell Viability Assay

AR42J cells were seeded in 96-well plates (8 × 10³ cells/well) and treated with AGK2 or Fer-1 at various concentrations for 24 hours. Cell viability was assessed using the CCK-8 assay (A311-01, Vazyme). Absorbance at 450 nm was measured using a microplate reader, and the viability was calculated accordingly.

Cell Transfection

AR42J cells were transfected with a SIRT2 overexpression plasmid (pcDNA3.1-SIRT2), control plasmid (pcDNA3.1), IER3 overexpression plasmid (pCMV-HA-IER3), control plasmid (pCMV-HA), or siRNAs (si-SIRT2, si-IER3, si-SLC7A11, si-NC) using Lipofectamine 2000. The sequences of siRNAs are provided in Table 2.

Table 2.

The siRNA Sequences Used in This Study

Name	Sense (5′–3′)	Antisense (5′–3′)
si-SIRT2	AGGGAGCAUGCCAACAUAGAU	AUCUAUGUUGGCAUGCUCCCU
si-NC	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
si-IER3-1	CCAACAUUGCCAAGAGGAUTT	AUCCUCUUGGCAAUGUUGGTT
si-IER3-2	CCAUAUCACCUGAGCCCAUTT	AUGGGCUCAGGUGAUAUGGTT
si-IER3-3	CGGACUAUGCUCUGGAUCUTT	AGAUCCAGAGCAUAGUCCGTT
si-SLC7A11-1	GGGUACGAGCAUAAAGAAATT	UUUCUUUAUGCUCGUACCCTT
si-SLC7A11-2	GGGUGGAACUGCUGGUAAUTT	AUUACCAGCAGUUCCACCCTT
si-SLC7A11-3	CUGAGCGGCUGCUGGGAAATT	UUUCCCAGCAGCCGCUCAGTT

si, small interfering.

Co-Immunoprecipitation

Cell lysates were prepared using a Co-IP kit (abs9649-50T, Absin). Antibodies against SIRT2 (sc-28298, Santa Cruz), Flag (20543-1-AP, Proteintech), HA (51064-2-AP, Proteintech), and lysine-acetylation (66289-1-Ig, Proteintech) were used. Protein complexes were precipitated using Protein A/G agarose beads and subsequently analyzed by Western blot.

RNA Sequencing

Total RNA from pancreatic tissues was sequenced using the Illumina 10 platform. DEGs were identified using thresholds of |log₂fold change| > 1 and P < .05. Heatmaps were generated to visualize DEG expression patterns. The data has been deposited into the China National GeneBank Sequence Archive, and the accession number is CNP0008187.

Dual-Luciferase Reporter Assay

Plasmids containing SLC7A11 promoter regions were cotransfected with IER3 overexpression or control plasmids, si-IER or si-NC, using Lipofectamine 2000. Luciferase activity was measured using a dual-luciferase assay kit (RG027, Beyotime). Firefly luciferase activity was normalized against Renilla luciferase activity.

Patient Samples and Indicator Measurements

With approval from the Ethics Committee of the Second Affiliated Hospital of Anhui Medical University (Ethics approval number: YX2025-264), blood samples were collected from healthy controls (n = 10, 8 men and 2 women) and patients with AP (n = 20, 12 men and 8 women). All participants or their relatives provided written informed consent. Serum was separated by centrifugation at 4000 × g for 15 minutes and subjected to enzyme-linked immunosorbent assays: SIRT2 (ELK1537, ELK Biotechnology), IER3 (ELK5015, ELK Biotechnology), IL1β (SBJ-H0292, Senbeijia), TNF-α (SBJ-H0038, Senbeijia), and IL6 (SBJ-H0465, Senbeijia). The SOFA score was applied to evaluate organ function based on 6 systems.⁵² The highest SOFA score within 24 hours of emergency admission was recorded.

Statistical Analysis

Data were analyzed using GraphPad Prism 8.0.2 and SPSS 26.0 and expressed as mean ± standard deviation. Two-group comparisons were conducted using the Student t test, whereas multiple comparisons were analyzed by 1- or 2-way analysis of variance with Tukey’s post hoc test. The correlation between clinical data and serum SIRT2 and IER3 was assessed by simple linear regression. A P value < .05 was considered statistically significant. All authors had access to the research data and have reviewed and approved the final manuscript.

CRediT Authorship Contributions

Shi-Ya Ma (Data curation: Supporting; Investigation: Lead; Methodology: Supporting; Software: Lead; Writing – original draft: Lead; Writing – review & editing: Equal).

Zhao-Jian Shen (Data curation: Equal; Investigation: Equal; Methodology: Equal).

Chong-Zhi Zhu (Investigation: Equal; Software: Equal).

Cui Shen (Data curation: Equal).

Zhong-Hua Lu (Methodology: Equal; Project administration: Equal; Writing – original draft: Equal).

Yun Sun (Funding acquisition: Supporting; Investigation: Equal; Writing – review & editing: Equal).

Wei-Li Yu (Conceptualization: Lead; Data curation: Lead; Funding acquisition: Lead; Investigation: Lead; Methodology: Lead; Project administration: Lead; Software: Equal; Supervision: Lead; Validation: Lead; Writing – original draft: Equal; Writing – review & editing: Lead).