Administration of injectable platelet-rich fibrin improved repair of thin endometrium via mitochondria in a rat model

Abstract

Background

Thin endometrium(TE) has been widely recognized as a critical factor contributing to reduced success rates of assisted reproductive technology (ART). In recent years, platelet-rich plasma (PRP) has been extensively employed in the treatment of thin endometrium; however, its underlying mechanisms remain poorly understood, and its clinical efficacy remains controversial. Given the superior therapeutic outcomes demonstrated by platelet concentrates (PCs) in regenerative medicine, the present study aimed to investigate the therapeutic potential and mechanistic basis of injectable platelet-rich fibrin (i-PRF) in an ethanol‑induced rat model of thin endometrium.

Methods

i-PRF was prepared from human blood and characterized for growth factor release and microstructure. Rats were divided into control, Model, Ethanol + NS, and Ethanol+i-PRF groups.Endometrial morphology was assessed by H&E and immunohistochemistry. Receptivity was evaluated by LIF/VEGF expression and embryo implantation counts. In vitro, endometrial stromal cells (ESCs) were co-cultured with platelets, and mitochondrial transfer was tracked using MitoTracker^®. Platelet mitochondrial respiration was inhibited with oligomycin/FCCP to assess functional contribution.

Results

i-PRF released VEGF-A, TGF-β1, and PDGF-AB for up to 15 days (peak at 7 days), with a dense fibrin network entrapping abundant platelets. Ethanol injection significantly reduced endometrial thickness from 409.27 ± 55.86 μm to 104.48 ± 57.03 μm and decreased gland number from 22.4 ± 4.34 to 9.2 ± 3.77 (both p < 0.05).Administration of i-PRF reversed these pathological changes, restoring endometrial thickness to 464.11 ± 27.1 μm and gland count to 29.0 ± 9.41 (*p* < 0.05 vs. model). Immunohistochemical analysis revealed that i-PRF treatment increased the abundance of vimentin⁺,cytokeratin 18⁺ (CK-18⁺) and ki-67⁺ cells and enhanced the expression of leukemia inhibitory factor (LIF) and vascular endothelial growth factor (VEGF). Compared with the model group, the Ethanol + i‑PRF group exhibited a markedly higher embryo number (3.88 ± 3.91, P < 0.001); although this value was lower than that of the control group (5.00 ± 3.46), the difference did not reach statistical significance (P > 0.05).  In vitro co-culture of endometrial stromal cells (ESCs) with platelets promoted ESC proliferation and VEGF secretion. Confocal microscopy confirmed the direct transfer of platelet mitochondria to ESCs. Inhibition of platelet mitochondrial respiration did not block ESC proliferation but significantly suppressed VEGF and vimentin expression (p < 0.05).

Conclusions

i-PRF effectively repairs thin endometrium in a rat model, and mitochondrial transfer from platelets to ESCs plays a key role in promoting endometrial regeneration. These findings support i-PRF as a promising therapy for TE.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s13287-026-05181-4.

Background

A well-developed embryo and a thick endometrium with good receptivity are two key conditions for successful embryo implantation. From a physiological perspective, the human endometrium has a strong regenerative ability to maintain pregnancy. A thin endometrium(TE) refers to a thickness of less than 7 millimeters as determined by ultrasound examination [1], which is closely related to adverse outcomes of assisted reproductive treatment [2, 3]. The incidence of a thin endometrium in assisted reproductive treatment ranges from 1% to 2.5% [4], but this figure is actually severely underestimated because many cycles that were cancelled before embryo transfer due to insufficient endometrial thickness were not actually included in the statistics. TE may occur alone or be caused by damage from endometrial surgeries (including diseases such as endometrial adhesions).

Although a variety of approaches (i.e., estrogen [5], low-dose aspirin [6], or granulocyte colony-stimulating factor [7]) have been attempted to improved outcomes in patients with TE, their results remain controversial. In the field of regenerative medicine, platelet-rich plasma (PRP) that derived from autologous whole blood has emerged as a promising therapeutic approach for tissue repair. As the second generation of PRP, platelet-rich fibrin (PRF) is generated by centrifugation of whole blood without the use of anticoagulant or bovine platelet activators, which have been implicated in suppressing tissue regeneration [8]. In previous reports, we have reported the efficacy of PRF in accelerating endometrium regeneration in an intrauterine adhesion (IUA) model of rats [9]. In a consequent clinical test, the safety and effectiveness of PRF in treating IUA was further demonstrated which showed significant improved pregnancy rate without treatment relevant adverse events. The injectable platelet-rich fibrin (i-PRF) [10] is a novel pattern of PRF produced by a shorter centrifugation process which remains in a fluid state for nearly 15 min before forming a gel-like structure. Compared with PRP, i-PRF has a three-dimensional framework which facilitates slow releasing of growth factors for a longer lasting time. Meanwhile, the fibrin network orchestrates a 3D structure for ingrowth, proliferation and matrix production by surrounding cells to fulfill the tissue regeneration [11–13].

Mitochondria plays a critical role in regulating cellular metabolic events by providing ATP as energy source. Additionally, growing evidence indicates that mitochondria dysfunction is associated with pathologies of many human disease such cardiovascular diseases, neurodegeneration, diabetes, and cancer [14–17]. In particular, mitochondrial damage in endometrial epithelial cells has been linked to increased risk of pregnancy loss [18]. It was recently reported that mitochondria can be transferred from one cell to another and thus affects function of receipt cells with impaired mitochondria [19]. For example, mitochondria transfer from platelets to mesenchymal stem cells (MSCs) facilitated their wound-healing capacity by promoting pro-angiogenic activity of MSCs. The acquisition of platelet derived mitochondria by MSCs ameliorates 5-FU induced apoptosis and improved their hematopoietic regulatory ability in bone marrow.

Here, we investigated the therapeutic efficacy of i-PRF in improving endometrium receptivity in a thin endometrium model of rats. Our results indicate that mitochondria transferred from platelet to endometrial stromal cells (ESCs) involved in the therapeutic efficacy of i-PRF in treating thin endometrium.

Materials and methods

Animals

Animal studies were reviewed and approved by the Ethics Committee of the Experimental Animal Centre of Xinjiang Medical University, China (issued number: IACUC-JT-20230321-71).Adult female Sprague-Dawley (SD) rats (purchased form the Laboratory Animal Center of Xinjiang Medical University, Urumqi, China) aged 8–10 weeks were housed in the Experimental Animal Centre of Xinjiang Medical University under a 12-hour light-dark cycle, allowing free access to food and water. After one-week adaption, the rats were used in the experiment.

Preparation of i-PRF

The studies were reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University, China (issued number: 20230608-2).The participants provided their written informed consent to participate in this study.Preparation of i-PRF was performed according to protocol by Thanasrisuebwong et al. [11]. In brief, a total of 21 milliliters of blood sample was collected from each subject. Two 10-milliliter samples were immediately placed in 15-ml tube without addition of anticoagulant. Following immediate centrifugation at 87 x g for 3 min, tubes were quickly transferred from centrifuge. Using a syringe, 1 mL of the yellow-orange supernatant was collected from the upper layer of the tube for i-PRF preparation. For samples A1 and A2, the needle bevel was positioned within the upper liquid layer; for samples B1 and B2, it was placed at the interface between the red and yellow phases. This procedure was performed twice to obtain duplicate samples (A1, B1, A2, B2). Each sample was subsequently compared with 1 mL of autologous whole blood (X).

Characterization of i-PRF

Determination of VEGF-A, PDGF-AB and TGF-β1 released from iPRF

Samples of iPRF were placed in 6-well plates and allowed to undergo natural solidification. Following incubation in 2 ml of Dulbecco’s modified Eagle’s medium (DMEM) at 37 °C in a 5% CO2 incubator (Thermo Fisher Scientific, Waltham, MA, USA) for 1 h, 8 h, 24 h, 72 h, 7 days, 11 days, and 15 days, respectively, supernatants of culture medium were collected. The concentration of vascular endothelial growth factor (VEGF-A), platelet-derived growth factor (PDGF-AB) and transforming growth factor-β1 (TGF-β1) was determined by enzyme-linked immunosorbent assay (ELISA).

Scanning electron microscope observation

The freshly prepared i-PRF were placed in 6-well plates and allowed to undergo natural solidification. Following fixation with 2.5% glutaraldehyde (Sigma-Aldrich), samples were dehydrated, freeze-dried and subjected to gold sputter-coating. Microstructure was evaluated under the scanning electron microscope (JEM-1230, JEOL, Japan).

Establishment of thin-endometrium models and i-PRF administration

Female Sprague-Dawley (SD) rats (8–10 weeks old) were randomly assigned to two groups (n = 5 per group). In the first group, to enable paired comparisons within the same animal, one uterine horn was injected with normal saline (control group), while the contralateral horn was injected with 95% ethanol (model group). In the second group, both uterine horns were rendered thin. Two weeks after model induction, one uterine horn was randomly injected with i-PRF (ethanol + i-PRF group) and the contralateral horn was injected with normal saline (ethanol + NS group) as a matched control.

A thin endometrium model was established as previously reported [20]. Briefly, female SD rats were anesthetized with isoflurane (0–5%, Shandong Technology Co., Ltd., China) using a portable small animal anesthesia system (model R500IE, Reward Life Science, China). The abdominal wall was surgically opened and the bilateral uteri were exposed under sterile conditions. At the junction near the uterine horn, one side was clamped with a vascular clamp. Approximately 300 µL of 95% ethanol was injected from the distal end of the uterine horn and retained in the uterine cavity for 5 min. The uterus was then rinsed with normal saline and the clamp was released. The contralateral uterine horn was injected with 300 µL of normal saline and rinsed with saline twice as a control. Two weeks after model establishment, under isoflurane anesthesia, blood was drawn from the abdominal aorta as completely as possible and used immediately to prepare i-PRF. Subsequently, the rats were euthanized and uterine tissues were rapidly collected for histological examination.

The treatment schedule was as follows: Day 0, injection of 95% ethanol or normal saline; Day 14, injection of i-PRF or normal saline; Day 28, tissue collection for histological and molecular analyses, or fertility assessment via cohousing with male rats.

Histology and immunohistochemistry

The harvested uterus was fixed in 4% paraformaldehyde (PFA), dehydrated, embedded in paraffin and sliced into 5-µm sections. Structures of the uterus was analyzed by hematoxylin-eosin (H&E) staining. Thickness of endometrium wall, the number of endometrial glands was calculated with Image J software.

Immunohistochemistry staining was performed by blocking endogenous peroxidase with 3% hydrogen peroxide in methanol for 10 min, followed by addition of 1% bovine serum albumin (BSA). Following incubation overnight at 4 °C with primary antibodies including rabbit anti-LIF (Leukemia Inhibitory Factor; Affinity Biosciences, Jiangsu, China; Cat# DF13730; dilution 1:1000), rabbit anti-VEGF (Vascular Endothelial Growth Factor; Affinity Biosciences, Jiangsu, China; Cat# AF5131; dilution 1:1000), rabbit anti-Ki67 (Abcam, Cambridge, UK; Cat# ab279653, Clone B56; dilution 1:500), rabbit anti-Vimentin (Abcam, Cambridge, UK; Cat# ab92547, Clone EPR3776; dilution 1:2000), rabbit anti-Cytokeratin 18 antibody (abcam, Cambridge, UK; Cat#ab133263, Clone EPR1626; 1:50). Tissue sections were incubated with a streptavidin-biotin-peroxidase complex (SABC) for 30 min at 37 °C. 3,3′-Diaminobenzidine (DAB) served as the chromogen for color development. Sections were counterstained with hematoxylin, dehydrated through a graded ethanol series, cleared in xylene, and mounted with a synthetic resin-based medium. Negative controls were performed by replacing the primary antibodies with phosphate-buffered saline (PBS) or non-immune serum. Images were acquired using a brightfield microscope (Olympus, Tokyo, Japan) and analyzed using ImageJ software (National Institutes of Health, USA).

Fertility test

At the 3rd week post-injection (95% ethanol or i-PRF), individual female rat in each group(n = 8) was housed with healthy male rat at a ratio of 1:1 to evaluate function of endometrium in supporting pregnancy. After 2 weeks of the observed presence of a vaginal plug, the number of implanted embryos in each side of uterine horn was calculated.

Platelet preparation and inhibition of mitochondrial respiration

Platelets were isolated from blood of female SD rats by centrifugation as described previously [21]. On average, 1.0 × 10^9 platelets were obtained from 2 to 3 mL of blood. To inhibit mitochondrial respiration, platelets were treated for 1 h with 2 µM oligomycin (ab141829-1 mg, Abcam, Britain) and 2 µM FCCP (C2920-10MG, Sigma, USA), respectively, followed by washing 3 times (900 x g at 22℃ for 15 min) in serum free DMEM containing heparin (40 U/ml) to avoid platelet activation and aggregation.

Labeling of mitochondria in platelets

Platelet precipitate pellet was obtained by centrifugation and added to a pre-warmed staining solution containing MitoTracker^® (40 nM, Invitrogen, Cat# M7514). Following incubation for 20–40 min, the solution was subjected to centrifugation and platelets at bottom were resuspended in fresh serum free DMEM-F12 medium.

Evaluation of mitochondria transfer from platelets to ESCs

To observe transfer of mitochondria from rats platelets to ESCs, ESCs were labelled with wheat germ agglutinin (WGA) conjugated to Alexa Fluor 647 (5 mg/mL; Invitrogen, Cat# W32466). Afterwards, ESCs (2 × 10^5 cells/well) were co-cultured with rats platelets (8 × 10^7 platelets/mL) that previously labelled with MitoTracker^® for 24 h. The presence of mouse platelet-derived mitochondria in ESCs was detected by LSM800 confocal microscopy (Zeiss).

Isolation and culture of endometrial stromal cells (ESCs)

Isolation of rat endometrial stromal cells (ESCs)

Freshly harvested uterine horns from 8-week-old female rat were trimmed and rinsed with phosphate-buffered saline (PBS), followed by incubation with HBSS containing 1 mg/mL type I collagenase (Invitrogen) and 50 IU/mL penicillin-streptomycin (Invitrogen) for 90 min at 37 °C. After being passed through a 70-µm cell strainer, residual tissue was digested with 0.25% trypsin-EDTA (Gibco, Grand Island, NY, USA) for five minutes at room temperature. The cells obtained were resuspended in Dulbecco’s modified eagle medium (DMEM) containing 10% fetal bovine serum (FBS, HyClone, Logan, Utah, USA) and 50 IU/mL penicillin-streptomycin. Cell cultures were maintained in a humidified incubator (Thermo Fisher Scientific, Waltham, MA, USA) under 5% CO2 at 37 °C.

Immunofluorescent staining of endometrial stromal cells (ESC)

Immunofluorescent staining of ESCs was performed by incubating cells with monoclonal mouse anti-vimentin antibody (1:1,000, ab8978, abcam) and monoclonal rabbit anti-Cytokeratin 18 antibody (1:300, ab133263, abcam), respectively. TRITC-conjugated anti-mouse IgG (goat, 1:50, abcam) and FITC-conjugated anti-rabbit IgG (goat, 1:50, abcam) were added as secondary antibody as indicated. Cells were observed under laser confocal microscope (Leica Microsystems, Wetzlar, Germany).

Co-culture of ESC cells with platelets

ESCs at passage 2 were co-cultured with platelets by adding isolated platelets at indicated concentration (4 × 10⁷, 8 × 10⁷/ml) for 24 h. Proliferation of endometrial stromal cells was detected by cell-counting assay and immunofluorescence staining of Ki-67. The level of VEGF secretion by ESCs that exposed to platelets for 24 h were measured by enzyme-linked immunosorbent (ELISA) assays according to the manufacturer’s instructions. The supernatant was obtained by centrifuging co-culture medium at 4,300 rpm for 5 min to remove cell debris and platelets.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The total RNA was extracted from ESCs cultured with or without platelets with Trizol (Invitrogen, CA, USA). The cDNA was synthesized using the HiScript III RT SuperMix for qPCR (Vazyme, Nanjing, China), in accordance with the manufacturer’s protocol. Real-time quantitative PCR analysis was performed with the ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) using Real-Time PCR Systems (Bio-Rad, Foster City, CA, USA). The expression of mRNAs was calculated from the comparative threshold cycle (Ct) values and normalized to glyceraldehyde-3-phosphate dehydrogenase (Gapdh). The primer sequences used in real-time PCR are listed in Table 1.

Table 1.

Quantitative polymerase chain reaction (qPCR) primer sequences

Primers name		Primers sequences
H-Ki67	FORWARD	TCCAAGCCACAGTCCAAGAGAAG
	REVERSE	GCCTGCTGATGGTGTTCGTTTC
H-Vimentin	FORWARD	TGACCGCTTCGCCAACTACATC
	REVERSE	TCCCGCATCTCCTCCTCGTAG
H-VEGFA	FORWARD	CCTTGCCTTGCTGCTCTACCTC
	REVERSE	GATGATTCTGCCCTCCTCCTTCTG
H-GAPDH	FORWARD	CGGCAAGTTCAACGGCTGAT
	REVERSE	GACATACTCAGCACCAGCCATT

Western blot

ESCs were harvested and re-suspended in cell lysis buffer. Following centrifugation, protein concentration in the supernatant was quantified using the BCA protein quantification kit (Solarbio, Beijing, China). SDS-PAGE (Biotides, Beijing, China) was used for protein separation, followed by transfer to PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 5% fat-free milk in Tris-buffered saline containing 0.1% Tween 20. Primary antibodies against Vimentin (1:4000, Abcam ab92547); VEGF (1:1000, Affinity Biosciences Cat# AF5131); LIF (1:1000, Affinity Biosciences Cat# DF13730); Bcl-2 (1:1000, Affinity Biosciences Cat# AF6139); Bax (1:5000, Abcam ab32503), GAPDH (1:5000, Affinity Biosciences Cat# AF7021) were incubated at 4 °C overnight, respectively. After washing with TBST for three times, membranes were incubated with species-matched horseradish peroxidase (HRP)-conjugated secondary antibodies (Boster, Wuhan, China) for 1 h at room temperature. Protein signals were visualized using an ECL chemiluminescence substrate (Biosharp, Hefei, China) and quantified via ImageJ software (NIH).

Statistical analysis

All values are presented as mean ± standard deviation (SD). Data were analyzed by one-way analysis of variance (ANOVA), followed by Bonferroni’s post hoc test for multiple comparisons, using GraphPad Prism version 8.4.0. Comparisons between two groups were performed using the two-tailed unpaired Student’s t-test. A P value < 0.05 was considered statistically significant.

Results

Characterization of i-PRF

In our study, we centrifuged whole blood, which separated into two distinct layers visible to the naked eye, with the upper layer exhibiting a yellowish hue (Fig. 1A). To maximize the extraction of i-PRF, we employed two sequential extraction methods (Methods A and B), collecting 1 mL of i-PRF at each step. We then analyzed the hematocrit composition of each sample and evaluated the release patterns of growth factors in the dialysate. The results demonstrated that A1 was comparable to B1, while A2 and B2 exhibited similarities to whole blood (X) (Fig. 1).

Fig. 1.

Preparation and Characterization of i-PRF. A The upper yellow-orange colored liquid within tube was collected for preparing i-PRF. B, C, D Comparison of platelet, leukocyte and erythrocyte contents in five samples, respectively. E Sample coagulation. F Dialysate after incubation of each sample.G Scanning electron microscope images of i-PRF and whole blood, with the arrow denoting the platelet(scale bar = 10 μm). H, I, J VEGF-A, PDGF-AB, and TGF-β1 at different time points release pattern of VEGF-A, PDGF-AB and TGF-β1.Data are shown as mean ± SD(n = 3). *p < 0.05

The platelet concentration in A1 was significantly higher than that of whole blood, approximately 1.3–2.0 times greater, with a statistically significant difference (P < 0.02, n = 3) (Fig. 1B). Additionally, A1 showed the highest white blood cell content and the lowest erythrocyte content; however, these differences were not statistically significant (P < 0.1 and P = 0.11, respectively, n = 3) (Fig. 1C, D). Each sample transitioned from a liquid to a gel-like solid state within approximately 20 min (Fig. 1E). The secretion of growth factors, including VEGF-A, TGF-β1, and PDGF-AB, into the dialysate persisted for 15 days, with peak concentrations observed within the first 7 days (Fig. 1H, I, J). Scanning electron microscopy revealed that A1 samples exhibited a higher number of platelets and leukocytes embedded within a three-dimensional fibrous network composed predominantly of fibronectin (Fig. 1G).

i-PRF improves thin endometrium in rats

Animals were divided into control, Model, Ethanol + NS, Ethanol + i-PRF groups (5 in each group) in this study (Fig. 2A). As shown in Fig. 2B, morphology of normal uteri displayed a white color with smooth appearance. While, uterus received ethanol injection displayed an irregular morphology with uterine fluid at 14 days post-injection. Histologically, whole thickness of uterus wall was remarkably in ethanol injected uterus, with missing of inner layer of epithelial cells. With administration of i-PRF, an intact epithelium layer was restored, and enlarged uteri cavity was decreased. The average thickness of normal endometrium of rat uterus was 409.27 ± 55.86 μm, comparable to that in model group (104.48 ± 57.03 μm); while, ethanol injection resulted a significant decrease (P < 0.05). Administration of i-PRF enhanced the average thickness to 464.11 ± 27.10 μm, which is significantly higher than ethanol treated endometrium (100.38 ± 32.76 μm, P < 0.05). The number of endometrium glands in the ethanol treated uterus (9.2 ± 3.77) was significantly lower than that in control (22.4 ± 4.34(P < 0.05) group. Again, i-PRF treatment led to marked increase of gland number (29.0 ± 9.41, P < 0.05) as compared with Ethanol + NS group (12.00 ± 6.63, P < 0.05). Furthermore, in comparison with that in Ethanol + NS group, immunohistochemistry showed significant increase in number of vimentin, CK-18 and Ki67-positive cells in uterus received i-PRF injection, indicating a robust regeneration event in damaged endometrium induced by i-PRF.

Fig. 2.

Uterine morphological features and changes after i-PRF treatment. A and B Experimental timeline and grouping. Gross view of representative uteri from each group (scale bar = 5 cm). C H&E staining of uterine cross-sections (×50 upper row, ×100 lower row; scale bar = 500 μm and 200 μm respectively). D Endometrial thickness (µm). E Number of endometrial glands. F Endometrial area (µm²) per section. Data are mean ± SD (n = 5 per group). *p < 0.05, **p < 0.01, ***p < 0.001

Assessment of endometrial tolerance and functional recovery

Poor receptivity for embryo implantation in thin endometrium has been attributed to impaired angiogenesis and endometrial cell regeneration, which is strictly regulated by VEGF and Vimentin, and decreased expression of LIF secreted by glands. We thus investigated expression of Vimentin, VEGF and LIF in endometrium of different groups. Immunohistochemistry results showed that expression of Vimentin, VEGF and LIF was markedly decreased in ethanol treated uterus, which was highly recovered by administration of i-PRF. This was further confirmed by Western Blot detection and corresponding quantitative analysis. Meanwhile, expression of apoptosis-related proteins BCL-2 was down-regulated, while BAX was up-regulated in thin endometrium. Within uterus treated with i-PRF, dysregulated expression of BCL-2 and BAX was significantly reversed (p < 0.05) (Fig. 3I).

Fig. 3.

Effects of i-PRF on endometrial epithelial and interstitial cell proliferation. A Immunohistochemistry for Vimentin in each group (×100 upper row, ×400 lower row, scale bar = 100 μm and 20 μm respectively). B Immunohistochemistry for CK-18 in each group (×50 upper row, ×400 lower row, scale bar = 100 μm and 20 μm respectively). C Immunohistochemistry for Ki-67 in each group (×100 upper row, ×400 lower row. scale bar = 100 μm and 20 μm respectively). D the integrated optical density (IOD) of Ki-67-positive cells. All data are representative images. Each dot represents an independent experiment. Bar graphs represent mean ± SD. n = 3 per group. *p < 0.05

To further assess the functional improvement of i-PRF on thin endometrium, female rats in different groups were mated and embryo implantation efficiency was investigated. The number of pregnant uterine horns, percentage of pregnant uterine horns and total number of implanted fetus in different groups was presented in Table 2. Compared with the Model group ( 0.00 ± 0.00), Ethanol+i-PRF Group (3.88 ± 3.91) exhibited a significantly higher number of embryos (P < 0.001) .The mean embryo number in Ethanol+i-PRF Group was numerically logroups (P > 0.05) (Fig.4I).

Table 2.

Embryo breeding status uterus in all groups

Variable	control	Model	Ethanol + NS	Ethanol + i-PRF
Total number of uterine horns	8	8	8	8
Number of pregnant uterine horns	6	0	3	5
Percentage of pregnant uterine horns	75%	0	37.5%	62.5%
Total number of fetuses	40	0	11	31

Comparison of reproductive outcomes among groups. Embryo breeding status of the uterus in all groups

Fig. 4.

Analysis of endometrial tolerance and embryo implantation. A and C Immunohistochemical staining of LIF and VEGF-A. B and D IOD analysis was shown in right panel. E Western blot of Vimentin 、VEGF and LIF expression and corresponding analysis. F Relative protein level of Vimentin 、VEGF-A and LIF. G Western blot of BAX and BCL-2. H Relative protein level of BAX and BCL-2. I Embryo implantation outcomes in different groups

Co-culture with platelets enhance proliferation and VEGF production by ESCs

After passaging, endometrial stromal cells (ESCs) displayed a uniform spindle fibroblast-like shape (Fig. 5A), which is positive for vimentin and CK-18 negative, indicating undetectable presence of epithelial cells (Fig. 5B). Double immunofluorescent staining showed that co-culture with platelets resulted in a dose-dependent increase of Ki-67 positive cells (red) in vimentin+ ESCs (green) (Fig. 5D). Quantitatively, both ESCs counting and percentage of Ki-67 + cells was significantly enhanced by addition of either 4 × 10⁷or 8 × 10⁷ platelets, whereas the difference in percentage of Ki-67 + cells showed no significance between 4 × 10⁷ or 8 × 10⁷ platelets (P > 0.05) (Fig. 5F).

Fig. 5.

ESCs co-cultured with platelets at different concentrations. A Isolation and culture of ESC from fresh isolated rat uterine tissue. B Microscopic observation and immunofluorescent staining (vimentin and CK18) of ESCs (scale bar = 75 μm). C platelets were isolated from whole blood of rats and were labelled with mitochondrial marker MitoTracker ^®.D Double fluorescent staining of vimentin(green) and Ki67(red) in ESCs co-cultured for 24 h with platelets at concentration of 4 × 107(Plts4), 8 × 107 (Plts8) platelets/ml respectively (scale bar = 75 μm). E Quantitative analysis of cell counting. F percentage of Ki67 positive cells was shown in right panel. G Secretion level of VEGF from ESCs alone, ESCs co-cultured with Plts4 or Plts8, and Plts4, Plts8 alone.*p < 0.05, **p < 0.01, ***p < 0.001,****p < 0.0001,ns, no significance. Each dot represents an independent experiment in (E)–(G). Bar graphs represent mean ± SD(n = 5)

Platelets of different concentrations were cultured alone or with ESCs for 24 h, and then the level of VEGF in the culture medium was determined by ELISA. Platelets cultured alone, at dose of either 4 × 10⁷ or 8 × 10⁷ platelets, showed negligible VEGF levels. Co-culture of ESCs with platelets at 4 × 10⁷ or 8 × 10⁷ concentrations led to significant increase in VEGF levels (both P < 0.01), respectively; the increase was platelet dose dependent (Fig. 5G).

Transfer of labelled platelet mitochondria to ESCs

Through the two-step procedure, platelets were isolated from whole blood of rats and were labelled with the live cell mitochondrial marker MitoTracker^® (Fig. 5C). To determine whether ESCs received mitochondria transfer from platelets, we co-cultured WGA labelled ESCs (red) (Fig. 6A) for 24 h with platelets pre-labelled with MitoTracker Green (Fig. 6B). By confocal microscopy observation, we could observe presence of green MitoTracker Green signals within most of the WGA labelled ESCs (Fig. 6C), indicating the transfer of mitochondria from platelets to ESCs. We next treated platelets with Oligomycin/FCCP to inhibit the respiratory function in their mitochondria and then incubated with ESCs for 24 h (Fig. 6D). We found that percentage of Ki67 + cells and mRNA level of Ki67 was significantly increased in ESCs co-cultured with platelets (Fig. 6E, F). Whereas, this increase was not significantly affected by Oligomycin/FCCP treatment, indicating the pro-proliferation effect of platelets on ESCs was not mitochondria transfer dependent.

Fig. 6.

Platelet-derived mitochondria promote activity of ESCs. A Laser confocal microscopy images of WGA labeled ESCs (scale bar = 75 μm). B Laser confocal microscopy images of MitoTracker Green pre-labeled platelets. C Laser confocal microscopy images of WGA labeled ESCs co-cultured for 24 h with MitoTracker Green pre-labeled platelets that treated with/without Oligomycin/FCCP(n = 5). D Immunostaining of Ki67(red) in ESCs alone, ESCs co-cultured for 24 h with platelets treated with/without Oligomycin/FCCP. Nuclei were stained with DAPI. (scale bar = 100 μm). E–F Ki67 positive cells(%) and relative Ki67 mRNA level in ESCs alone, ESCs incubated with Oligomycin/FCCP-treated or non-treated platelets(8 × 10⁷/ml) for 24 h(n = 3). G–J Western blot of VEGF, vimentin, BAX and BCL-2 in ESCs, ESCs cocultured for 24-h with platelets treated with or without Oligomycin/FCCP. K,L Relative VEGF mRNA level and Relative VEGF mRNA level in ESCs after 24-h incubation with untreated or Oligomycin/FCCP-treated platelets

We next investigated the influence of respiratory function inhibition on pro-angiogenesis and endometrial tolerance markers expression of ESCs co-cultured with platelets. The results showed that the enhancement in expression of VEGF and vimentin in ESCs co-cultured with platelets was significantly suppressed when platelets were pre-treated with Oligomycin/FCCP, at both protein and mRNA level, as determined by western-blot (Fig. 6G–I) and real-time RT-PCR (Fig. 6J–L). The expression of VEGF and vimentin in ESCs co-cultured with treated platelets returned to a level comparable to that in ESCs cultured alone. These results suggest that the improvement in angiogenesis and endometrial tolerance in ESCs elicited by platelets largely depends on mitochondria transfer.

Discussion

The effectiveness of platelet derivatives on improving repair and regeneration of impaired endometrium has been well accepted [22]. The beneficial outcomes of platelet derivatives in treating damaged endometrium has been attributed to the promotion of cellular proliferation and endometrial neovascularisation by paracrine factors released by activated platelets [23]. In clinic, intrauterine infusion of PRP successfully improved pregnancy of patients with thin endometrium [24]. Moreover, it was reported that PRP treatment highly enhanced therapeutic effect of bone marrow MSCs in increasing endometrial regeneration in a rat model [25].

Compared with PRP, i-PRF was processed without addition of anticoagulant and can maintain in liquid state within 15 min following preparation, which endorses it injectable for delivering directly into the uterine cavity [26]. Resident large amount of platelets adhering to the three-dimensional fibrin release growth factors in a controllable and time dependent manner [26]. In the present study, we found that the secretion of VEGF-A, TGF-β1, and PDGF-AB growth factors in i-PRF can last for nearly 15 days, with a peak in the beginning 7 days. With secretion of these growth factors, cellular proliferation, neo-vascularization and local immune response was restored, respectively, which orchestrates a microenvironment facilitating endometrium regeneration. Following intrauterine injection of i-PRF, the thickness, area of endometrium and number of glands in endometrium was increased to a comparable level as that of normal endometrium. The improvement of histological structure in thin endometrium induced by i-PRF administration can be ascribed to cellular proliferation in response to growth factor released from i-PRF, which is indicated by robust increase of ki67 positive cells in damaged endometrium. In fact, we found that both epithelial and stromal cells in endometrium was activated to proliferate as indicated by increased ki67-positive cells in CK-18 and vimentin positive cells, respectively.

Endometrial receptivity depends on sufficient blood supply to uterine wall and well organized interplay between endometrial stroma and embryo [27]. By co-culturing i-PRF, we found that expression VEGF was largely enhanced in ESCs. Consistent with the in vitro study, in vivo results displayed significant enhancement in VEGF expression in thin endometrium treated with i-PRF. LIF plays a key role in the process of embryo implantation by modulating uterine receptors expression in endometrial cells. Our results showed i-PRF administration resulted in enhancement of LIF expression in thin endometrium. More importantly, the number of embryo implantation was concomitantly increased with introduction of i-PRF in rat model of thin endometrium. Together, these results demonstrated an improved endometrial receptivity elicited by i-PRF injection into thin endometrium uterine.

As above mentioned, the pro-regenerative efficacy of platelet concentrates has been widely documented owing to their release of multiple growth factors [28]. However, we discovered mitochondria translocation from platelets to ESCs, an alternative way by which platelets affect biological behavior of ESCs in addition to growth factor release. Mitochondria transfer play a crucial role in regulation of cellular metabolism, improving respiratory function and rescuing energy metabolism in damaged cells [19]. To demonstrate the involvement of platelet mitochondria in the reparative effects of endometrial cells, we pretreated platelets with oligomycin and FCCP to inhibit platelet mitochondrial respiratory function. This loss-of-function study showed that, with pre-treated with Oligomycin/FCCP, proliferation and VEGF expression in ESCs was remarkably suppressed, indicating that mitochondria transfer deeply involved in the promotion of regenerative capacity of ESCs induced by i-PRF.

The precise mechanism by which mitochondria are transferred from platelets to ESCs remains to be fully elucidated. However, two main pathways have been described in intercellular mitochondrial transfer: tunneling nanotubes (TNTs) and extracellular vesicles (EVs). TNTs are F-actin-based membrane protrusions that establish direct cytoplasmic connections between cells, allowing the transport of organelles including mitochondria. Alternatively, mitochondria can be packaged into EVs (e.g., exosomes or microvesicles) and released by donor cells, followed by uptake by recipient cells. Both mechanisms have been reported in platelet-mediated mitochondrial transfer to mesenchymal stem cells and other cell types. Future studies are needed to determine whether TNTs, EVs, or both contribute to platelet-to-ESC mitochondrial transfer in the context of endometrial repair.”

Several limitations of this study should be acknowledged. First, the sample size in each experimental group was relatively small (n = 5 per group for most in vivo experiments), which may limit the statistical power and generalizability of the findings. Second, while the rat model of ethanol-induced thin endometrium recapitulates certain histological features of the human condition, it does not fully reflect the complex etiology and chronic nature of thin endometrium in patients, particularly those with recurrent intrauterine adhesions or idiopathic thin endometrium. Therefore, the translational relevance of our results requires confirmation in larger animal models and ultimately in clinical trials. Third, although we demonstrated mitochondrial transfer from platelets to ESCs using MitoTracker labelling and observed that inhibition of platelet mitochondrial respiration attenuated the pro-angiogenic and pro-repair effects, the precise molecular mechanisms by which transferred mitochondria enhance ESC function remain incompletely defined. For instance, whether the effect is mediated by restoration of ESC ATP levels, modulation of reactive oxygen species, or downstream signalling pathways such as AMPK or mTOR requires further investigation.At last we did not directly compare i-PRF with conventional PRP. While previous reports have established that i-PRF offers a more prolonged growth factor release and a three-dimensional fibrin network, future studies should include a PRP treatment arm to determine whether the observed mitochondrial transfer and regenerative effects are different between i-PRF and PRP.

Conclusion

Our research results indicate that i-PRF has a significant promoting effect on the regeneration of the damaged endometrium in the thin endometrium rat model, and can effectively promote the proliferation of endometrial stromal cells and angiogenesis. Besides continuously releasing various growth factors to exert its effect, our research also shows that the mitochondria transferred from platelets to endometrial stromal cells also play a repair role in it. This reveals a previously unrecognized mechanism of the therapeutic effect of i-PRF.

Abbreviations

i

PRF injectable platelet rich fibrin

ESCs

 Endometrial stromal cells

MSCs

Mesenchymal stem cells

TE

Thin endometrium

PRP

 Platelet-rich plasma

PRF

Platelet-rich fibrin

LIF

Leukemia Inhibitory Factor

VEGF

Vascular endothelial growth factor

DMEM

Dulbecco’s modified Eagle’s mediu

IUA

Intrauterine adhesion

Author contributions

H.T contributed to conceptualization, experimental design, methodology, project administration, writing original manuscript and funding acquisition; Y.Z and M.Z carried out the experiments, performed statistical analysis.carried out validation, data curation and visualization; Z.Z and N.S carried outthe experiments, the investigation, data curation; H.M and M.Z participated in the investigation, data and resources; X.L contributed to conceptualization and sample collection; L.C were responsible for writing, revising and editing the manuscript; J.D were responsible for project conception, revising and editing the manuscript; J.D and H.T are the corresponding authors.All authors read and approved the final manuscript.

Funding

This work was financially sponsored by Natural Science Foundation of Xinjiang (NO. 2021D01C296).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author.

Declarations

Ethics approval and consent to participate

The studies involving human participants were reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University, China (20230608-2 which was issued on June 12th, 2023).This study was conducted and reported in accordance with the ARRIVE guidelines 2.0. The title of the approved project is “[Treatment of thin endometrium with platelet concentrate products administered into uterine cavity]”.The participants provided their written informed consent to participate in this study. Animal studies were reviewed and approved by the Ethics Committee of the Experimental Animal Centre of Xinjiang Medical University, China (issued number IACUC-JT-20230321-71 on March 21 st, 2023). Title of the approved project: The investigation of injectable platelet rich fibrin (i-PRF) on improving thin endometrium in a rat model.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.