Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2026 Oct 9;105(12):107925. doi: 10.1016/j.psj.2026.107925

The degree of polymerization influences the effects of pectic oligosaccharide on intestinal histomorphology, barrier function and microbial community structure in broilers

Chong Ling 1,1, Jiarong Fang 1,1, Songtao Liu 1, Shitang Zhang 1, Furui Liang 1, Hui Ye 1, Qingyun Cao 1, Jianjun Zuo 1,⁎, Weiwei Wang 1,⁎
PMCID: PMC13682003  PMID: 42868845

Abstract

This study aimed to investigate whether the degree of polymerization (DP) influences intestinal health benefits of pectic oligosaccharide (POS) in broilers. A total of 360 one-day-old female Huanghua yellow-feathered broilers were randomly allocated into 3 groups (10 replicates/group), which received a basal diet alone or supplemented with 600 mg/kg low‑DP (DP = 10) POS (LPOS) or 600 mg/kg high‑DP (DP = 17) POS (HPOS) over a 21‑day experimental period. The results showed that supplemental LPOS and HPOS tended to reduce (P = 0.081) average daily feed intake, but tended to increase (P < 0.10) relative duodenal weight and length along with relative ileal length. They also increased (P < 0.05) relative cecal weight and length, ileal villus height (VH), as well as duodenal and ileal VH to crypt depth ratio (VCR). LPOS showed a greater (P < 0.05) effect on ileal VCR, whilst HPOS additionally increased (P < 0.05) duodenal VH. Both LPOS and HPOS reduced (P < 0.05) serum endotoxin level, with HPOS also lowering (P < 0.05) serum D-lactic acid level. LPOS upregulated (P < 0.05) duodenal Zonula Occludens (ZO)-1 expression, while HPOS upregulated (P < 0.05) ileal Claudin-1 and ZO-1 expression. Cecal microbial analysis demonstrated that HPOS elevated (P < 0.05) most α‑diversity indices, including Simpson index, Shannon index, Chao1 index, and phylogenetic diversity, whereas LPOS only increased (P < 0.05) Simpson index. Notably, LPOS, rather than HPOS, reduced (P < 0.05) the within‑group β‑diversity index (heterogeneity) of cecal microbial communities, and caused greater microbial separation (P < 0.05) from control group. Further analysis indicated that HPOS enriched (P < 0.05) a greater variety of beneficial bacteria in the cecum than LPOS. Moreover, LPOS increased (P < 0.05) cecal isovaleric acid concentration, while HPOS elevated (P < 0.05) cecal concentrations of propionic, valeric, isobutyric, and isovaleric acids. In summary, LPOS and HPOS differentially promoted intestinal health in broilers, with HPOS being superior to LPOS in improving intestinal barrier and microbial community structure. These findings highlight an influence of the DP on the efficacy of POS, supporting the efficient application of POS in poultry production.

Keywords: Broiler, Gut microbiota, Intestinal health, Pectic oligosaccharide, Polymerization degree

Introduction

The intestine serves not only as the primary organ for digestion and absorption in poultry, but also contributes to maintaining systemic health via its barrier function (Ducatelle et al., 2023). In modern intensive poultry production, numerous dietary and environmental factors can directly or indirectly impair intestinal health, subsequently compromising poultry production performance (Aminullah et al., 2026). Although antibiotics were once widely used to improve poultry gut health, the resultant increases in antimicrobial resistance and antibiotic residues have raised prominent public health concerns. Under the global trend toward banning or restricting the usage of in-feed antibiotics, developing functional oligosaccharides capable of promoting intestinal health has become an important direction in poultry nutrition research (Prusty et al., 2026).

As an emerging class of functional oligosaccharides, pectic oligosaccharide (POS) is obtained from pectin degradation and composed of 2-20 D-galacturonic acid residues linked by glycosidic bonds (Wang et al., 2026). POS may benefit poultry gut health through various bioactivities especially the prebiotic effect (Wang et al., 2026), as POS withstands the actions of host digestive enzymes and then selectively stimulates the growth of specific beneficial bacteria to optimize gut microbial composition (De Alencar et al., 2025). Notably, bacterial fermentation of POS generates certain beneficial metabolites such as short-chain fatty acids (SCFAs), which can reduce intestinal luminal pH and repress harmful bacterial growth, thus further improving intestinal microenvironment (Wang et al., 2026). Moreover, SCFAs serve as energy substrates for intestinal epithelial cells (IECs) and as signaling molecules that activate specific signaling pathways to promote tight junction (TJ) protein expression, ultimately sustaining intestinal development and barrier function (Aminullah et al., 2026). In recent years, the application of POS in poultry nutrition has attracted increasing attention. For instance, it was reported that supplemental POS ameliorated growth performance and duodenal villus morphology, as well as elevated cecal isobutyric acid concentration in broiler chickens (Wang et al., 2019). Likewise, Mao et al. (2021) detected elevations in cecal abundances of certain SCFA‑producing bacteria and jejunal expression of specific TJ proteins in broiler breeders fed with POS, thus benefiting intestinal barrier function and laying performance.

Although the above studies have revealed the beneficial effects of POS on poultry gut health potentially through the prebiotic action, the relationships between in vivo efficacy of POS and its structural characteristics remain poorly understood. The degree of polymerization (DP) is a critical structural characteristic influencing the bioactivities of POS (Wang et al., 2026), because it determines the chain length, molecular weight (MW), and solubility of POS. Since different bacteria vary in their capacity to degrade oligosaccharides (De Alencar et al., 2025), POS with different DPs may be fermented differently in the gut. In vitro human fecal fermentation experiments have evidenced that lower-MW POS exerted stronger effects in facilitating beneficial bacterial growth and SCFA production (Yeung et al., 2021; Vásquez et al., 2024), whilst conflicting results have been described elsewhere (Wilkowska et al., 2025). Consequently, the influences of DP (a determinant of MW) on the in vivo efficacy of POS deserve investigation. We hypothesized that different DPs of POS interact differentially with gut microbiota, conferring distinct benefits for poultry gut health. Accordingly, this study aimed to compare the effects of two POS fractions with low and high average DPs (2-10 and 11-20, respectively) on intestinal histomorphology, barrier function and microbial community structure in broilers. The findings were expected to provide a basis for the efficient application of POS as an improver of intestinal health in poultry production.

Materials and methods

Preparation of POS

According to our previous study (Wang et al., 2026), POS with two different DPs were prepared through enzymatically hydrolyzing citrus-derived polygalacturonic acid (> 90% purity; Yihe Biotechnology Co., Ltd., Shanghai, China) that acts as a backbone of pectin, followed by purification via the ethanol fractional precipitation method. The purities of the above POS preparations were determined as 96.1% and 97.2%, respectively. Based on the weight-average MW determined by GPC-20A gel permeation chromatography (Shimadzu, Kyoto, Japan), the average DPs of the above POS preparations were calculated as 10 and 17, respectively, with corresponding polydispersity indexes calculated as 1.27 and 1.08, suggesting narrow MW distributions for both. The average DPs of the two POS preparations were 10 and 17, falling within the ranges of 2-10 and 11-20, respectively. Thus, they were designated as low-average-DP POS (LPOS) and high-average-DP POS (HPOS), respectively.

Animals and experimental design

The animal experimental protocols of the present study were approved by the Institutional Animal Care and Use Committee of South China Agricultural University (Guangzhou, China). A total of 360 one-day-old female Huanghua yellow-feathered broilers were randomly assigned into 3 groups. Each group consisted of 10 replicates with 12 birds per replicate. The initial body weight (34.91 ± 0.10 g) was comparable across all replicates. Birds in control group received a basal diet, while those in treatment groups received a basal diet with supplementation of 600 mg/kg LPOS and HPOS, respectively. The additive level of POS was selected in accordance with our previous study (Ling et al., 2026). The experimental period lasted 21 d, since prebiotics are more likely to confer growth benefit for broilers during the early growth stage, when intestinal structure remains incompletely developed and microbial community is still maturing (Rezaei et al., 2015; Shani and Irani, 2024). The composition of basal diet is detailed in Table 1 (Ling et al., 2026), with its nutrient levels established referring to the Chinese Feeding Standard of Yellow-feathered Chickens (NY/T 3645-2020). During the experimental period, all birds were reared in metallic cages, with unlimited access to feed and water. Illumination was provided continuously (24 h/d). The environmental temperature was set at 34 °C for the initial three days, and then decreased by 3 °C weekly until reaching a final temperature of roughly 24 °C.

Table 1.

Composition of the basal diet (air-dry basis).

Ingredients Content (%)
Corn 54.70
Soybean meal 38.10
Soybean oil 2.60
Dicalcium phosphate 2.00
Limestone 1.20
Sodium chloride 0.26
DL-Methionine (98%) 0.13
L-Lysine. HCl (99%) 0.01
Premix1 1.00
Total 100.00
Nutrient levels
Apparent metabolizable energy (MJ/kg) 12.55
Crude protein 21.10
Calcium 1.00
Available phosphorus 0.46
Lysine 1.20
Methionine 0.50
Open in a new tab
1

Premix provided per kilogram of diet: VA 5000 IU, VD3400 IU, VE 31 IU, VK18 mg, VB12.5 mg, VB215 mg, pantothenate 60 mg, nicotinamide 15 mg, VB64.0 mg, biotin 0.1 mg, folic acid 1.5 mg, Choline 450 mg, VB120.02 mg; Fe 70 mg, Cu 8.0 mg, Zn 60 mg, Mn 80 mg, Se 0.25 mg, I 1.4 mg.

Sample collection

At 21 d of age, one bird per replicate cage was randomly chosen and sacrificed. Blood was collected from the jugular vein, after which the abdominal cavity was rapidly incised to expose the intestine. The proximal intestine (duodenum) and distal intestine (ileum and cecum) were excised to measure their relative weight, relative length, and density. The middle segments of duodenal and ileal segments were separately rinsed with phosphate buffered saline to remove luminal contents, followed by division into two portions. One portion was immersed in 4% paraformaldehyde for fixation, while the other was snap‑frozen in liquid nitrogen and stored at -80 °C. Additionally, cecal digesta from each bird was collected and immediately frozen in liquid nitrogen for subsequent storage at -80 °C.

Growth performance measurement

At 21 d of age, feed intake and live body weight of broilers in each replicate cage were recorded. The final body weight (FBW), average daily gain (ADG), average daily feed intake (ADFI), along with feed conversion ratio (FCR) during 1–21 d of age were calculated.

Serum indice assay

Blood samples were centrifuged at 1,500 × g for 10 min at 4 °C, and the resultant serum samples were then harvested. Serum endotoxin level was determined using a commercial kit that employs a quantitative chromogenic assay (Bioendo Technology Co., Ltd., Xiamen, China). Serum D‑lactic acid (DLA) was quantified with a colorimetric commercial kit (Abbkine Scientific Co., Ltd., Wuhan, China).

Measurements of relative weight, relative length, and density of the intestine

The collected duodenum, ileum, and cecum were carefully trimmed of mesenteric fat, and gently handled to prevent tissue distortion. The weight and length of each intestinal segment were measured to calculate relative weight and relative length, which were calculated as intestinal segment weight (g) and length (cm) per 100 g live body weight, respectively. Subsequently, intestinal density, namely the ratio of intestinal weight (g) to intestinal length (cm), was calculated.

Determination of intestinal villus morphology

Duodenal and ileal tissues fixed in 4% paraformaldehyde were embedded in paraffin, sectioned, deparaffinized, rehydrated, stained with hematoxylin-eosin, and then coverslipped after dehydration. For each stained section, representative villi with intact structure were chosen for determining intestinal villus morphology under a Moticam2306 optical microscope (Motic Industrial Group Co., Ltd., Xiamen, China). Villus height (VH), crypt depth (CD), and the VH/CD ratio (VCR) were then measured using ImageJ software.

Real-time PCR

Total RNA was isolated from duodenal and ileal tissues using the FastPure® Cell/Tissue Total RNA Isolation Kit (Vazyme Biotechnology Co., Ltd., Nanjing, China). The concentration and purity of RNA samples were measured with an UV spectrophotometer Nano-Drop 2000 (Thermo Fisher Scientific, Waltham, USA), and RNA integrity was evaluated by agarose gel electrophoresis. Subsequently, reverse transcription was carried out with the HiScript II qRT SuperMix for qPCR kit (Vazyme Biotechnology Co., Ltd., Nanjing, China) to synthesize cDNA, which was then diluted with RNase‑free water and used as the PCR template. Quantitative real‑time PCR was performed on a CFX96 Touch platform (Bio‑Rad Laboratories, Hercules, CA, USA) using the 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotechnology Co., Ltd., Nanjing, China) with gene‑specific primers (listed in Table 2). β-Actin acted as the reference gene, and the relative mRNA expression of TJ proteins (Claudin‑1, Occludin, and ZO‑1) was computed using the 2⁻ΔΔCt method (Livak and Schmittgen, 2001).

Table 2.

Primer sequences for real-time PCR.

Genes1 Sequences (5′→3′) GenBank numbers Product size, bp
β-Actin F: CCGCTCTATGAAGGCTACGC NM_205518.2 128
R: CTCTCGGCTGTGGTGGTGAA
Claudin-1 F: TATGGCAACAGAGTGGCTCG NM_001013611.2 196
R: AGGGGGCATTTTTGGGGTAG
Occludin F: GAGCTACAGCTACGGCTACG XM_046904540.1 217
R: GATGGAGGCGATGAGCATGA
ZO-1 F: CTTCAGGTGTTTCTCTTCCTCCTC XM_046925214.1 131
R: CTGTGGTTTCATGGCTGGATC
Open in a new tab
1

ZO-1, zonula occludens 1.

Gut microbial analysis

Bacterial genomic DNA was isolated from cecal digesta using the CretMag™ Power Soil DNA Kit (Cretaceous Biotechnology Co., Ltd., Suzhou, China). DNA concentration and purity were determined with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and its integrity was verified via agarose gel electrophoresis. Using the purified DNA as the template, the V3-V4 region of the 16S rRNA gene was then amplified with the forward primer GTGYCAGCMGCCGCGGTAA and reverse primer GGACTACNVGGGTWTCTAAT. The resulting amplicons were visualized by agarose gel electrophoresis and purified with the AxyPrep DNA Gel Extraction Kit (Axygen Bioscience, Union City, CA, USA). Purified products were quantified with a Quantus™ Fluorometer (Promega, Madison, WI, USA), and sequencing libraries were constructed using the VAHTS® Universal Plus DNA Library Prep Kit for MGI V2 (Vazyme Biotechnology Co., Ltd., Nanjing, China). Following quality control, paired-end sequencing was performed on the MGI platform (MGI Tech, Shenzhen, China). After quality filtering and length trimming, the raw tags were subjected to chimera removal. The resulting effective tags were then denoised to generate amplicon sequence variants (ASV) for taxonomic annotation. Subsequently, we evaluated microbial α-diversity using multiple indicators, including the observed ASV, Chao1 and ACE indexes (reflecting richness), Shannon and Simpson indexes (reflecting richness and evenness), as well as phylogenetic diversity (PD) whole tree (reflecting evolutionary breadth). Note: PD whole tree was defined as the total branch length of the phylogenetic tree connecting all species in the community. In addition to α-diversity, microbial β‑diversity analysis, including principal co-ordinates analysis (PCoA), β-diversity index assessment, and analysis of similarity (ANOSIM) between groups were also performed. Finally, linear discriminant analysis (LDA) combined with effect size measurement (LEfSe) was employed to identify differentially abundant taxa (LDA > 2.0, P < 0.05) among groups.

Quantification of cecal SCFAs

The concentrations of SCFAs (acetic acid, propionic acid, butyric acid, valeric acid, isobutyric acid, isovaleric acid, and total SCFAs) in cecal digesta were measured using a Shimadzu Nexis GC‑2030 gas chromatograph (Kyoto, Japan) with 2‑ethylbutyric acid serving as the internal standard, following the procedures described in our previous research (Ren et al., 2025).

Statistical analysis

Data are presented as mean ± standard error of the mean. Growth performance was measured with each replicate pen as the experimental unit, whereas the other indicators were measured with each bird as the experimental unit. Gut microbial analysis-related data were subjected to the Kruskal-Wallis test; while data for other indicators were analyzed using the one-way ANOVA of SPSS 25.0, followed by assessment of the differences among groups using the Duncan's multiple comparisons. Statistical significance was set at P < 0.05, and 0.05 ≤ P < 0.10 was considered a trend toward significance.

Results

Growth performance

As shown in Table 3, no significant differences (P > 0.05) were observed in growth performance parameters, including FBW, ADG, ADFI, and FCR, among groups. However, ADFI tended to be lower (P = 0.081) in POS treatment groups relative to control group.

Table 3.

Effect of pectic oligosaccharides with different degrees of polymerization on growth performance1 in broilers (1-21 d).

Control2 LPOS HPOS P-value
FBW (g) 200.58±2.94 195.56±3.11 200.10±6.18 0.604
ADG (g) 8.70±0.16 8.46±0.16 8.57±0.41 0.837
ADFI (g) 19.18±0.78 17.03±0.35 18.20±0.65 0.081
FCR 2.20±0.07 2.03±0.04 2.17±0.06 0.113
Open in a new tab

Data are presented as mean ± standard error of the mean.

1

FBW, final body weight; ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio.

2

Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Serum indices

Serum endotoxin level was significantly lower (P < 0.05) in both LPOS and HPOS groups than that in control group (Fig. 1). Serum DLA level was significantly lower (P < 0.05) in HPOS group versus control group, but it was not significantly different (P > 0.05) between LPOS and HPOS groups.

Fig. 1.

Fig. 1

Open in a new tab

Effects of pectic oligosaccharides with different degrees of polymerization on serum indicesin broilers (21 d).Data are presented as mean ± standard error of the mean.a,bValues with different letters differ significantly (P < 0.05). Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Intestinal histomorphological parameters

Relative weight of the duodenum along with relative lengths of the duodenum and ileum tended to be higher (P < 0.10) in both LPOS and HPOS groups versus control group (Table 4). Besides, both LPOS and HPOS groups showed significant increases (P < 0.05) in relative weight and length of the cecum compared with control group, with HPOS group also exhibiting a significant increase (P < 0.05) in relative weight of the ileum. However, intestinal density was not significantly different (P > 0.05) among groups.

Table 4.

Effects of pectic oligosaccharides with different degrees of polymerization on relative weight, relative length, and density1of the intestine in broilers (21 d).

Control2 LPOS HPOS P-value
Relative weight (g/g BW)
Duodenum 2.34±0.19 2.59±0.07 2.81±0.15 0.078
Ileum 2.71±0.12b 3.10±0.21ab 3.49±0.09a 0.009
Cecum 1.64±0.05b 1.94±0.09a 1.93±0.09a 0.018
Relative length (cm/g BW)
Duodenum 9.74±0.34 10.74±0.23 11.00±0.55 0.083
Ileum 16.77±0.37 18.33±0.29 18.92±1.06 0.078
Cecum 4.72±0.12b 5.41±0.08a 5.25±0.16a 0.004
Density (g/cm)
Duodenum 0.23±0.02 0.25±0.02 0.23±0.01 0.140
Ileum 0.16±0.02 0.17±0.02 0.18±0.01 0.209
Cecum 0.17±0.02 0.17±0.03 0.17±0.01 0.997
Open in a new tab

Data are presented as mean ± standard error of the mean.a,bValues within a row with different superscript letters differ significantly (P < 0.05).

1

Relative weight and relative length of each intestinal segment were calculated as intestinal segment weight (g) and length (cm) per 100 g live body weight, respectively. Intestinal density was calculated as the ratio of intestinal weight (g) to intestinal length (cm).

2

Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

There were significant increases (P < 0.05) in duodenal VCR coupled with ileal VH and VCR in either LPOS or HPOS group relative to control group (Table 5). Moreover, duodenal VH in HPOS group was significantly higher (P < 0.05) than that in control group but did not differ significantly from (P > 0.05) that in LPOS group.

Table 5.

Effect of pectic oligosaccharides with different degrees of polymerization on intestinal villus morphology1 in broilers (21 d).

Control1 LPOS HPOS P-value
Duodenum
Villus height (μm) 1308.26±45.04b 1347.84±19.25ab 1425.28±23.81a 0.049
Crypt depth (μm) 309.44±17.66 271.89±7.01 263.44±7.23 0.126
Villus height/crypt depth 4.28±0.31b 5.00±0.17a 5.43±0.23a 0.017
Ileum
Villus height (μm) 774.10±14.72b 891.50±8.26a 847.03±29.78a 0.003
Crypt depth (μm) 228.73±12.15 196.07±6.22 212.28±9.92 0.092
Villus height/crypt depth 3.42±0.16c 4.58±0.17a 4.00±0.11b <0.001
Open in a new tab

Data are presented as mean ± standard error of the mean.a-cValues within a row with different superscript letters differ significantly (P < 0.05).

1

Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Relative mRNA expression of intestinal TJ proteins

The expression of duodenal TJ protein Claudin-1 and Occludin remained comparable (P > 0.05) across groups (Fig. 2), but LPOS group rather than HPOS group had significantly higher (P < 0.05) expression of duodenal ZO-1 than control group. Comparatively, HPOS group showed a significant increase (P < 0.05) in ileal Claudin-1 and ZO-1 expression relative to control group.

Fig. 2.

Fig. 2

Open in a new tab

Effect of pectic oligosaccharides with different degrees of polymerization on the relative mRNA expression of duodenal (A) and ileal (B) tight junction proteinsin broilers (21 d). Data are presented as mean ± standard error of the mean.a,bValues with different letters differ significantly (P < 0.05). Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Cecal microbial structure

Microbial α-diversity: Compared with control group, HPOS group showed significantly higher (P < 0.05) α-diversity indicators of cecal microbiota, including Chao1 index, observed ASV, Shannon index, Simpson index, and PD whole tree (Fig. 3). However, only Simpson index was observed to be significantly higher (P < 0.05) in LPOS group versus control group.

Fig. 3.

Fig. 3

Open in a new tab

α-Diversity analysis of gut microbiota in broilers (21 d) fed with pectic oligosaccharides with different degrees of polymerization. Data are presented as mean ± standard error of the mean. *P < 0.05,⁎⁎P < 0.01. Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Microbial β-diversity: There was a significant separation (P < 0.05) in cecal microbial communities among groups as visualized by PCoA plot (Fig. 4. A). β-Diversity index was significantly reduced (P < 0.05) in LPOS group but remained unchanged (P > 0.05) in HPOS group when compared with control group (Fig. 4. B). ANOSIM revealed a significant difference (P < 0.05, R > 0) in microbial community between control and LPOS groups (Fig. 4. C), together with a trend toward a difference (P = 0.097, R > 0) in that between control and HPOS groups, implying a more obvious shift in microbial composition caused by LPOS.

Fig. 4.

Fig. 4

Open in a new tab

β-Diversity analysis of gut microbiota in broilers (21 d) fed with pectic oligosaccharides with different degrees of polymerization. Data are presented as mean ± standard error of the mean.A, principal co-ordinates analysis (PCoA); B, β-diversity index based on weighted unifrac distance; C, analysis of similarity (ANOSIM), R > 0 indicates that inter-group differences exceed intra-group differences, with higher values indicating more distinct differences between groups. Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Taxonomic distribution: Firmicutes and Bacteroidota were the dominant phyla in the cecum of broilers (Fig. 5. A). Both LPOS and HPOS groups had higher abundance of Firmicutes coupled with lower abundance of Bacteroidota relative to control group. Alistipes, followed by Bacteroides and Faecalibacterium were the dominant genera in broiler cecum (Fig. 5. B). Compared with control group, LPOS group showed a reduction in Alistipes abundance accompanied by increases in Bacteroides and Faecalibacterium abundances, whilst HPOS group exhibited reduced abundances of these three genera together with increased abundances of the majority of the remaining genera.

Fig. 5.

Fig. 5

Open in a new tab

Gut microbial distribution at the phylum (A) and genus (B) levels in broilers (21 d) fed with pectic oligosaccharides with different degrees of polymerization.Data are presented as mean ± standard error of the mean.Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Differentially abundant taxa: LEfSe analysis identified differentially abundant taxa (LDA > 2.0, P < 0.05) among groups (Fig. 6). Only one taxa Alistipes was enriched in control group. In comparison, LPOS group was enriched with several microbial taxa, including the family Prevotellaceae, the genera Phascolarctobacterium, Faecalibacterium, and Alloprevotella, as well as the species Bifidobacterium pullorum, Anaerotignum lactatifermentans, Butyricicoccus pullicaecorum, and Enterococcus faecium. Strikingly, HPOS group was enriched with more beneficial taxa, such as the phylum Actinobacteriota, the order Lactobacillales, the genera Olsenella, Butyricimonas, Lactobacillus, Romboutsia, and Lachnospira, as well as the species Lactobacillus aviarius, Lactobacillus agilis, Lactobacillus helveticus, Bacteroides acidifaciens, Bacteroides thetaiotaomicron, and Bacteroides barnesiae.

Fig. 6.

Fig. 6

Open in a new tab

Identification of differentially abundant taxa in gut microbiota of broilers (21 d) across different groups based on linear discriminant analysis (LDA) combined with effect size measurements. Data are presented as mean ± standard error of the mean.Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Cecal concentrations of SCFAs

Cecal concentrations of propionic, valeric, isobutyric, and isovaleric acids were significantly higher (P < 0.05) in HPOS group than those in control group (Fig. 7). However, LPOS group only showed a significant increase (P < 0.05) in cecal isovaleric acid concentration concurrent with a numerical increase (P > 0.05) in cecal propionic acid concentration relative to control group. The concentrations of cecal acetic and butyric acids did not differ significantly (P > 0.05) among groups.

Fig. 7.

Fig. 7

Open in a new tab

Effects of pectic oligosaccharides with different degrees of polymerization on cecal concentrations of short-chain fatty acidsin broilers (21 d). Data are presented as mean ± standard error of the mean.a,bValues with different letters differ significantly (P < 0.05). Control, broilers were fed a basal diet; LPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with low degree of polymerization; HPOS, broilers were fed a basal diet supplemented with 600 mg/kg pectic oligosaccharide with high degree of polymerization.

Discussion

Intestinal development can be largely evaluated by morphological indices, such as relative intestinal weight and length, as well as intestinal villus morphology (e.g., VH, CD, and VCR) (Zhang et al., 2022). In this study, both LPOS and HPOS increased relative weight and length of the cecum, as well as tended to increase those of the duodenum coupled with relative length of the ileum. They also elevated duodenal VCR along with ileal VH and VCR. These observations suggested that LPOS and HPOS facilitated intestinal development in broilers, which were similar to previous reports on POS (Wang et al., 2019; Ling et al., 2026) in broilers. Although the microbial community in broiler duodenum is relatively low in abundance, it exhibits a complex interaction network (Feng et al., 2023). Within this network, specific beneficial bacteria, especially Lactobacillus spp. that predominate in the duodenum (Stamilla et al., 2021; Deng et al., 2026), are vital for sustaining broiler gut health (Liao et al., 2020; Deng et al., 2026). In this study, LPOS and HPOS might act in part as substrates to stimulate duodenal Lactobacillus growth (Yeung et al., 2021; Vásquez et al., 2024), subsequently boosting duodenal development in broilers (Liao et al., 2020). In fact, recent evidences have revealed the effectiveness of prebiotics in animal duodenum (Stanley et al., 2025). Given the longer chain length of HPOS than LPOS, HPOS might also remain relatively intact in the duodenum, where it possibly functioned as a ligand for specific signal receptors and then activated proliferation‑related signaling pathway in IECs (Zhao et al., 2020; Wang et al., 2024). This could explain why HPOS elevated duodenal VH more markedly than LPOS. The ileum and cecum are densely populated with microbes (Feng et al., 2023). Upon arrival at these segments, LPOS and HPOS were likely fermented by beneficial anaerobes to generate abundant metabolites, particularly SCFAs (Wang et al., 2026). These metabolites could supply energy to IECs and activate G‑protein‑coupled receptors that drive IEC proliferation (Aminullah et al., 2026), probably mediating the promoting effect of LPOS and HPOS on ileal and cecal development in broilers. Interestingly, LPOS was less effective than HPOS in increasing relative ileal weight but showed a superiority in increasing ileal VCR. We postulated that the shorter chain of LPOS rendered it more readily fermented by gut microbiota (Pan et al., 2026). The rapidly produced metabolites, especially SCFAs, might act earlier and more promptly on ileal villi, which exhibit high turnover rates (Neurath et al., 2025), thus leading to a more pronounced improvement in ileal villus morphology. Conversely, HPOS, due to its longer chain, was fermented more slowly but over a longer duration (Yeung et al., 2021; Pan et al., 2026). This action might enable the fermentation metabolites to exert more sustained effects on the ileum, thus better supporting the gradual process of increasing relative ileal weight.

Intestinal physical barrier consists of IECs and intercellular junctional complexes, among which TJ proteins, including Claudins, Occludin, and ZOs, serve as the core structural components (Neurath et al., 2025). POS supplementation has been reported to upregulate jejunal and ileal TJ protein expression in broilers (Mao et al., 2021; Ling et al., 2026). Similarly, this study showed that LPOS upregulated duodenal ZO‑1 expression, while HPOS upregulated ileal Claudin‑1 and ZO‑1 expression, demonstrating that these two oligosaccharides reinforced intestinal barrier integrity in a segment‑dependent manner. We speculated that the lower MW of LPOS rendered a relatively larger proportion susceptible to fermentation by duodenal Lactobacillus, a primary fermenter abundant in the duodenum (Stamilla et al., 2021). This fermentation would elevate duodenal lactate level and then promote TJ protein expression in this segment (Huang et al., 2021). On the contrary, HPOS, due to its higher MW, might preferentially reach the hindgut (ileum and cecum), where more diverse and abundant microbial communities exist. In such microenvironments, HPOS might be extensively fermented and favor the production of end‑products (SCFAs) (Tingirikari, 2018; Zhao et al., 2025b). This production could be partially supported by cecal SCFA data and might subsequently promote ileal TJ protein expression.

TJ determines intestinal permeability and restrains the translocation of luminal bacterial products into blood (Neurath et al., 2025). Accordingly, serum bacterial products, such as endotoxin and DLA, are the biomarkers of intestinal permeability (Tan et al., 2025). It was reported that POS alleviated lipopolysaccharide‑induced elevation in serum endotoxin level in broilers (Ling et al., 2026). Likewise, this study revealed that both LPOS and HPOS reduced serum endotoxin level, with HPOS also lowering serum DLA level. These results indicated that HPOS conferred an advantage over LPOS in reducing intestinal permeability. Considering the higher microbial density in the ileum than the duodenum (Feng et al., 2023), we deduced that HPOS‑elicited upregulation of ileal TJ proteins (Claudin‑1 and ZO‑1) better reduced intestinal permeability and limited microbial product translocation when compared with LPOS‑elicited upregulation of duodenal ZO‑1.

Gut microbiota exerts close linkages with intestinal development and function of poultry (Liao et al., 2020; Ducatelle et al., 2023). Among the various intestinal compartments, the cecum exhibits the highest microbial diversity and abundance in chickens (Stamilla et al., 2021; Feng et al., 2023). In this study, cecal microbial α-diversity, including richness and evenness, was first assessed. The results indicated that LPOS increased only the Simpson index, while HPOS elevated the observed ASV, Chao1 index, Shannon index, and Simpson index. These results revealed a superiority of HPOS over LPOS in increasing cecal microbial richness and evenness, which could better maintain microbial stability (Spragge et al., 2023). Similarly, an ex vivo fermentation study indicated that high‑DP fructan was more effective than low‑DP fructan in increasing human gut microbial α-diversity, with these inulin fractions showing greater efficacy than fructooligosaccharide (Astó et al., 2019). We also found that HPOS (rather than LPOS) elevated the PD whole tree, an indicator of phylogenetic breadth (Liu et al., 2026b), suggesting that cecal microbiota in HPOS group was more evolutionarily diverse. Integrating all α‑diversity indexes, we inferred that HPOS was more beneficial than LPOS for weakening the predominance of originally dominant taxa in broiler cecum. Such action could propel the release and differentiation of ecological niches, allowing the growth of relatively rare taxa with distinct evolutionary backgrounds (Yao et al., 2025). This inference was supported by cecal microbial distribution data, which disclosed that LPOS reduced the abundance of the top‑ranked genus (Alistipes) but elevated the abundances of second‑ to fifth‑ranked genera (Bacteroides, Faecalibacterium, Negativibacillus, and Phascolarctobacterium). In comparison, HPOS decreased the abundances of top three genera while elevating the abundances of most genera ranked fourth and beyond. A potential explanation was that oligosaccharides with longer chain were slowly and progressively fermented, which provided stepwise substrates for microbial taxa occupying different niches (Pascale et al., 2022; Pan et al., 2026), supporting a richer and more diverse community. This could interpret the observed advantage of HPOS over LPOS in elevating cecal microbial α‑diversity.

Unlike α‑diversity, β‑diversity reflects the dissimilarity between communities (Liao et al., 2020; Feng et al., 2023). In this study, we employed multiple metrics to evaluate cecal microbial β‑diversity. PCoA and ANOSIM revealed a greater separation of cecal microbiota in LPOS group from control group than that in HPOS group, indicating that POS, especially LPOS, reshaped cecal microbiota. This was analogous to a previous finding that fructooligosaccharide reshaped human gut microbiota more profoundly than fructan (Astó et al., 2019). Further analysis showed that LPOS, instead of HPOS, lowered the within‑group β‑diversity index of cecal microbiota, implying that LPOS exerted a stronger and directional reshaping effect that diminished dispersion or heterogeneity among individuals within the group. It was potential that the shorter chain of LPOS allowed it to rapidly stimulate several specific microbes prevalent across different individuals, thus driving cecal microbial communities of different individuals toward a relatively homogeneous state (Van den Abbeele et al., 2023). A similar finding was described for alginate oligosaccharide (Liu et al., 2026a) and pectin (Van den Abbeele et al., 2023). Although the directional reshaping effect rendered cecal microbiota of LPOS group more distinct from that of control group, this effect might weaken microbial α‑diversity enhancement (as reflected by the elevation of only Simpson index in LPOS group). A similar phenomenon was also observed in other biological communities (He et al., 2025). In contrast to LPOS, the longer chain of HPOS rendered it unlikely to be rapidly and predominantly utilized by a few microbial taxa, thus maintaining inter‑individual heterogeneity of microbial communities within the group (as reflected by the unchanged β‑diversity index in HPOS group).

LEfSe analysis revealed that HPOS enriched a broader range of bacterial taxa in broiler cecum than LPOS, further supporting the advantage of HPOS over LPOS in enhancing cecal microbial α‑diversity. Analogously, Xiao et al. (2025) found that high‑DP fructan was more effective than fructooligosaccharide in enriching specific bacteria and increasing microbial richness in mice colon. Notably, the enriched taxa in LPOS group included several gut health‑promoting bacteria, such as the family Prevotellaceae (Tajasuwan et al., 2023), the genera Phascolarctobacterium, Faecalibacterium, and Alloprevotella (Tajasuwan et al., 2023; Zhao et al., 2025a), together with several putative probiotics (e.g., Bifidobacterium pullorum, Anaerotignum lactatifermentans, Butyricicoccus pullicaecorum, and Enterococcus faecium). Likewise, Mao et al. (2021) reported that POS supplementation increased cecal Phascolarctobacterium abundance in broiler breeders. Since Phascolarctobacterium and Alloprevotella are potential producers of isovaleric acid (Fan et al., 2019; Wang et al., 2025), their increased abundances might contribute to the elevation in cecal isovaleric acid content observed in LPOS group. Relative to LPOS, HPOS enriched more beneficial bacteria capable of directly improving intestinal homeostasis or generating SCFAs, including the phylum Actinobacteriota (Binda et al., 2018), the order Lactobacillales (Zhang et al., 2025a), accompanied by the genera Olsenella (Chen et al., 2022), Butyricimonas (Liu et al., 2018a), Lactobacillus (Liao et al., 2020), Romboutsia (Liu et al., 2018a), and Lachnospira (Bang et al., 2018). Furthermore, HPOS enriched plentiful probiotic candidates, among which Lactobacillus aviarius (Hong et al., 2021), Lactobacillus agilis (Hong et al., 2021), Lactobacillus helveticus (Zhang et al., 2025c), Bacteroides acidifaciens (Li et al., 2022), Bacteroides thetaiotaomicron (Zhang et al., 2025b), and Bacteroides barnesiae (Pu et al., 2022) could promote intestinal development or protect intestinal morphology. Strikingly, HPOS‑induced enrichments of Lachnospira and Bacteroides thetaiotaomicron aligned with previous reports showing that in vitro fermentation of pectic polysaccharides markedly increased these bacteria (Bang et al., 2018; Tingirikari et al., 2019).

As the key metabolites derived from gut microbiota, SCFAs are mainly produced in the hindgut and can sustain intestinal development of chickens throughout the growth period (Liao et al., 2020). A previous study disclosed that alginate oligosaccharide elevated intestinal SCFA contents in mice, with isovaleric acid being one of the two major products (Teng et al., 2024). In this study, LPOS increased cecal isovaleric acid concentration, while HPOS elevated cecal concentrations of propionic, valeric, isobutyric, and isovaleric acids. These findings confirmed the superiority of HPOS over LPOS in optimizing cecal fermentation pattern, which could be associated with the observed enhancement of cecal microbial α-diversity in HPOS group. Similarly, Wallace et al. (2026) observed that xylooligosaccharide with higher DP was more conducive to improving broiler cecal fermentation. It appeared that longer chain oligosaccharides allowed a greater proportion to reach the hindgut and continuously nourish the resident microbiota (Tingirikari, 2018; Pan et al., 2026), therefore better modulating cecal fermentation pattern. It is known that propionic, valeric, isobutyric, and isovaleric acids impel intestinal development in animals (Liu et al., 2018b; Zhou et al., 2019). Consequently, the increased cecal isovaleric acid concentration might partially account for the observed elevations in relative cecal weight and length caused by both LPOS and HPOS. Likewise, the elevated concentrations of cecal propionic, valeric, and isobutyric acids could also contribute to these developmental changes of the cecum in HPOS group. Intriguingly, LPOS did not broadly increase cecal SCFA concentrations, although it enriched several beneficial bacteria in the cecum. It was assumed that LPOS caused only a moderate increase in SCFA production, and most of the produced SCFAs were subsequently absorbed by cecal epithelial cells, which might be responsible for the unaltered concentrations of the primary SCFAs (acetic, propionic, butyric, and valeric acids) in cecal lumen of LPOS group (Montoya et al., 2016; Sakata, 2019). Comparatively, HPOS likely triggered a greater production of SCFAs. Even if a large portion of these SCFAs were absorbed by cecal epithelial cells, the remaining SCFAs might still be sufficient to elevate their concentrations in cecal lumen, presumably explaining the increases in multiple SCFAs of cecal lumen observed in HPOS group.

Strikingly, although LPOS and HPOS improved broiler gut health, they did not significantly improve broiler growth performance. This result contrasted with previous findings that supplemental 400 mg/kg POS tended to increase ADG and reduce ADFI in aflatoxin B₁‑exposed broilers from 1-21 d of age (Ye et al., 2025), and that 600 mg/kg POS increased FBW and ADG in lipopolysaccharide‑challenged broilers over the same period (Ling et al., 2026). Such discrepancies could be attributed to variations in the physiological states of broilers. It has been recognized that functional feed additives prefer to benefit growth performance of poultry under stressed state (Abdelli et al., 2021). Regarding POS, it might be more favorable in eliciting growth‑promoting effects when broilers were subjected to specific stressors (Chen et al., 2017; Ling et al., 2026). Under non‑stressed state, however, the margin for POS‑mediated growth improvement was relatively narrow, as broilers might have already attained optimal performance. This assumption could be supported by previous reports, which indicated that certain oligosaccharides improved intestinal health (including histomorphology and barrier function) without translating into growth performance gains in broilers (Wang et al., 2020; Lan et al., 2024; Ruangpanit et al., 2025). Nevertheless, our results revealed that LPOS and HPOS tended to lower ADFI and numerically reduced FCR of broilers from 1-21 d of age, implying a potential of them to reduce feed costs during the early growth phase of broilers. Because only two POS preparations with different DPs were successfully obtained in this study, we compared the effects of these two POS preparations, which did not differ markedly with respect to many of the measured parameters. Future studies are needed to compare the application effects of POS with a broader range of DPs in poultry, particularly in birds subjected to intestinal injury stress. Besides, dose-response studies are warranted to compare the effects of POS preparations differing in DP and to determine the optimal dose for each preparation.

Conclusions

Supplementation of both LPOS and HPOS ameliorated intestinal histomorphology in broilers, but HPOS was more effective than LPOS in strengthening intestinal barrier integrity and optimizing gut microbial community structure. Specifically, LPOS reduced inter‑individual heterogeneity of cecal microbial communities potentially via exerting a directional reshaping effect. By contrast, HPOS maintained inter‑individual heterogeneity of cecal microbial communities, as well as exhibited a superiority over LPOS in increasing microbial α-diversity and enriching beneficial bacteria in the cecum, thereby better favoring the production of certain SCFAs (propionic, valeric, and isobutyric acids). These findings emphasize an influence of DP on the efficacy of POS in promoting broiler gut health, which is expected to provide a basis for the application of DP‑optimized POS in poultry production.

Ethics declaration

This study was conducted in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. This study was approved by the Institutional Animal Care and Use Committee of South China Agricultural University .

Author contributions

Chong Ling designed the experimental protocols and wrote the manuscript draft. Jiarong Fang acquired and analyzed the experimental data, and contributed to the writing of the manuscript draft. Songtao Liu contributed to data acquisition and analysis, and critically reviewed the manuscript for crucial intellectual content. Shitang Zhang contributed to data interpretation and critically reviewed the manuscript for crucial intellectual content. Furui Liang contributed to data analysis and validation, and critically reviewed the manuscript for crucial intellectual content. Hui Ye contributed to data analysis and visualization, and critically reviewed the manuscript for crucial intellectual content. Qingyun Cao contributed to data analysis and curation, and critically reviewed the manuscript for crucial intellectual content. Jianjun Zuo contributed to the experimental design and data interpretation, critically reviewed the manuscript for crucial intellectual content, and provided funding support for data collection. Weiwei Wang developed the research concept, planned the overall research approach, critically reviewed and revised the manuscript, and provided funding support for data collection. All authors have read and approved the exact, final version of the manuscript. All authors agree to be personally and publicly responsible for all aspects of this work, and to ensure that questions regarding the accuracy or integrity of this work are thoroughly investigated and resolved.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This study was financially supported by Guangdong Basic and Applied Basic Research Foundation (No. 2025A1515012884), National Natural Science Foundation of China (No. 32573263), and Key Areas Research & Development Program of Guangdong Province (No. 2026B0202150001).

Contributor Information

Jianjun Zuo, Email: zuoj@scau.edu.cn.

Weiwei Wang, Email: wangweiwei@scau.edu.cn.

References

  1. Abdelli N., Solà-Oriol D., Pérez J.F. Phytogenic feed additives in poultry: achievements, prospective and challenges. Animals. 2021;11:3471. doi: 10.3390/ani11123471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aminullah N., Langar H., Mahaq O., Azizi M.N., Zahir A. Microbial ecology, functional implications, and associated factors influencing poultry intestinal health. Vet. Immunol. Immunopathol. 2026;293 doi: 10.1016/j.vetimm.2026.111065. [DOI] [PubMed] [Google Scholar]
  3. Astó E., Méndez I., Rodríguez-Prado M., Cuñé J., Espadaler J., Farran-Codina A. Effect of the degree of polymerization of fructans on ex vivo fermented human gut microbiome. Nutrients. 2019;11:1293. doi: 10.3390/nu11061293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bang S.J., Kim G., Lim M.Y., Song E.J., Jung D.H., Kum J.S., Nam Y.D., Park C.S., Seo D.H. The influence of in vitro pectin fermentation on the human fecal microbiome. AMB Express. 2018;8:98. doi: 10.1186/s13568-018-0629-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Binda C., Lopetuso L.R., Rizzatti G., Gibiino G., Cennamo V., Gasbarrini A. Actinobacteria: a relevant minority for the maintenance of gut homeostasis. Dig. Liver Dis. 2018;50:421–428. doi: 10.1016/j.dld.2018.02.012. [DOI] [PubMed] [Google Scholar]
  6. Chen H., Hu H.Y., Chen D.W., Tang J., Yu B., Luo J.Q., He J., Luo Y.H., Yu J., Mao X.B. Dietary pectic oligosaccharide administration improves the growth performance and immunity in weaned pigs infected by rotavirus. J. Agric. Food Chem. 2017;65:2923–2929. doi: 10.1021/acs.jafc.7b00039. [DOI] [PubMed] [Google Scholar]
  7. Chen Q.X., Yin Q.L., Xie Q.G., Jiang C.Q., Zhou L.Y., Liu J., Li B.L., Jiang S.L. 2′-Fucosyllactose promotes the production of short-chain fatty acids and improves immune function in human-microbiota-associated mice by regulating gut microbiota. J. Agric. Food Chem. 2022;70:13615–13625. doi: 10.1021/acs.jafc.2c04410. [DOI] [PubMed] [Google Scholar]
  8. De Alencar J.C.G., Pinto G.T.D., Silva K.F.C.E., Santos J.M.S., Hubinger M.D., Bicas J.L., Marostica M.R., Jr., Petkowicz C.L.D., Paulino B.N. Pectin and pectic oligosaccharides (POS): recent advances for extraction, production, and its prebiotic potential. Trends Food Sci. Tech. 2025;155 [Google Scholar]
  9. Deng Z.C., Huang Y.X., Cao K.X., Peng Z., Refaie A., Khalil M.M., Zhao L., Guan L.L., Sun L.H. Microbiome Published online; 2026. Duodenal resident Limosilactobacillus Improves Feed Efficiency Through Ornithine-Mediated Optimization of Gut Microbiota and Nutrient Absorption Via the Nrf2 Signaling. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ducatelle R., Goossens E., Eeckhaut V., Immerseel F.V. Poultry gut health and beyond. Anim. Nutr. 2023;13:240–248. doi: 10.1016/j.aninu.2023.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fan, C.N., Li, S.J., Wang, R., Fan, X.Q., Liang, A.M., Qi, K.M., 2019. SCFA producing bacteria shape the subtype of ADHD in children. Preprint.
  12. Feng Y., Zhang M., Liu Y., Yang X.Y., Wei F.X., Jin X.L., Liu D., Guo Y.M., Hu Y.F. Vol. 2. iMeta; 2023. (Quantitative Microbiome Profiling Reveals the Developmental Trajectory of the Chicken Gut Microbiota and Its Connection To Host Metabolism). [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. He J.K., Yi J.F., Holyoak M., Goodale E., Yu J.H., Liu W., Zhang Q., Xu H.G. Decade-long bird trends in China: stable species richness but increasing biotic homogenization. Glob. Change Biol. 2025;31 doi: 10.1111/gcb.70654. [DOI] [PubMed] [Google Scholar]
  14. Hong Y., Zhou Z., Yu L.Z., Jiang K.Y., Xia J.M., Mi Y.L., Zhang C.Q., Li J. Lactobacillus salivarius and Lactobacillus agilis feeding regulates intestinal stem cells activity by modulating crypt niche in hens. Appl. Microbiol. Biotechnol. 2021;105:8823–8835. doi: 10.1007/s00253-021-11606-2. [DOI] [PubMed] [Google Scholar]
  15. Huang Y.P., Zhang J.L., Dong R.J., Ji X.W., Jiang Y.S., Cen J.K., Bai Z.H., Hong K.R., Li H.H., Chen J.J., Zhou J.H., Qian F.Y., Wang F.Y., Qu Y., Zhou Y. Lactate as a metabolite from probiotic lactobacilli mitigates ethanol-induced gastric mucosal injury: an in vivo study. BMC Complement. Med. Ther. 2021;21:1–10. doi: 10.1186/s12906-020-03198-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lan R.X., Wu F., Wang Y.C., Lin Z.W., Wang H.X., Zhang J., Zhao Z.H. Chitosan oligosaccharide improves intestinal function by promoting intestinal development, alleviating intestinal inflammatory response, and enhancing antioxidant capacity in broilers aged d 1 to 14. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Li X.Y., Peng X.X., Qiao B., Peng M.J., Deng N., Yu R., Tan Z.J. Gut-kidney impairment process of adenine combined with Folium sennae-induced diarrhea: association with interactions between Lactobacillus intestinalis, Bacteroides acidifaciens and acetic acid, inflammation, and kidney function. Cells. 2022;11:3261. doi: 10.3390/cells11203261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liao X.D., Shao Y.X., Sun G.M., Yang Y.F., Zhang L.Y., Guo Y.L., Luo X.G., Lu L. The relationship among gut microbiota, short-chain fatty acids, and intestinal morphology of growing and healthy broilers. Poult. Sci. 2020;99:5883–5895. doi: 10.1016/j.psj.2020.08.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ling C., Li Y., Fang J.R., Dong Z.M., Zhang C.M., Ye H., Cao Q.Y., Zuo J.J., Wang W.W. Supplementation of pectic oligosaccharide alleviates lipopolysaccharide-induced intestinal inflammatory damages and impairment of growth performance in broilers. Anim. Nutr. 2026;25:186–195. doi: 10.1016/j.aninu.2025.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Liu J., Yue S.J., Yang Z.R., Feng W.W., Meng X.T., Wang A.T., Peng C., Wang C.Y., Yan D. Oral hydroxysafflor yellow A reduces obesity in mice by modulating the gut microbiota and serum metabolism. Pharmacol. Res. 2018;134:40–50. doi: 10.1016/j.phrs.2018.05.012. [DOI] [PubMed] [Google Scholar]
  21. Liu Q., Wang C., Zhang Y.L., Pei C.X., Zhang S.L., Guo G., Huo W.J., Yang W.Z. Effects of isovalerate supplementation on morphology and functional gene expression of small intestine mucosa in pre- and post-weaned dairy calves. J. Agric. Sci. 2018;156:272–281. [Google Scholar]
  22. Liu S., Wu Y., Lv Y., Shao M., Lv D., Li Q., Shang Q. Fermentation of structurally defined alginate oligosaccharides by the human gut microbiota enriched in Bifidobacterium, Bacteroides, Faecalibacterium, or Blautia. Mar. Drugs. 2026;24:239. doi: 10.3390/md24070239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu Y.Y., Xia F., Zhou J.T. Assessing whether rectal swabs reflect appendiceal microbiota profiles in acute appendicitis: a 16S rRNA-based comparative study. Gut. Pathog. 2026;18:1. doi: 10.1186/s13099-025-00794-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  25. Mao X.B., Ding X.M., Zeng Q.F., Bai S.P., Zhang K.Y., Chen D.W., Yu B., He J., Yu J., Yan H., Luo J.Q., Luo Y.H., Wang J.P. The effect of dietary pectic oligosaccharide supplementation on intestinal health of broiler breeders with different egg-laying rates. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2020.12.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Montoya C.A., Rutherfurd S.M., Moughan P.J. Kiwifruit fibre level influences the predicted production and absorption of SCFA in the hindgut of growing pigs using a combined in vivo-in vitro digestion methodology. Br. J. Nutr. 2016;115:1317–1324. doi: 10.1017/S0007114515002883. [DOI] [PubMed] [Google Scholar]
  27. Neurath M.F., Artis D., Becker C. The intestinal barrier: a pivotal role in health, inflammation, and cancer. Lancet Gastroenterol. 2025;10:573–592. doi: 10.1016/S2468-1253(24)00390-X. [DOI] [PubMed] [Google Scholar]
  28. Pan Y., Wang Y., Liu Z., Liang T., Chang Z., Wang Q., Pan Q., Jiang Y., Li Z., Gao M. Controlled biosynthesis of curdlan oligosaccharides with tunable degree of polymerization and their prebiotic effects on gut microbiota. Bioresour. Technol. 2026;458 doi: 10.1016/j.biortech.2026.135020. [DOI] [PubMed] [Google Scholar]
  29. Pascale N., Gu F., Larsen N., Jespersen L., Respondek F. The potential of pectins to modulate the human gut microbiota evaluated by in vitro fermentation: a systematic review. Nutrients. 2022;14:3629. doi: 10.3390/nu14173629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Prusty S., Dubey M., Gendley M., Bhagat V., Bisen S., Verma S. Agricultural by-products-derived oligosaccharides as prebiotic feed additives in poultry. World's Poult. Sci. J. Online. 2026:1–23. [Google Scholar]
  31. Pu G., Hou L.M., Du T.R., Zhou W.D., Liu C.X., Niu P.P., Wu C.W., Bao W.B., Huang R.H., Li P.H. Increased proportion of fiber-degrading microbes and enhanced cecum development jointly promote host to digest appropriate high-fiber diets. mSystems. 2022;8 doi: 10.1128/msystems.00937-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ren L.L., Cao Q.Y., Ye H., Dong Z.M., Zhang C.M., Yan F., Zhou Y.P., Zhou H.Y., Zuo J.J., Wang W.W. The single degree of polymerization influences the efficacy of xylooligosaccharides in shaping microbial and metabolite profiles in chicken gut to combat avian pathogenic Escherichia coli. BMC Microbiol. 2025;25:227. doi: 10.1186/s12866-025-03948-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Rezaei S., Faseleh Jahromi M., Liang J.B., Zulkifli I., Farjam A.S., Laudadio V., Tufarelli V. Effect of oligosaccharides extract from palm kernel expeller on growth performance, gut microbiota and immune response in broiler chickens. Poult. Sci. 2015;94:2414–2420. doi: 10.3382/ps/pev216. [DOI] [PubMed] [Google Scholar]
  34. Ruangpanit Y., Rassmidatta K., Philatha A., Saothong P., Sompugdee C., Phungkeha P., Srikijkasemwat K., Adeyemi K.D., Sulaimon R.O., Sivapirunthep P. Effects of fructooligosaccharide administration routes on growth performance, gut integrity, microbiota, and meat quality in broiler chickens exposed to reused litter. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sakata T. Pitfalls in short-chain fatty acid research: a methodological review. Anim. Sci. J. 2019;90:3–13. doi: 10.1111/asj.13118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shani M.A., Irani M. Feeding strategy and prebiotic supplementation: effects on immune responses and gut health in the early life stage of broiler chickens. Res. Vet. Sci. 2024;171 doi: 10.1016/j.rvsc.2024.105226. [DOI] [PubMed] [Google Scholar]
  37. Spragge F., Bakkeren E., Jahn M.T., Araujo E.B.N., Pearson C.F., Wang X.D., Pankhurst L., Cunrath O., Foster K.R. Microbiome diversity protects against pathogens by nutrient blocking. Science. 2023;382 doi: 10.1126/science.adj3502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Stamilla A., Ruiz-Ruiz S., Artacho A., Pons J., Messina A., Randazzo C.L., Caggia C., Lanza M., Moya A. Analysis of the microbial intestinal tract in broiler chickens during the rearing period. Biology. 2021;10:942. doi: 10.3390/biology10090942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Stanley J.S., Mansbridge S.C., Bedford M.R., Connerton I.F., Mellits K.H. Prebiotic xylo-oligosaccharides modulate the gut microbiome to improve innate immunity and gut barrier function and enhance performance in piglets experiencing post-weaning diarrhoea. Microorganisms. 2025;13:1760. doi: 10.3390/microorganisms13081760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tajasuwan L., Kettawan A., Rungruang T., Wunjuntuk K., Prombutara P. Role of dietary defatted rice bran in the modulation of gut microbiota in AOM/DSS-induced colitis-associated colorectal cancer rat model. Nutrients. 2023;15:1528. doi: 10.3390/nu15061528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tan L.X., Li Y., Ding C.L., Qian J.J., Cui X.F. Serum biomarkers of intestinal barrier dysfunction predict postoperative endoscopic recurrence in Crohn’s disease patients. BMC Gastroenterol. 2025;25:668. doi: 10.1186/s12876-025-04273-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Teng Y., Li J.H., Guo J., Yan C.H., Wang A.L., Xia X.D. Alginate oligosaccharide improves 5-fluorouracil-induced intestinal mucositis by enhancing intestinal barrier and modulating intestinal levels of butyrate and isovalerate. Int. J. Biol. Macromol. 2024;276 doi: 10.1016/j.ijbiomac.2024.133699. [DOI] [PubMed] [Google Scholar]
  43. Tingirikari J.M.R. Microbiota-accessible pectic poly- and oligosaccharides in gut health. Food Funct. 2018;9:5059–5073. doi: 10.1039/c8fo01296b. [DOI] [PubMed] [Google Scholar]
  44. Tingirikari J.M.R. In-vitro prebiotic analysis of microbiota accessible pectic polysaccharides. Curr. Microbiol. 2019;76:1452–1460. doi: 10.1007/s00284-019-01781-x. [DOI] [PubMed] [Google Scholar]
  45. Van den Abbeele P., Deyaert S., Albers R., Baudot A., Mercenier A. Carrot RG-I reduces interindividual differences between 24 adults through consistent effects on gut microbiota composition and function ex vivo. Nutrients. 2023;15:2090. doi: 10.3390/nu15092090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Vásquez P., Stucken K., Garcia-Martin A., Ladero M., Bolivar J.M., Bernal C. Enzymatic production, physicochemical characterization, and prebiotic potential of pectin oligosaccharides from pisco grape pomace. Int. J. Biol. Macromol. 2024;281 doi: 10.1016/j.ijbiomac.2024.136302. [DOI] [PubMed] [Google Scholar]
  47. Wallace A.D., Bedford M.R., González-Ortiz G., Morgan N.K. Influence of fraction size on the efficacy of xylo-oligosaccharides in broiler chicken diets. Anim. Nutr. 2026;25:246. doi: 10.1016/j.aninu.2025.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang Q., Wang X.F., Xing T., Li J.L., Zhu X.D., Zhang L., Gao F. The combined influence of xylo-oligosaccharides and gamma-irradiated Astragalus polysaccharides on growth performance and intestinal mucosal barrier function of broilers. Poult. Sci. 2020;100 doi: 10.1016/j.psj.2020.11.075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang Q.Q., Lu Q.C., Tang Y.Q., Li Q.Y., Gao P.Y., Pang S.Y., Zhang W.J., Nie C.X., Niu J.L., Ma X.L. Integrated 16S rDNA-Seq and metabolomics reveal seasonal dynamics of gut microbial-SCFA-immune crosstalk in diarrheic calves. Front. Vet. Sci. 2025;12 doi: 10.3389/fvets.2025.1615310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wang W.W., Liu S.T., Zhang S.T., Li Y., Zuo J.J. The promise of pectic oligosaccharides as a novel sustainable additive in poultry production: a systematic review. Poult. Sci. 2026;105 doi: 10.1016/j.psj.2026.106704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang X.R., Li L., Liu T.J., Shi Y.Y. More than nutrition: therapeutic potential and mechanism of human milk oligosaccharides against necrotizing enterocolitis. Life Sci. 2024;339 doi: 10.1016/j.lfs.2024.122420. [DOI] [PubMed] [Google Scholar]
  52. Wang Z.C., Yu H.M., Xie J.J., Cui H., Gao X.H. Effect of pectin oligosaccharides and zinc chelate on growth performance, zinc status, antioxidant ability, intestinal morphology and short-chain fatty acids in broilers. J. Anim. Physiol. Anim. Nutr. 2019;103:935–946. doi: 10.1111/jpn.13076. [DOI] [PubMed] [Google Scholar]
  53. Wilkowska A., Nowak A., Motyl I., Oracz J. The molecular weight of enzymatically modified pectic oligosaccharides from apple pomace as a determinant for biological and prebiotic activity. Molecules. 2025;30:46. doi: 10.3390/molecules30010046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Xiao Y.Q., Zhao Q.Y., Ni D.W., Zhang X.Q., Hao W., Yuan Q., Xu W., Mu W.M., Wu D.T., Wu X., Wang S.P. Polymerization of dietary fructans differentially affects interactions among intestinal microbiota of colitis mice. ISME J. 2025;19 doi: 10.1093/ismejo/wrae262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Yao L., Shujie C., Wenxin F., Wupeng X., Xin L., Laws E.A., Huang B.Q. Coupling between bacterial phylogenetic diversity and heterotrophic productivity in a coastal ecosystem affected by estuarine plumes. ISME Commun. 2025;5 doi: 10.1093/ismeco/ycaf102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Ye Z.Q., Qin Y.Z., Zhang H.J., Xian M.T., Ye H., Cao Q.Y., Dong Z.M., Zhang C.M., Zuo J.J., Wang W.W. Effects of pectic oligosaccharide on growth performance, organ indexes and intestinal health in broilers exposed to aflatoxin B1. Poult. Science. 2025;104 doi: 10.1016/j.psj.2025.105668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yeung Y.K., Kang Y., So B.R., Jung S.K., Chang Y.H. Structural, antioxidant, prebiotic and anti-inflammatory properties of pectic oligosaccharides hydrolyzed from okra pectin by Fenton reaction. Food Hydrocoll. 2021;118 [Google Scholar]
  58. Zhang H., Luan Y.S., Gao Q., Zhang B., Hong W.H. An optimized probiotic formulation achieves sustained gut microbiota modulation and attenuates dextran sulfate sodium-induced colitis in mice. J. Med. Food. 2025;28:1025–1032. doi: 10.1089/jmf.2025.k.0023. [DOI] [PubMed] [Google Scholar]
  59. Zhang Q.Y., Zhang S., Shi S.R. Supplementing the early diet of broilers with soy protein concentrate can improve intestinal development and enhance short-chain fatty acid-producing microbes and short-chain fatty acids, especially butyric acid. J. Anim. Sci. Biotechnol. 2022;13:1. doi: 10.1186/s40104-022-00749-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhang S.S., Sun Y.G., Bian X.Y., Liu F.W., Nie S.P. Larch arabinogalactan alleviates colitis by modulating gut microbiota and promoting Bacteroides thetaiotaomicron. J. Agric. Food Chem. 2025;73:30304–30315. doi: 10.1021/acs.jafc.5c09920. [DOI] [PubMed] [Google Scholar]
  61. Zhang Z., Lv J.M., Wang X., Chun L., Yang Q.N., Zhao H.R., Xue S.M., Zhang Z.Y., Liu X.B., Wang S.W., Sun Y.M. Lactobacillus helveticus mitigates diarrhea and inflammation induced by enterotoxigenic E. coli through rebalance of gut microbiota. Curr. Res. Food Sci. 2025;11 doi: 10.1016/j.crfs.2025.101147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zhao M.S., Lin F.Q., Peng S., Ma Y.X., Wu H.N., Li Z.L. Effects of soybean meal fermented by Lactobacillus plantarum NX69 on growth performance and intestinal health of nursery pigs. Fermentation. 2025;11:235. [Google Scholar]
  63. Zhao Y., Feng Y.N., Liu M., Chen L., Meng Q.S., Tang X.F., Wang S.K., Liu L., Li L., Shen W., Zhang H.F. Single-cell RNA sequencing analysis reveals alginate oligosaccharides preventing chemotherapy-induced mucositis. Mucosal Immunol. 2020;13:437–448. doi: 10.1038/s41385-019-0248-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zhao Y.Y., Aru V., Wang D., Wang P., Qin P.Y., Jiang Q.Q., Li Z.D., Engelsen S.B., Zhao X.Y. Deciphering the interplay between pectin structural variability, intestinal bioavailability and gut microbiota metabolism: a review. Carbohydr. Polym. 2025;360 doi: 10.1016/j.carbpol.2025.123596. [DOI] [PubMed] [Google Scholar]
  65. Zhou Z.R., Zhang J., Zhang X.L., Mo S.L., Tan X., Wang L.X., Li J.Z., Li Y.L., Ding X.Q., Liu X.Y., Ma X.Q., Yang H.S., Yin Y.L. The production of short chain fatty acid and colonic development in weaning piglets. J. Anim. Physiol. Anim. Nutr. 2019;103:1530–1537. doi: 10.1111/jpn.13164. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES